Translate this page to:
In JoVE (1)
- Nano-fEM: Protein Localization Using Photo-activated Localization Microscopy and Electron Microscopy
Other Publications (200)
- BMC Neurology
- Nutrition & Metabolism
- Twin Research and Human Genetics : the Official Journal of the International Society for Twin Studies
- Pediatric Nephrology (Berlin, Germany)
- Biogerontology
- Nutrients
- Hawai'i Journal of Medicine & Public Health : a Journal of Asia Pacific Medicine & Public Health
- BJU International
- Pediatric Clinics of North America
- Expert Opinion on Pharmacotherapy
- Preventing Chronic Disease
- The Journal of Emergency Medicine
- Bioorganic & Medicinal Chemistry
- Journal of Neurosurgery
- Journal of Emergency Nursing: JEN : Official Publication of the Emergency Department Nurses Association
- Environmental Research
- Developmental Cell
- Archives of Physical Medicine and Rehabilitation
- Current Opinion in Supportive and Palliative Care
- International Journal of Palliative Nursing
- Environmental Health Perspectives
- Journal of Health Care for the Poor and Underserved
- Journal of Health Care for the Poor and Underserved
- Maternal and Child Health Journal
- European Journal of Immunology
- Cleveland Clinic Journal of Medicine
- Acta Crystallographica. Section E, Structure Reports Online
- The Review of Scientific Instruments
- The Review of Scientific Instruments
- The Review of Scientific Instruments
- Orthopedics
- Rural and Remote Health
- Journal of Burn Care & Research : Official Publication of the American Burn Association
- Pest Management Science
- Proceedings of the National Academy of Sciences of the United States of America
- Journal of Neurology, Neurosurgery, and Psychiatry
- Journal of the American Heart Association
- International Journal of Audiology
- American Journal of Obstetrics and Gynecology
- Wilderness & Environmental Medicine
- Journal of Pediatric Gastroenterology and Nutrition
- AIDS and Behavior
- Neuropsychopharmacology : Official Publication of the American College of Neuropsychopharmacology
- The Pan African Medical Journal
- HPB : the Official Journal of the International Hepato Pancreato Biliary Association
- BMC Public Health
- Archives of Disease in Childhood. Fetal and Neonatal Edition
- American Journal of Health-system Pharmacy : AJHP : Official Journal of the American Society of Health-System Pharmacists
- Journal of Virology
- The Journal of General Virology
- Archives of Physiology and Biochemistry
- The Journal of Supportive Oncology
- Journal of Investigative Medicine : the Official Publication of the American Federation for Clinical Research
- Alzheimer Disease and Associated Disorders
- Current Urology Reports
- Nature Biotechnology
- Science and Engineering Ethics
- Arteriosclerosis, Thrombosis, and Vascular Biology
- Social Work Research
- PloS One
- Ethnicity & Disease
- Cell
- Journal of Cataract and Refractive Surgery
- Toxicology and Applied Pharmacology
- Gastroenterology
- Plastic and Reconstructive Surgery
- European Journal of Clinical Pharmacology
- Nature
- Nature Genetics
- Toxicological Sciences : an Official Journal of the Society of Toxicology
- Journal of Bacteriology
- American Journal of Physiology. Lung Cellular and Molecular Physiology
- Expert Review of Endocrinology & Metabolism
- PloS One
- PloS One
- PloS One
- American Journal of Translational Research
- The Journal of the Acoustical Society of America
- Journal of Food Science
- Biomacromolecules
- Lymphatic Research and Biology
- Resuscitation
- The Journal of Trauma and Acute Care Surgery
- Molecular Phylogenetics and Evolution
- The Journal of Biological Chemistry
- Radiation Research
- BioData Mining
- Climacteric : the Journal of the International Menopause Society
- Trials
- The Journal of Pediatrics
- Surgery for Obesity and Related Diseases : Official Journal of the American Society for Bariatric Surgery
- Social Science & Medicine (1982)
- Journal of Cancer Education : the Official Journal of the American Association for Cancer Education
- International Journal of Cancer. Journal International Du Cancer
- Investigative Ophthalmology & Visual Science
- The Journal of Hand Surgery, European Volume
- Annals of Dyslexia
- PloS One
- PloS One
- Journal of Microbiological Methods
- Archives of Neurology
- Archives of Dermatology
- PloS One
- PloS One
- Journal of the Academy of Nutrition and Dietetics
- Mucosal Immunology
- Dermatitis : Contact, Atopic, Occupational, Drug : Official Journal of the American Contact Dermatitis Society, North American Contact Dermatitis Group
- Clinical Chemistry
- The Journal of Infectious Diseases
- The Journal of Infectious Diseases
- Circulation. Cardiovascular Imaging
- Chiropractic & Manual Therapies
- American Journal of Physiology. Renal Physiology
- Emerging Infectious Diseases
- International Journal of Epidemiology
- Nature
- Journal of Pharmacy Practice
- Development (Cambridge, England)
- Thyroid : Official Journal of the American Thyroid Association
- Prehospital and Disaster Medicine
- Endeavour
- The Journal of Adolescent Health : Official Publication of the Society for Adolescent Medicine
- International Journal for Quality in Health Care : Journal of the International Society for Quality in Health Care / ISQua
- Tetrahedron Letters
- The Journal of Neuroscience : the Official Journal of the Society for Neuroscience
- Journal of AOAC International
- Biochemical Society Transactions
- Analytical Chemistry
- Nutrition Research (New York, N.Y.)
- Annals of Allergy, Asthma & Immunology : Official Publication of the American College of Allergy, Asthma, & Immunology
- The Annals of Thoracic Surgery
- Microscopy and Microanalysis : the Official Journal of Microscopy Society of America, Microbeam Analysis Society, Microscopical Society of Canada
- Current Biology : CB
- AORN Journal
- Endeavour
- Nature Cell Biology
- Age and Ageing
- The European Respiratory Journal : Official Journal of the European Society for Clinical Respiratory Physiology
- Database : the Journal of Biological Databases and Curation
- Organic Syntheses; an Annual Publication of Satisfactory Methods for the Preparation of Organic Chemicals
- Journal of Oncology Practice / American Society of Clinical Oncology
- Frontiers in Oncology
- Environmental Science & Technology
- Journal of Pain and Symptom Management
- Parkinsonism & Related Disorders
- Sexual & Reproductive Healthcare : Official Journal of the Swedish Association of Midwives
- Women and Birth : Journal of the Australian College of Midwives
- Marine Environmental Research
- The Lancet Infectious Diseases
- MAbs
- Australian Veterinary Journal
- Journal of Neural Engineering
- Progress in Transplantation (Aliso Viejo, Calif.)
- The American Journal of the Medical Sciences
- Chest
- BMJ Open
- Pediatric Emergency Care
- The Journal of Trauma and Acute Care Surgery
- The Journal of Trauma and Acute Care Surgery
- Scientific Reports
- Dentistry Today
- Journal of Applied Biomechanics
- Clinical Chemistry
- Nucleic Acids Research
- Analytical Chemistry
- Journal of Child Sexual Abuse
- American Heart Journal
- Molecular and Cellular Probes
- Eye (London, England)
- Stem Cells Translational Medicine
- Proceedings. Mathematical, Physical, and Engineering Sciences / the Royal Society
- Phytochemistry
- American Journal of Obstetrics and Gynecology
- Pain Physician
- Chemical Communications (Cambridge, England)
- Annals of Surgery
- Nature Immunology
- Organic & Biomolecular Chemistry
- Journal of Child Health Care : for Professionals Working with Children in the Hospital and Community
- Frontiers in Immunology
- Water Quality, Exposure, and Health
- Surgical Infections
- Ocular Immunology and Inflammation
- Public Health Nutrition
- The Journal of Urology
- European Journal of Vascular and Endovascular Surgery : the Official Journal of the European Society for Vascular Surgery
- Academic Psychiatry : the Journal of the American Association of Directors of Psychiatric Residency Training and the Association for Academic Psychiatry
- PloS One
- Journal of Pediatric Endocrinology & Metabolism : JPEM
- The Physiologist
- Journal of Economic Entomology
- Human Factors
- American Journal of Preventive Medicine
- Seminars in Roentgenology
- The New Phytologist
- Chemical Communications (Cambridge, England)
- The Surgical Clinics of North America
- The Surgical Clinics of North America
- The Analyst
- Water Research
Articles by Wayne M. Davis in JoVE
Nano-fEM: Protein Localization Using Photo-activated Localization Microscopy and Electron Microscopy
Shigeki Watanabe, Jackson Richards, Gunther Hollopeter, Robert J. Hobson, Wayne M. Davis, Erik M. Jorgensen
Department of Biology, Howard Hughes Medical Institute, University of Utah
We describe a method to localize fluorescently tagged proteins in electron micrographs. Fluorescence is first localized using photo-activated localization microscopy on ultrathin sections. These images are then aligned to electron micrographs of the same section.
Other articles by Wayne M. Davis on PubMed
The Association Between Cognitive Function and White Matter Lesion Location in Older Adults: a Systematic Review
BMC Neurology. Oct, 2012 | Pubmed ID: 23110387
ABSTRACT: BACKGROUND: Maintaining cognitive function is essential for healthy aging and to function autonomously within society. White matter lesions (WMLs) are associated with reduced cognitive function in older adults. However, whether their anatomical location moderates these associations is not well-established. This review systematically evaluates peer-reviewed evidence on the role of anatomical location in the association between WMLs and cognitive function. METHODS: In accordance with the preferred reporting items for systematic reviews and meta-analysis (PRISMA) statement, databases of EMBASE, PUBMED, MEDLINE, and CINAHL, supplemented by reference lists were searched. We limited our search results to adults aged 60 years and older, and studies published in the English language from 2000 to 2011. Studies that investigated the association between cognitive function and WML location were included. Two independent reviewers extracted: 1) study characteristics including sample size, sample characteristic, and study design; 2) WML outcomes including WML location, WML quantification method (scoring or volume measurement), strength of the MRI magnet in Tesla, and MRI sequence used for WML detection; and 3) cognitive function outcomes including cognitive tests for two cognitive domains of memory and executive function/processing speed. RESULTS: Of the 14 studies included, seven compared the association of subcortical versus periventricular WMLs with cognitive function. Seven other studies investigated the association between WMLs in specific brain regions (e.g., frontal, parietal lobes) and cognitive function. Overall, the results show that a greater number of studies have found an association between periventricular WMLs and executive function/processing speed, than subcortical WMLs. However, whether WMLs in different brain regions have a differential effect on cognitive function remains unclear. CONCLUSIONS: Evidence suggests that periventricular WMLs may have a significant negative impact on cognitive abilities of older adults. This finding may be influenced by study heterogeneity in: 1) different MRI sequences, WML quantification methods, and neuropsychological batteries; 2) modifying effect of cardiovascular risk factors; and 3) quality of studies and lack of sample size calculation.
Comparisons of the Iron Deficient Metabolic Response in Rats Fed Either an AIN-76 or AIN-93 Based Diet
Nutrition & Metabolism. Oct, 2012 | Pubmed ID: 23110872
ABSTRACT: BACKGROUND: Previous studies examining the metabolic consequences of dietary iron deficiency have reported elevated serum glucose concentrations in iron-deficient animals. Importantly, the majority of these findings were observed using an earlier version of a laboratory animal diet (AIN-76A) in which the primary carbohydrate source was sucrose - a disaccharide known to negatively impact both glucose and lipid homeostasis. The AIN-76A diet formula was improved in 1993 (AIN-93) to optimize animal nutrition with a major change being the substitution of cornstarch for sucrose. Therefore, we sought to examine the effects of iron deficiency on steady-state glucose homeostasis and the hepatic expression of glucose- and lipid-related genes in rats fed an iron-deficient diet based on either an AIN-76A or AIN-93 diet. METHODS: The study design consisted of 6 treatment groups: control (C; 40 mg Fe/kg diet), iron deficient (ID; [less than or equal to] 3 mg Fe/kg diet), or pair-fed (PF; 40 mg Fe/kg) fed either an AIN-76A or AIN-93 diet for 21 d. Hemoglobin and hematocrit were measured in whole blood. Serum insulin and cortisol were measure by ELISA. Serum glucose and triacylglycerols were measured by standard colorimetric enzyme assays. Alterations in hepatic gene expression were determined by real-time qPCR. RESULTS: Hemoglobin and hematocrit were significantly reduced in both ID groups compared to the C and PF groups. Similarly, animals in the both ID groups exhibited elevated steady-state levels of blood glucose and insulin, and significantly decreased levels of circulating cortisol compared to their respective PF controls. Serum triacyglycerols were only increased in ID animals consuming the AIN-76A diet. Hepatic gene expression analyses revealed a ~4- and 3-fold increase in the expression of glucokinase and pyruvate dehydrogenase kinase-4 mRNA, respectively, in the ID group on either diet compared to their respective PF counterparts. In contrast, the expression of lipogenic genes was significantly elevated in the AIN-76 ID group, while expression of these genes was unaffected by iron status in the AIN- 93 ID group. CONCLUSIONS: These results indicate that an impaired iron status is sufficient to alter glucose homeostasis, though alterations in lipid metabolism associated with ID are only observed in animals receiving the AIN-76A diet.
Twins Early Development Study (TEDS): A Genetically Sensitive Investigation of Cognitive and Behavioral Development From Childhood to Young Adulthood
Twin Research and Human Genetics : the Official Journal of the International Society for Twin Studies. Oct, 2012 | Pubmed ID: 23110994
The Twins Early Development Study (TEDS) is a large longitudinal sample of twins born in England and Wales between 1994 and 1996. The focus of TEDS has been on cognitive and behavioral development, including difficulties in the context of normal development. TEDS began when multiple births were identified from birth records and the families were invited to take part in the study; 16,810 pairs of twins were originally enrolled in TEDS. More than 10,000 of these twin pairs remain enrolled in the study to date. DNA has been collected for more than 7,000 pairs, and genome-wide genotyping data for two million DNA markers are available for 3,500 individuals. The TEDS families have taken part in studies when the twins were aged 2, 3, 4, 7, 8, 9, 10, 12, 14, and 16 years of age. Data collection is currently underway to assess the adult destinations of the twins as they move from school to university and the workplace. Between January 2012 and December 2014, all of the TEDS twins will turn 18, and the study will transition to an adult sample. TEDS represents an outstanding resource for investigating the developmental effects of genes and environments on complex quantitative traits from childhood to young adulthood and beyond.
Buyer Beware! Doctor Be Aware!: Questions
Pediatric Nephrology (Berlin, Germany). Oct, 2012 | Pubmed ID: 23111895
P38 (MAPK) Stress Signalling in Replicative Senescence in Fibroblasts from Progeroid and Genomic Instability Syndromes
Biogerontology. Oct, 2012 | Pubmed ID: 23112078
Werner Syndrome (WS) is a human segmental progeria resulting from mutations in a DNA helicase. WS fibroblasts have a shortened replicative capacity, an aged appearance, and activated p38 MAPK, features that can be modulated by inhibition of the p38 pathway. Loss of the WRNp RecQ helicase has been shown to result in replicative stress, suggesting that a link between faulty DNA repair and stress-induced premature cellular senescence may lead to premature ageing in WS. Other progeroid syndromes that share overlapping pathophysiological features with WS also show defects in DNA processing, raising the possibility that faulty DNA repair, leading to replicative stress and premature cellular senescence, might be a more widespread feature of premature ageing syndromes. We therefore analysed replicative capacity, cellular morphology and p38 activation, and the effects of p38 inhibition, in fibroblasts from a range of progeroid syndromes. In general, populations of young fibroblasts from non-WS progeroid syndromes do not have a high level of cells with an enlarged morphology and F-actin stress fibres, unlike young WS cells, although this varies between strains. p38 activation and phosphorylated HSP27 levels generally correlate well with cellular morphology, and treatment with the p38 inhibitor SB203580 effects cellular morphology only in strains with enlarged cells and phosphorylated HSP27. For some syndromes fibroblast replicative capacity was within the normal range, whereas for others it was significantly shorter (e.g. HGPS and DKC). However, although in most cases SB203580 extended replicative capacity, with the exception of WS and DKC the magnitude of the effect was not significantly different from normal dermal fibroblasts. This suggests that stress-induced premature cellular senescence via p38 activation is restricted to a small subset of progeroid syndromes.
Comparison of Glucose Monitoring Methods During Steady-State Exercise in Women
Nutrients. Sep, 2012 | Pubmed ID: 23112916
Data from Continuous Glucose Monitoring (CGM) systems may help improve overall daily glycemia; however, the accuracy of CGM during exercise remains questionable. The objective of this single group experimental study was to compare CGM-estimated values to venous plasma glucose (VPG) and capillary plasma glucose (CPG) during steady-state exercise. Twelve recreationally active females without diabetes (aged 21.8 ± 2.4 years), from Central Washington University completed the study. CGM is used by individuals with diabetes, however the purpose of this study was to first validate the use of this device during exercise for anyone. Data were collected between November 2009 and April 2010. Participants performed two identical 45-min steady-state cycling trials (~60% P(max)) on non-consecutive days. Glucose concentrations (CGM-estimated, VPG, and CPG values) were measured every 5 min. Two carbohydrate gel supplements along with 360 mL of water were consumed 15 min into exercise. A product-moment correlation was used to assess the relationship and a Bland-Altman analysis determined error between the three glucose measurement methods. It was found that the CGM system overestimated mean VPG (mean absolute difference 17.4 mg/dL (0.97 mmol/L)) and mean CPG (mean absolute difference 15.5 mg/dL (0.86 mmol/L)). Bland-Altman analysis displayed wide limits of agreement (95% confidence interval) of 44.3 mg/dL (2.46 mmol/L) (VPG compared with CGM) and 41.2 mg/dL (2.29 mmol/L) (CPG compared with CGM). Results from the current study support that data from CGM did not meet accuracy standards from the 15197 International Organization for Standardization (ISO).
Perspectives of Chuukese Patients and Their Health Care Providers on the Use of Different Sources of Interpreters
Hawai'i Journal of Medicine & Public Health : a Journal of Asia Pacific Medicine & Public Health. Sep, 2012 | Pubmed ID: 23115753
Immigrants from Chuuk, a Pacific Island nation in Micronesia, are a growing population of limited-English speakers in Hawai'i. The purpose of this study was to examine the perspectives of Chuukese patients and their physicians in Honolulu, Hawai'i on interpreter services.
The Prostate Cancer Registry: Monitoring Patterns and Quality of Care for Men Diagnosed with Prostate Cancer
BJU International. Nov, 2012 | Pubmed ID: 23116361
What's known on the subject? and What does the study add? Operating principles exist both within Australia and internationally to provide guidance on how to establish clinical registries. In establishing a registry, consideration needs to be given to its purpose, the stakeholders and the output it will generate and to whom output will be disseminated The present study describes how a prostate cancer-specific registry was developed that aligns with generic operating principles. We describe the governance model, the data items collected, the collection methodology clinical indicators selected for reporting and the reporting framework. OBJECTIVE: • To establish a pilot population-based clinical registry with the aim of monitoring the quality of care provided to men diagnosed with prostate cancer. PATIENTS AND METHODS: • All men aged >18 years from the contributing hospitals in Victoria, Australia, who have a diagnosis of prostate cancer confirmed by histopathology report notified to the Victorian Cancer Registry are eligible for inclusion in the Prostate Cancer Registry (PCR). • A literature review was undertaken aiming to identify existing quality indicators and source evidence-based guidelines from both Australia and internationally. RESULTS: • A Steering Committee was established to determine the minimum dataset, select quality indicators to be reported back to clinicians, identify the most effective recruitment strategy, and provide a governance structure for data requests; collection, analysis and reporting of data; and managing outliers. • A minimum dataset comprising 72 data items is collected by the PCR, enabling ten quality indicators to be collected and reported. • Outcome measures are risk adjusted according to the established National Comprehensive Cancer Network and Cancer of the Prostate Risk Assessment Score (surgery only) risk stratification model. Recruitment to the PCR occurs concurrently with mandatory notification to the state-based Cancer Registry. • The PCR adopts an opt-out consent process to maximize recruitment. • The data collection approach is standardized, using a hybrid of data linkage and manual collection, and data collection forms are electronically scanned into the PCR. • A data access policy and escalation policy for mortality outliers has been developed. CONCLUSIONS: • The PCR provides potential for high-quality population-based data to be collected and managed within a clinician-led governance framework. • This approach satisfies the requirement for health services to establish quality assessment, at the same time as providing clinically credible data to clinicians to drive practice improvement.
Is Preventable Harm the Right Patient Safety Metric?
Pediatric Clinics of North America. Dec, 2012 | Pubmed ID: 23116525
Despite increasing attention and discussion, patient harm remains an important issue in health care. Defining and identifying harm remains challenging, and little standardization in approach exists. This summary describes an approach to identifying hospital-wide preventable harm with focused safety efforts using the Preventable Harm Index as a measure of progress and as a metric to motivate improvement. Our hospital's significant decrease in serious safety events, mortality, and preventable harm is outlined.
Combination of Glibenclamide-metformin HCl for the Treatment of Type 2 Diabetes Mellitus
Expert Opinion on Pharmacotherapy. Dec, 2012 | Pubmed ID: 23116560
Introduction: Combination of glibenclamide (glyburide in the U.S.) and metformin hydrochloride simultaneously addresses two different but complimentary mechanisms to improve glycemic control in type 2 diabetes. Areas covered: The pharmacokinetics, efficacy, and side effect profile of the oral combination of glibenclamide-metformin are reviewed. Expert opinion: Those patients, uncontrolled with single oral agent sulfonylurea or metformin alone, benefit from combination glibenclamide-metformin. There is improvement in fasting plasma glucose, HbA(1C), and post-prandial glucose control, and patients are more likely to achieve a HbA(1C) < 7%. Initiation should be started at the lowest doses and titrated to get the desired effect. Combination therapy allows for reduced pill burden while treating a multifactorial disease by two different mechanisms. Practitioners should be cognizant of risks of hypoglycemia and the theoretical potential for lactic acidosis in the elderly and those with renal impairment. We caution the use of glibenclamide-metformin in patients at risk for cardiovascular disease. Therapy should be individualized, but overall, combination of glibenclamide-metformin should be considered in patients, without renal or cardiovascular impairment, who are not controlled on monotherapy alone. Alternatively, practitioners may want to weigh the efficacy and safety of available dipeptidyl-peptidase-4 inhibitor-metformin combinations to those of glibenclamide-metformin when considering combination therapy.
A Qualitative Study of Tobacco Dependence Treatment in 19 US Dental Hygiene Programs
Preventing Chronic Disease. Nov, 2012 | Pubmed ID: 23116779
The US Public Health Service calls for health professionals to provide tobacco dependence counseling for patients. The purpose of this study was to understand how dental hygiene programs make decisions about and provide training for tobacco dependence counseling to help them graduate more fully competent hygienists.
Emergency Medicine Resident Anesthesia Training in a Private Vs. Academic Setting
The Journal of Emergency Medicine. Oct, 2012 | Pubmed ID: 23116930
BACKGROUND: Airway management is an essential part of any Emergency Medicine (EM) training program. Academic centers typically provide training to many learners at various training levels in a number of medical specialties during anesthesiology rotations. This potentially creates competition for intubation procedures that may negatively impact individual experiences. OBJECTIVES: We hypothesized that residents would report higher numbers of intubations and improved educational value in a private practice, rather than an academic, anesthesiology rotation. METHODS: EM residents' anesthesiology training was evaluated pre and post a change in training setting from an academic institution to a private practice institution. Outcome measures included the number of self-reported intubations, resident ratings of the rotation, and the number of positive comments. Residents' evaluation was measured with: a 14-item evaluation; subjective comments, which two blinded reviewers rated as positive, negative, or neutral; and transcripts from structured interviews to identify themes related to training settings. RESULTS: The number of intubations increased significantly in the private practice setting (4.6 intubations/day vs. 1.5 intubations/day, p < 0.001). Resident evaluations improved significantly with the private practice experience (mean scores of 3.83 vs. 2.23, p-values <0.05). Residents' impressions were also significantly higher for the private practice setting with respect to increased educational value, greater use of adjunct airway devices, and directed teaching. CONCLUSIONS: Number of intubations performed and residents' rating of the educational value were more favorable for a private practice anesthesiology rotation. Alternative settings may provide benefit for training in areas that have competition among trainees.
Synthesis and Antimalarial Evaluation of a Screening Library Based on a Tetrahydroanthraquinone Natural Product Scaffold
Bioorganic & Medicinal Chemistry. Dec, 2012 | Pubmed ID: 23117170
As part of a research program aimed at discovering new antimalarial leads from Australian macrofungi a unique fungi-derived prefractionated library was screened against a chloroquine-sensitive Plasmodium falciparum line (3D7) using a radiometric growth inhibition assay. A library fraction derived from a Cortinarius species displayed promising antimalarial activity. UV-guided fractionation on the CH(2)Cl(2)/MeOH extract from this fungus resulted in the isolation of four known compounds: (1S,3R)-austrocortirubin (1), (1S,3S)-austrocortirubin (2), 1-deoxyaustrocortirubin (3), and austrocortinin (4). Compound 2 was used as a natural product scaffold in the parallel solution-phase synthesis of a small library of N-substituted tetrahydroanthraquinones (5-15). All compounds (1-15) were tested in vitro against P. falciparum 3D7 parasites and (1S,3S)-austrocortirubin (2), the major fungal constituent, was shown to be the most active compound with an IC(50) of 1.9μM. This compound displayed moderate cytotoxicity against neonatal foreskin fibroblast (NFF) cells with an IC(50) of 15.6μM.
Validation of the Surgical Apgar Score in a Neurosurgical Patient Population
Journal of Neurosurgery. Nov, 2012 | Pubmed ID: 23121434
Object The surgical Apgar score (SAS) reliably predicts postoperative death and complications and has been validated in a large cohort of general and vascular surgery patients. However, there has been limited study of the utility of the score in the neurosurgical population. The authors tested the hypothesis that the SAS would predict postoperative complications and length of stay after neurosurgical procedures. Methods A cohort of 918 intracranial and spine surgery patients treated over a 3-year period were retrospectively evaluated. The 10-point SAS was calculated and postoperative 30-day mortality and complications rates, intensive care unit (ICU) stay, and hospital stay were assessed by 2 independent raters. Univariate analysis and multivariate logistic regression were performed. Results There were 145 patients (15.8%) with at least 1 complication and 24 patients (2.6%) who died within 30 days of surgery. Surgical Apgar scores were significantly associated with the likelihood of postoperative complications (p < 0.001) and death (p = 0.002); scores varied inversely with postoperative complication and mortality risk in a multivariate analysis. Low SASs also predicted prolonged ICU and hospital stay. Patients with scores of 0-2 stayed a mean of 18.9 days (p < 0.001) and patients with scores of 3-4 stayed an average of 14.3 days (p < 0.001) compared with 4.1 days in patients with scores of 9-10. Conclusions The application of the surgical Apgar score to a neurosurgical cohort predicted 30-day postoperative mortality and complication rates as well as extended ICU and hospital stay. This readily calculated score may help neurosurgical teams efficiently direct postoperative care to those at highest risk of death and complications.
Twelve-hour Shifts
Journal of Emergency Nursing: JEN : Official Publication of the Emergency Department Nurses Association. Nov, 2012 | Pubmed ID: 23122197
Reducing Methylmercury Accumulation in the Food Webs of San Francisco Bay and Its Local Watersheds
Environmental Research. Nov, 2012 | Pubmed ID: 23122771
San Francisco Bay (California, USA) and its local watersheds present an interesting case study in estuarine mercury (Hg) contamination. This review focuses on the most promising avenues for attempting to reduce methylmercury (MeHg) contamination in Bay Area aquatic food webs and identifying the scientific information that is most urgently needed to support these efforts. Concern for human exposure to MeHg in the region has led to advisories for consumption of sport fish. Striped bass from the Bay have the highest average Hg concentration measured for this species in USA estuaries, and this degree of contamination has been constant for the past 40 years. Similarly, largemouth bass in some Bay Area reservoirs have some of the highest Hg concentrations observed in the entire US. Bay Area wildlife, particularly birds, face potential impacts to reproduction based on Hg concentrations in the tissues of several Bay species. Source control of Hg is one of the primary possible approaches for reducing MeHg accumulation in Bay Area aquatic food webs. Recent findings (particularly Hg isotope measurements) indicate that the decades-long residence time of particle-associated Hg in the Bay is sufficient to allow significant conversion of even the insoluble forms of Hg into MeHg. Past inputs have been thoroughly mixed throughout this shallow and dynamic estuary. The large pool of Hg already present in the ecosystem dominates the fraction converted to MeHg and accumulating in the food web. Consequently, decreasing external Hg inputs can be expected to reduce MeHg in the food web, but it will likely take many decades to centuries before those reductions are achieved. Extensive efforts to reduce loads from the largest Hg mining source (the historic New Almaden mining district) are underway. Hg is spread widely across the urban landscape, but there are a number of key sources, source areas, and pathways that provide opportunities to capture larger quantities of Hg and reduce loads from urban runoff. Atmospheric deposition is a lower priority for source control in the Bay Area due to a combination of a lack of major local sources. Internal net production of MeHg is the dominant source of MeHg that enters the food web. Controlling internal net production is the second primary management approach, and has the potential to reduce food web MeHg in some habitats more effectively and within a much shorter time-frame. Controlling net MeHg production and accumulation in the food web of upstream reservoirs and ponds is very promising due to the many features of these ecosystems that can be manipulated. The most feasible control options in tidal marshes relate to the design of flow patterns and subhabitats in restoration projects. Options for controlling MeHg production in open Bay habitat are limited due primarily to the highly dispersed distribution of Hg throughout the ecosystem. Other changes in these habitats may also have a large influence on food web MeHg, including temperature changes due to global warming, sea level rise, food web alterations due to introduced species and other causes, and changes in sediment supply. Other options for reducing or mitigating exposure and risk include controlling bioaccumulation, cleanup of contaminated sites, and reducing other factors (e.g., habitat availability) that limit at-risk wildlife populations.
Silencing of Germline-expressed Genes by DNA Elimination in Somatic Cells
Developmental Cell. Nov, 2012 | Pubmed ID: 23123092
Chromatin diminution is the programmed elimination of specific DNA sequences during development. It occurs in diverse species, but the function(s) of diminution and the specificity of sequence loss remain largely unknown. Diminution in the nematode Ascaris suum occurs during early embryonic cleavages and leads to the loss of germline genome sequences and the formation of a distinct genome in somatic cells. We found that ∼43 Mb (∼13%) of genome sequence is eliminated in A. suum somatic cells, including ∼12.7 Mb of unique sequence. The eliminated sequences and location of the DNA breaks are the same in all somatic lineages from a single individual and between different individuals. At least 685 genes are eliminated. These genes are preferentially expressed in the germline and during early embryogenesis. We propose that diminution is a mechanism of germline gene regulation that specifically removes a large number of genes involved in gametogenesis and early embryogenesis.
A Pilot Study of the Effect of Low Cadence Functional Electrical Stimulation Cycling After Spinal Cord Injury on Thigh Girth and Strength
Archives of Physical Medicine and Rehabilitation. Oct, 2012 | Pubmed ID: 23123504
OBJECTIVE: To investigate the chronic effects of FES-evoked cycle training cadence on leg muscle hypertrophy and electrically-evoked strength. Prior research has shown that greater muscles forces can be produced by using lower pedalling cadences. Lower cadence functional electrical stimulation (FES) cycling might offer greater muscle hypertrophy and strength gains than higher cadences. DESIGN: Open intervention study. SETTING: Laboratory setting. PARTICIPANTS: Eight untrained individuals with chronic spinal cord injury (SCI). INTERVENTIONS: Six weeks (3 d•wk(-1)) of training on an isokinetic FES cycle ergometer. For each subject, one leg was randomly allocated to cycling at 10 rev•min(-1) (LOW) for 30-min per day and the other cycling at 50 rev•min(-1) (HIGH) for 30-min per day. MAIN OUTCOME MEASURES: Pre- and post-training measurements of lower limb circumference were performed at the distal and middle position of each thigh. Electrically-evoked quadriceps muscle torque during an isometric contraction was also assessed. RESULTS: Six weeks of FES cycle training significantly increased thigh girth in both LOW and HIGH groups. At mid-thigh, girth increases induced by LOW (6.6 ± 1.2%) were significantly greater than HIGH (3.6 ± 0.8%). LOW also produced greater gains in electrically-evoked isometric torque than HIGH after training. CONCLUSIONS: These results suggest that lower pedalling cadences evoke greater muscle hypertrophy and electrically-stimulated muscle strength compared to higher cadences.
Topics in Research: Structuring Studies in Palliative Care
Current Opinion in Supportive and Palliative Care. Dec, 2012 | Pubmed ID: 23123820
This review describes the advances in trial methodology and presents new methodologies to meet some of the challenges of conducting trials in a palliative care setting. To describe why this review is timely and relevant.
Use of Oxygen at the End of Life: on What Basis Are Decisions Made?
International Journal of Palliative Nursing. Aug, 2012 | Pubmed ID: 23123981
Discussing and conducting research on end-of-life issues is often difficult. However, it is important to initiate a dialogue about various topics surrounding death and dying. This paper looks at the available scientific literature relating to oxygen use at the end of life, describes associated attitudes and beliefs, and presents some brief examples of institutional practices. The aim is to stimulate thoughtful reflection and encourage research on this important topic. There is limited research regarding oxygen use at the end of life, and many questions remain. Despite the difficulty with research in this area, there is a need to expand the data and awareness in this field. Several authors have questioned the use of oxygen in end-of-life care, and the evidence that oxygen use may not always be indicated is growing.
Methicillin-Resistant Staphylococcus Aureus (MRSA) Detected at Four U.S. Wastewater Treatment Plants
Environmental Health Perspectives. Nov, 2012 | Pubmed ID: 23124279
Background: The incidence of community-acquired methicillin-resistant Staphylococcus aureus (CA-MRSA) infections is increasing in the United States, and it is possible that municipal wastewater could be a reservoir of this microorganism. To date, no U.S. studies have evaluated the occurrence of MRSA in wastewater.Objective: We examined the occurrence of MRSA and methicillin-susceptible S. aureus (MSSA) at U.S. wastewater treatment plants.Methods: We collected wastewater samples from two Mid-Atlantic and two Midwest wastewater treatment plants between October 2009 and October 2010. Samples were analyzed for MRSA and MSSA using membrane filtration. Isolates were confirmed using biochemical tests and PCR (polymerase chain reaction). Antimicrobial susceptibility testing was performed by Sensititre® microbroth dilution. Staphylococcal cassette chromosome mec (SCCmec) typing, Panton-Valentine leucocidin (PVL) screening, and pulsed field gel electrophoresis (PFGE) were performed to further characterize the strains. Data were analyzed by two-sample proportion tests and analysis of variance.Results: We detected MRSA (n = 240) and MSSA (n = 119) in 22 of 44 (50%) and 24 of 44 (55%) wastewater samples, respectively. The odds of samples being MRSA-positive decreased as treatment progressed: 10 of 12 (83%) influent samples were MRSA-positive, while only one of 12 (8%) effluent samples was MRSA-positive. Ninety-three percent and 29% of unique MRSA and MSSA isolates, respectively, were multidrug resistant. SCCmec types II and IV, the pvl gene, and USA types 100, 300, and 700 (PFGE strain types commonly found in the United States) were identified among the MRSA isolates.Conclusions: Our findings raise potential public health concerns for wastewater treatment plant workers and individuals exposed to reclaimed wastewater. Because of increasing use of reclaimed wastewater, further study is needed to evaluate the risk of exposure to antibiotic-resistant bacteria in treated wastewater.
The Prostate Cancer Screening Controversy: Addressing Bioethical Concerns at a Community Health Promotion Event for Men
Journal of Health Care for the Poor and Underserved. Nov, 2012 | Pubmed ID: 23124496
Summary: There are bioethical concerns related to prostate cancer screening. A new prostate cancer screening approach at a community health promotion event used vouchers to promote informed decision-making in order to reduce these concerns.
Sociodemographic Differences in Fears and Mistrust Contributing to Unwillingness to Participate in Cancer Screenings
Journal of Health Care for the Poor and Underserved. Nov, 2012 | Pubmed ID: 23124501
Effective provider-patient relationships are vital for positive patient health outcomes. This analysis assessed sociodemographic differences in fears and mistrust related to the provider-patient relationship, which may contribute to unwillingness to participate in cancer screenings (CSs). The data are from a stratified, random-digit dial telephone questionnaire of non-institutionalized households in New York, Maryland, and Puerto Rico. Statistically significant results indicate that Hispanics, compared with Whites, were nearly two times more likely to report that fear of being a "guinea pig" and lacking trust in medical people would make them unwilling to participate in CSs. Additionally, those with less education were over two times more likely to indicate a fear of being embarrassed during the screening would make them unwilling to participate in CSs. These results highlight areas where health professionals can improve interactions with their patients and be attentive to their fears and/or mistrusts to promote CSs utilization.
Factors Associated with Depressive Symptoms in the Early Postpartum Period Among Women with Recent Gestational Diabetes Mellitus
Maternal and Child Health Journal. Nov, 2012 | Pubmed ID: 23124798
Women with gestational diabetes mellitus (GDM) have a substantial risk of subsequently developing type 2 diabetes. This risk may be mitigated by engaging in healthy eating, physical activity, and weight loss when indicated. Since postpartum depressive symptoms may impair a woman's ability to engage in lifestyle changes, we sought to identify factors associated with depressive symptoms in the early postpartum period among women with recent GDM. The participants are part of the baseline cohort of the TEAM GDM (Taking Early Action for Mothers with Gestational Diabetes Mellitus) study, a one-year randomized trial of a lifestyle intervention program for women with a recent history of GDM, conducted in Boston, Massachusetts between June 2010 and September 2012. We administered the Edinburgh Postnatal Depression Scale (EPDS) at 4-15 weeks postpartum to women whose most recent pregnancy was complicated by GDM (confirmed by laboratory data or medical record review). An EPDS score ≥9 indicated depressive symptoms. We measured height and thyroid stimulating hormone, and administered a questionnaire to collect demographic data and information about breastfeeding and sleep. We calculated body mass index (BMI) using self-reported pre-pregnancy weight and measured height. We reviewed medical records to obtain data about medical history, including history of depression, mode of delivery, and insulin use during pregnancy. We conducted bivariable analyses to identify correlates of postpartum depressive symptoms, and then modeled the odds of postpartum depressive symptoms using multivariable logistic regression. Our study included 71 women (mean age 33 years ± 5; 59 % White, 28 % African-American, 13 % Asian, with 21 % identifying as Hispanic; mean pre-pregnancy BMI 30 kg/m(2) ± 6). Thirty-four percent of the women scored ≥9 on the EPDS at the postpartum visit. In the best fit model, factors associated with depressive symptoms at 6 weeks postpartum included cesarean delivery (aOR 4.32, 95 % CI 1.46, 13.99) and gestational weight gain (aOR 1.21 [1.02, 1.46], for each additional 5 lbs gained). Use of insulin during pregnancy, breastfeeding, personal history of depression, and lack of a partner were not retained in the model. Identifying factors associated with postpartum depression in women with GDM is important since depression may interfere with lifestyle change efforts in the postpartum period. In this study, cesarean delivery and greater gestational weight gain were correlated with postpartum depressive symptoms among women with recent GDM (Clinicaltrials.gov NCT01158131).
Flt3 Ligand Expands CD4(+) FoxP3(+) Regulatory T Cells in Human Subjects
European Journal of Immunology. Nov, 2012 | Pubmed ID: 23124877
CD4(+) CD25(+) FoxP3(+) naturally occurring regulatory T (Treg) cells play a crucial role in the maintenance of immune tolerance and in preventing autoimmune pathology. Interventions which expand Treg cells are highly desirable, as they may offer novel treatment options in a variety of autoimmune and transplantation settings. Paralleling previous pre-clinical studies, we demonstrate here that administration of the hematopoietic growth factor Flt3L to human subjects increases the frequency and absolute number of Treg cells, and reduces the ratio of CD8(+) T cells to Treg cells in the peripheral blood. The increase in Treg cells was due to enhanced Treg-cell proliferation rather than release of Treg cells from the thymus. Further studies revealed that Flt3L-induced proliferation of Treg cells was an indirect effect which occurred via the interaction of Treg cells with the Flt3L-expanded pool of CD1c(+) myeloid dendritic cells. On the basis of these findings, Flt3L may represent a promising agent for promoting immune tolerance in a variety of clinical settings.
A Rash After Streptococcal Infection
Cleveland Clinic Journal of Medicine. Nov, 2012 | Pubmed ID: 23125324
(η(6)-Benzene)-(benzyl-diphenyl-phos-phane)dichloridoruthenium(II)
Acta Crystallographica. Section E, Structure Reports Online. Oct, 2012 | Pubmed ID: 23125570
In the title compound, [RuCl(2)(C(6)H(6))(C(19)H(17)P)], the Ru(II) atom has a distorted pseudo-octa-hedral coordination environment with the metrical parameters around the metallic core as Ru-centroid(η(6)-benzene) = 1.6894 (11) Å, Ru-P = 2.3466 (6), Ru-Cl(avg.) = 2.4127 (7) Å; Cl-Ru-Cl = 88.07 (2) and Cl-Ru-P = 82.77 (2), 87.65 (2)°. The effective cone angle for the benzyl-diphenyl-phosphane was calculated to be 143°. In the crystal C-H⋯Cl and C-H⋯π inter-actions are observed.
A Langmuir Probe Diagnostic for Time-of-flight Measurements of Transient Plasmas Produced by High-energy Laser Ablation
The Review of Scientific Instruments. Oct, 2012 | Pubmed ID: 23126899
We discuss here the development of a Langmuir probe (LP) diagnostic to examine high-density, high-temperature inhomogeneous plasmas such as those that can be created at the University of Rochester's Laboratory for Laser Energetics OMEGA facility. We have configured our diagnostic to examine the velocity of the plasma expanding from the target. We observe velocities of approximately 16-17 cm∕μs, with individual LP currents displaying complex structures, perhaps due to the multiple atomic species and ionization states that exist.
The X-ray Source Application Test Cassette for Radiation Exposures at the OMEGA Laser
The Review of Scientific Instruments. Oct, 2012 | Pubmed ID: 23126957
We have designed a sample cassette that can be used to position up to six samples in the OMEGA laser chamber. The cassette accommodates round samples up to 38.1 mm (1.5(")) in diameter and square samples up to 27 mm on a side, any of which can be up to 12.7 mm thick. Smaller specimens are centered with spacers. The test cassette allows each sample to have a unique filter scheme, with multiple filter regions in front of each sample. This paper will present mechanical design considerations and operational aspects of the x-ray source application cassette.
Radiochromic Film Measurement of Spatial Uniformity for a Laser Generated X-ray Environment
The Review of Scientific Instruments. Oct, 2012 | Pubmed ID: 23126958
An existing x-ray source application (XRSA) test cassette was modified to hold multiple x-ray filter materials followed by two radiochromic film types (FWT-60 and HD-810 Gafchromic® film) to qualitatively characterize the spectral-spatial uniformity over the XRSA sample field of view. Multiple sets of film were examined and nominal set was determined. These initial, qualitative measurements suggest a low-energy regime (E < 3 keV) spatial anisotropy and spatial isotropy at higher energies (E > 3 keV).
Ideal Position for Thumb Interphalangeal Arthrodesis in the Era of Smartphones and Text Communication
Orthopedics. Nov, 2012 | Pubmed ID: 23127441
The hypothesis of this study was that arthrodesis of the thumb interphalangeal joint at a degree of flexion greater than the recommended 0° to 15° in the era of widespread use of handheld devices would potentially be more beneficial for the use of these devices. For patients who rely heavily on a smart-phone or handheld device and require dominant thumb arthrodesis, thumb interphalangeal arthrodesis at an angle of 10° or 30° will neither improve nor impede their use of the device.
Mental Health and Aging Initiative: Intervention Component Effects
Rural and Remote Health. Oct, 2012 | Pubmed ID: 23127552
The objective of this investigation is to evaluate the Mental Healthiness and Aging Initiative (MHAI) intervention. The MHAI was created to promote awareness and knowledge about mental health/substance (MH/SA) use and aging issues in rural Kentucky, USA, due to limitations in formal and informal mental health care and treatment resources as a result of multilevel barriers in rural regions and effects on health, wellbeing and quality of life.
The Impact of Caregiver Support on Mortality Following Burn Injury in the Elderly
Journal of Burn Care & Research : Official Publication of the American Burn Association. Nov, 2012 | Pubmed ID: 23128127
Advances in burn care have decreased mortality in the past 20 years, but affecting elderly mortality rates (>65 years) remain challenging. This study evaluates the impact of home caregiver support on elderly burn patients' mortality. The authors retrospectively reviewed patients aged 65 and older admitted to their burn center from July 1995 to October 2004. Patient demographics, Injury Severity Score, TBSA, and patients' primary caregiver were collected. The outcomes were mortality, disposition, and length of stay and these were evaluated using univariate and subsequently multivariate regression. Significance was calculated at P ≤ .05. A total of 112 patients were included in the analysis. The mean age was 76 ± 8. Male patients constituted 47%, whereas 53% were female patients, and mean TBSA was 21 ± 16%. Thirty patients' primary caregiver was a spouse, 38 had a child, and 44 had no caregiver. Fifty-eight patients survived (51.7%), and 54 patients died (48.3%). Only 21% of the survivors had a child as their primary caregiver; however, 48% of the nonsurvivors had a child as the primary caregiver (P ≤ 0.05). On multivariate analysis, age, TBSA, and child as primary caregiver were all independent predictors of mortality. Having a child as a caregiver provided the largest impact, with an odds ratio of 4.4 (95% confidence interval, 1.2-15.62; P = .02).
Mobility, Longevity and Activity of Chlorfenapyr in Soils Treated at a Termiticidal Rate
Pest Management Science. May, 2012 | Pubmed ID: 23129480
BACKGROUND: The mobility, longevity and termiticidal activity of chlorfenapyr applied to soils at the termiticidal labeled rate was evaluated for 30 months after treatment (MAT) in a greenhouse study. RESULTS: There was little dissipation of chlorfenapyr in soil treated at the labeled rate for perimeter treatments for the prevention and control of termite infestations. Chlorfenapyr was detected in soil immediately below the initially treated soil in the packed soil columns. This was likely due to settling of soil. The treated soil remained toxic to subterranean termites in 3 and 7 day bioassays over the duration of the study. The treated soil displayed slow-acting properties regarding toxicity to termites. Trace amounts of chlorfenapyr were detected in the eluates of packed soil cones. CONCLUSION: The commercial formulation of chlorfenapyr used in this study (21.45% concentrate diluted to 0.125% prior to application) killed 100% of the tested subterranean termites for at least 30 months. Copyright © 2012 Society of Chemical Industry.
Background-dependent Effects of Polyglutamine Variation in the Arabidopsis Thaliana Gene ELF3
Proceedings of the National Academy of Sciences of the United States of America. Nov, 2012 | Pubmed ID: 23129635
Tandem repeats (TRs) have extremely high mutation rates and are often considered to be neutrally evolving DNA. However, in coding regions, TR copy number mutations can significantly affect phenotype and may facilitate rapid adaptation to new environments. In several human genes, TR copy number mutations that expand polyglutamine (polyQ) tracts beyond a certain threshold cause incurable neurodegenerative diseases. PolyQ-containing proteins exist at a considerable frequency in eukaryotes, yet the phenotypic consequences of natural variation in polyQ tracts that are not associated with disease remain largely unknown. Here, we use Arabidopsis thaliana to dissect the phenotypic consequences of natural variation in the polyQ tract encoded by EARLY FLOWERING 3 (ELF3), a key developmental gene. Changing ELF3 polyQ tract length affected complex ELF3-dependent phenotypes in a striking and nonlinear manner. Some natural ELF3 polyQ variants phenocopied elf3 loss-of-function mutants in a common reference background, although they are functional in their native genetic backgrounds. To test the existence of background-specific modifiers, we compared the phenotypic effects of ELF3 polyQ variants between two divergent backgrounds, Col and Ws, and found dramatic differences. In fact, the Col-ELF3 allele, encoding the shortest known ELF3 polyQ tract, was haploinsufficient in Ws × Col F(1) hybrids. Our data support a model in which variable polyQ tracts drive adaptation to internal genetic environments.
Infrequent SCN9A Mutations in Congenital Insensitivity to Pain and Erythromelalgia
Journal of Neurology, Neurosurgery, and Psychiatry. Nov, 2012 | Pubmed ID: 23129781
OBJECTIVE: Mutations in SCN9A have been reported in (1) congenital insensitivity to pain (CIP); (2) primary erythromelalgia; (3) paroxysmal extreme pain disorder; (4) febrile seizures and recently (5) small fibre sensory neuropathy. We sought to investigate for SCN9A mutations in a clinically well-characterised cohort of patients with CIP and erythromelalgia. METHODS: We sequenced all exons of SCN9A in 19 clinically well-studied cases including 6 CIP and 13 erythromelalgia (9 with family history, 10 with small-fibre neuropathy). The identified variants were assessed in dbSNP135, 1K genome, NHLBI-Exome Sequencing Project (5400-exomes) databases, and 768 normal chromosomes. RESULTS: In erythromelalgia case 7, we identified a novel Q10>K mutation. In CIP case 6, we identified a novel, de novo splicing mutation (IVS8-2A>G); this splicing mutation compounded with a nonsense mutation (R523>X) and abolished SCN9A mRNA expression almost completely compared with his unaffected father. In CIP case 5, we found a variant (P610>T) previously considered causal for erythromelalgia, supporting recently raised doubt on its causal nature. We also found a splicing junction variant (IVS24-7delGTTT) in all 19 patients, this splicing variant was previously considered casual for CIP, but IVS24-7delGTTT was in fact the major allele in Caucasian populations. CONCLUSIONS: Two novel SCN9A mutations were identified, but frequently polymorphism variants are found which may provide susceptibility factors in pain modulation. CIP and erythromelalgia are defined as genetically heterogeneous, and some SCN9A variants previously considered causal may only be modifying factors.
Mild Sensory Stimulation Protects the Aged Rodent from Cortical Ischemic Stroke After Permanent Middle Cerebral Artery Occlusion
Journal of the American Heart Association. Aug, 2012 | Pubmed ID: 23130160
Accumulated research has shown that the older adult brain is significantly more vulnerable to stroke than the young adult brain. Although recent evidence in young adult rats demonstrates that single-whisker stimulation can result in complete protection from ischemic damage after permanent middle cerebral artery occlusion (pMCAO), it remains unclear whether the same treatment would be effective in older animals.
The Future Role of Genetic Screening to Detect Newborns at Risk of Childhood-onset Hearing Loss
International Journal of Audiology. Nov, 2012 | Pubmed ID: 23131088
Objective: To explore the future potential of genetic screening to detect newborns at risk of childhood-onset hearing loss. Design: An expert led discussion of current and future developments in genetic technology and the knowledge base of genetic hearing loss to determine the viability of genetic screening and the implications for screening policy. Results and Discussion: Despite increasing pressure to adopt genetic technologies, a major barrier for genetic screening in hearing loss is the uncertain clinical significance of the identified mutations and their interactions. Only when a reliable estimate of the future risk of hearing loss can be made at a reasonable cost, will genetic screening become viable. Given the speed of technological advancement this may be within the next 10 years. Decision-makers should start to consider how genetic screening could augment current screening programmes as well as the associated data processing and storage requirements. Conclusion: In the interim, we suggest that decision makers consider the benefits of (1) genetically testing all newborns and children with hearing loss, to determine aetiology and to increase knowledge of the genetic causes of hearing loss, and (2) consider screening pregnant women for the m.1555A> G mutation to reduce the risk of aminoglycoside antibiotic-associated hearing loss.
A Randomized Trial of Vitamin D Supplementation in 2 Community Health Center Networks in South Carolina
American Journal of Obstetrics and Gynecology. Nov, 2012 | Pubmed ID: 23131462
OBJECTIVE: We sought to determine whether 4000 IU/d (vs 2000 IU/d) of vitamin D during pregnancy is safe and improves maternal/neonatal 25-hydroxyvitamin D [25(OH)D] in a dose-dependent manner. STUDY DESIGN: A total of 257 pregnant women 12-16 weeks' gestation were enrolled. Randomization to 2000 vs 4000 IU/d followed 1-month run-in at 2000 IU/d. Participants were monitored for hypercalciuria, hypercalcemia, and 25(OH)D status. RESULTS: Maternal 25(OH)D (n = 161) increased from 22.7 ng/mL (SD 9.7) at baseline to 36.2 ng/mL (SD 15) and 37.9 ng/mL (SD 13.5) in the 2000 and 4000 IU groups, respectively. While maternal 25(OH)D change from baseline did not differ between groups, 25(OH)D monthly increase differed between groups (P < .01). No supplementation-related adverse events occurred. Mean cord blood 25(OH)D was 22.1 ± 10.3 ng/mL in 2000 IU and 27.0 ± 13.3 ng/mL in 4000 IU groups (P = .024). After controlling for race and study site, preterm birth and labor were inversely associated with predelivery and mean 25(OH)D, but not baseline 25(OH)D. CONCLUSION: Maternal supplementation with vitamin D 2000 and 4000 IU/d during pregnancy improved maternal/neonatal vitamin D status. Evidence of risk reduction in infection, preterm labor, and preterm birth was suggestive, requiring additional studies powered for these endpoints.
Cyanoacrylate Glues for Wilderness and Remote Travel Medical Care
Wilderness & Environmental Medicine. Nov, 2012 | Pubmed ID: 23131754
Cyanoacrylate (CA) glues are commonly used in medical and household repairs. Their chemical compositions have been refined over half a century, making some more suitable than others for creative applications. In remote settings where advanced medical care is not accessible, readily available CAs of differing chemical composition may possess an important therapeutic function. Within this paper we critically examine the published therapeutic risks and benefits of both pharmaceutical and hardware grade CAs when applied in acute care situations. Topics discussed include wound closure as well as the treatment of burns, abrasions, and blisters. Also considered are their chemical properties, toxicities, and potential off-label uses.
Commentary on "Markers of Antigen Presentation And Activation On Eosinophils And T-Cells in the Esophageal Tissue of Patients With Eosinophilic Esophagitis"
Journal of Pediatric Gastroenterology and Nutrition. Nov, 2012 | Pubmed ID: 23132165
Relationships Between Dimensions of Disability Experienced by Adults Living with HIV: A Structural Equation Model Analysis
AIDS and Behavior. Nov, 2012 | Pubmed ID: 23132208
As individuals age with HIV it is increasingly important to consider the health-related consequences of HIV and multiple morbidities, known as disability. We assessed relationships between four dimensions of disability among adults living with HIV. We conducted a structural equation modeling analysis using data from 913 participants in the Ontario HIV Treatment Network Cohort Study to determine relationships between four latent variables of disability in the Episodic Disability Framework: physical symptoms and impairments, mental health symptoms and impairments, difficulties with day-to-day activities, and challenges to social inclusion. Results indicated that physical symptoms and impairments, mental health symptoms and impairments and difficulties with day-to-day activities directly or indirectly predicted challenges to social inclusion for adults living with HIV. Challenges to social inclusion were directly predicted by mental health symptoms and indirectly by physical health symptoms via (mediated by) having difficulties carrying out day-to-day activities and mental health symptoms and impairments. These findings provide a basis for conceptualizing disability experienced by people living with HIV.
Convergent Findings for Abnormalities of the NF-κB Signaling Pathway in Schizophrenia
Neuropsychopharmacology : Official Publication of the American College of Neuropsychopharmacology. Nov, 2012 | Pubmed ID: 23132271
Neurons exhibit a constitutive level of nuclear factor-κB (NF-κB) signaling and this pathway plays a significant role in neurite outgrowth, activity-dependent plasticity, and cognitive function. Transcription factor analysis was performed in a microarray data set profiled in four different brain regions (n=54 comparison group; n=53 schizophrenia (SZ)). An independent postmortem cohort was used for gene expression (n=24 comparison group; n=22 SZ), protein abundance (n=8 comparison group; n=8 SZ), and NF-κB nuclear activity (n=10 comparison group; n=10 SZ) quantification. Expression quantitative trait locus analysis was performed using publicly available data. Prepulse inhibition (PPI) of the acoustic startle reflex was tested in healthy individuals (n=690). Comparison of microarray data showed that NF-κB was among the transcription factors associated with the differential expression of genes in cases vs controls. NF-κB gene and protein levels and nuclear activation were significantly decreased in the superior temporal gyrus of patients with SZ. Upstream NF-κB genes related to translocation were significantly dysregulated in SZ. The gene expression levels of an NF-κB-associated importin (KPNA4: one of the proteins responsible for the translocation of NF-κB to the nucleus) was decreased in SZ and an SNP within the KPNA4 locus was associated with susceptibility to SZ, reduced KPNA4 expression levels and attenuated PPI of the startle reflex in healthy control subjects. These findings implicate abnormalities of the NF-κB signaling pathway in SZ and provide evidence for an additional possible mechanism affecting the translocation of NF-κB signaling to the nucleus.Neuropsychopharmacology advance online publication, 7 November 2012; doi:10.1038/npp.2012.215.
Circulating Vaccine Derived Poliovirus and the Polio Eradication Endgame
The Pan African Medical Journal. 2012 | Pubmed ID: 23133709
Laparoscopic Cholecystectomy is the Preferred Approach in Cirrhosis: a Nationwide, Population-based Study
HPB : the Official Journal of the International Hepato Pancreato Biliary Association. Dec, 2012 | Pubmed ID: 23134187
To assess the impact of open versus laparoscopic surgery in cirrhotic patients undergoing a cholecystectomy using the Nationwide Inpatient Sample (NIS).
Contextual Determinants of Health Behaviours in an Aboriginal Community in Canada: Pilot Project
BMC Public Health. 2012 | Pubmed ID: 23134669
ABSTRACT:
Predicting Death or Major Neurodevelopmental Disability in Extremely Preterm Infants Born in Australia
Archives of Disease in Childhood. Fetal and Neonatal Edition. Nov, 2012 | Pubmed ID: 23134711
BACKGROUND: The aim of this study was to determine if the National Institute of Child Health and Human Development (NICHD) calculator, designed to predict mortality or neurosensory disability in infants 22-25 weeks' gestation, was valid for contemporary Australian infants. METHOD: Outcome data at 2 years of age for 114 infants who were liveborn in Victoria, Australia, in 2005, between 22 and 25 completed weeks' gestation, weighing 401-1000 g at birth, and free of lethal anomalies, were entered into the NICHD online calculator. Predicted outcomes were then compared with the actual outcomes. RESULTS: Of the 114 infants, 99 (87%) were inborn and 15 (13%) were outborn. The overall prediction of death for inborn infants was 47.1% compared with the actual death rate to 2 years of age of 49.5%. The area under the curve (AUC) was 0.803 (95% CI 0.718 to 0.888; p<0.001) for mortality, comparable with the AUC for the NICHD study (AUC: 0.753; 95% CI 0.737 to 0.769; p<0.001). The accuracy for predicting death was not as precise for outborn infants (AUC: 0.643; 95% CI 0.337 to 0.949; p=0.36). The calculator overestimated the combined outcome of death or survival with major disability at 72.0%, compared with an actual rate of 60.5%. CONCLUSIONS: The NICHD outcome estimator was helpful in predicting mortality for inborn infants, 22-25 weeks' gestation, but was less precise for outborn infants. It overestimated the combined outcome of death or major disability in infants born in Victoria, Australia, in 2005.
Opportunities for Pharmacists in the Criminal Justice System
American Journal of Health-system Pharmacy : AJHP : Official Journal of the American Society of Health-System Pharmacists. Nov, 2012 | Pubmed ID: 23135555
Highly-attenuated Recombinant Vesicular Stomatitis Virus VSV-12' GFP Displays Immunogenic and Oncolytic Activity
Journal of Virology. Nov, 2012 | Pubmed ID: 23135719
Vesicular stomatitis virus (VSV) has shown considerable promise both as an immunization vector, and as an oncolytic virus. In both applications, an important concern is the safety profile of the virus. To generate a highly attenuated virus, we added two reporter genes to the 3' end of the VSV genome, thereby shifting the NPMGL genes from positions 1-5 to 3-7. The resulting virus (VSV-12' GFP) was highly attenuated, generating smaller plaques than four other attenuated VSVs. In one-step growth curves, VSV-12' GFP displayed the slowest growth kinetics. The mechanism of attenuation appears to be due to reduced expression of VSV genes downstream of the reporter genes, as suggested by a 10.4 fold reduction in L protein RNA transcript. Although attenuated, VSV-12' GFP was highly effective at generating an immune response, indicated by a high-titer antibody response against the GFP protein expressed by the virus. Although VSV-12' GFP was more attenuated than other VSVs on both normal and cancer cells, it nonetheless showed a greater level of infection of human cancer cells (glioma and melanoma) than normal cells, and this effect was magnified in glioma by interferon application, indicating selective oncolysis. Intravenous VSV-12' GFP selectively infected human gliomas implanted into SCID mice subcutaneously or intracranially. All postnatal day 16 mice given intranasal VSV-12' GFP survived, whereas only 10% of those given VSV-G/GFP survived, indicating greatly reduced neurotoxicity. Intratumoral injection of tumors with VSV-12' GFP dramatically suppressed tumor growth and enhanced survival. Together these data suggest this recombinant virus merits further study for its oncolytic and vaccine potential.
The Molecular Evolution of Lineage 2 West Nile Virus
The Journal of General Virology. Nov, 2012 | Pubmed ID: 23136360
Since the 1990's West Nile virus (WNV) has become an increasingly important public health problem and cause of outbreaks of neurological disease. Genetic analyses have identified multiple lineages with many studies focusing on lineage 1 due to its emergence in New York in 1999 and neuroinvasive phenotype. Until recently, viruses in lineage 2 were not thought to be of public health importance due to few outbreaks of disease being associated with viruses in this lineage. However, recent epidemics of lineage 2 in Europe (Greece, Italy) and Russia have shown the increasing importance of this lineage. There are very few genetic studies examining isolates belonging to lineage 2. We have sequenced the full-length genomes of four older lineage 2 WNV isolates, compared them to 12 previously published genomic sequences, and examined the evolution of this lineage. Our studies show that this lineage has evolved over the last 300-400 years and appears to correlate with a change from mouse attenuated to virulent phenotype based on previous studies by our group (Beasley et al. 2004. Molecular determinants of virulence of West Nile virus in North America. Arch Virol Suppl, 35-41). This evolution mirrors that which is seen in lineage 1 isolates, which have also evolved to a virulent phenotype over the same period of time.
Relationship of Fasting Total Homocysteine, High Sensitivity C-reactive Protein and Features of the Metabolic Syndrome in Trinidadian Subjects
Archives of Physiology and Biochemistry. Nov, 2012 | Pubmed ID: 23137347
Objectives: To assess the relationship of homocysteine, hs-CRP, with known cardiovascular risk factors of the metabolic syndrome. Method: Cross sectional study comprised 182 diabetic outpatients (70 males and 112 females), attending endocrinology clinics in Trinidad. Results: Both male and females showed significant linear relationships between high sensitive C-reactive protein (hs-CRP), blood pressure and diabetes (r = -0.2 < R or R > 0.2). In females hs-CRP showed significant linear relationship with HDL, triglyceride, blood pressure and diabetes mellitus (p < 0.0001). The inverse relationship of hs-CRP with HDL implies the strong association of hs-CRP with metabolic syndrome. The multivariate logistic regression analysis showed significant relation of hs-CRP, metabolic syndrome and diabetes mellitus. There was no significant relationship of tHCY to any of the features studied. Conclusion: Serum C-reactive protein is significantly related to features of the metabolic syndrome. Total plasma homocysteine, appears to be independent of both hs-CRP and features of the metabolic syndrome.
Nausea and Vomiting in Advanced Cancer- "The Cleveland Clinic Protocol"
The Journal of Supportive Oncology. Nov, 2012 | Pubmed ID: 23137588
Nausea and vomiting are common and distressing symptoms in advanced cancer. Both are multifactorial and cause significant morbidity, nutritional failure, and reduced quality of life. Assessment includes a detailed history, physical examination and investigations for reversible causes. Assessment and management will be influenced by performance status, prognosis, and goals of care. Several drug classes are effective with some having the added benefit of multiple routes of administration. It is our institution's practice to recommend metoclopramide as the first drug with haloperidol as an alternative antiemetic. Dexamethasone should be used for patients with central nervous system metastases or bowel obstruction. If your patient is near death, empiric metoclopramide, haloperidol or chlorpromazine is used without further investigation. For patients with a better prognosis, we exclude reversible causes and use the same first-line antiemetics, metoclopramide and haloperidol. For those who do not respond to first-line single antiemetics, olanzapine is second line and ondansetron is third. Rarely do we use combination therapy or cannabinoids. Olanzapine as a single agent has a distinct advantage over antiemetic combinations. It improves compliance, reduces drug interactions and has several routes of administration. Antiemetics, anticholinergics, octreotide and dexamethasone are used in combination to treat bowel obstruction. In opiod-naïve patients, we prefer haloperidol, glycopyrrolate and an opioid as the first-line treatment and add or substitute octreotide and dexamethasone in those who do not respond. Non-pharmacologic interventions (mechanical stents and percutaneous endoscopic gastrostomy tubes) are used when nausea is refractory to medical management or for home-going management to relieve symptoms, reduce drug costs and rehospitalization.
Physiology and Pathophysiology of the Blood-brain Barrier: P-glycoprotein and Occludin Trafficking As Therapeutic Targets to Optimize Central Nervous System Drug Delivery
Journal of Investigative Medicine : the Official Publication of the American Federation for Clinical Research. Dec, 2012 | Pubmed ID: 23138008
ABSTRACT: The blood-brain barrier (BBB) is a physical and metabolic barrier that separates the central nervous system from the peripheral circulation. Central nervous system drug delivery across the BBB is challenging, primarily because of the physical restriction of paracellular diffusion between the endothelial cells that comprise the microvessels of the BBB and the activity of efflux transporters that quickly expel back into the capillary lumen a wide variety of xenobiotics. Therapeutic manipulation of protein trafficking is emerging as a novel means of modulating protein function, and in this minireview, the targeting of the trafficking of 2 key BBB proteins, P-glycoprotein and occludin, is presented as a novel, reversible means of optimizing central nervous system drug delivery.
Comparative Analysis of the Alzheimer Questionnaire (AQ) With the CDR Sum of Boxes, MoCA, and MMSE
Alzheimer Disease and Associated Disorders. Nov, 2012 | Pubmed ID: 23138174
The Alzheimer Questionnaire (AQ) has been established as a valid and accurate informant-based screening questionnaire for Alzheimer disease and amnestic mild cognitive impairment. Although the AQ's validity and diagnostic accuracy has been established, its performance in comparison with other instruments has not. Thirty-nine amnestic mild cognitive impairment cases and 34 Alzheimer disease cases were matched on the basis of age, education, and sex to 73 cognitively normal individuals. The sample had a mean age of 82.54±7.77 years and a mean education level of 14.61±2.61 years. The diagnostic accuracy of the CDR Sum of Boxes, Mini Mental State Exam (MMSE), and Montreal Cognitive Assessment (MoCA) were compared with the AQ. The AQ correlated strongly with the CDR Sum of Boxes (r=0.79) and demonstrated similar diagnostic accuracy with the MoCA and MMSE. These results suggest that the AQ is comparable with other established informant-based and patient-based measures.
Lymphadenectomy with Robotic Cystectomy
Current Urology Reports. Nov, 2012 | Pubmed ID: 23138180
It is now established that an experienced, dedicated robotic surgeon can perform a high quality extended template pelvic lymph node dissection at the time of robot-assisted radical cystectomy. The evidence for this conclusion can be seen in comparing absolute lymph node counts, percent positive lymph nodes, and oncologic outcomes from N1 patients. In this report, we outline the endpoints of study for this question, and report recent data on efforts to advance robot-assisted urinary diversion, cost-focused studies, and standardized complication reporting. These studies demonstrate maintenance of adequate lymph node dissections while advancing the goal of reducing morbidity for patients needing radical cystectomy for invasive disease.
Genome-wide Mapping of Methylated Adenine Residues in Pathogenic Escherichia Coli Using Single-molecule Real-time Sequencing
Nature Biotechnology. Nov, 2012 | Pubmed ID: 23138224
Single-molecule real-time (SMRT) DNA sequencing allows the systematic detection of chemical modifications such as methylation but has not previously been applied on a genome-wide scale. We used this approach to detect 49,311 putative 6-methyladenine (m6A) residues and 1,407 putative 5-methylcytosine (m5C) residues in the genome of a pathogenic Escherichia coli strain. We obtained strand-specific information for methylation sites and a quantitative assessment of the frequency of methylation at each modified position. We deduced the sequence motifs recognized by the methyltransferase enzymes present in this strain without prior knowledge of their specificity. Furthermore, we found that deletion of a phage-encoded methyltransferase-endonuclease (restriction-modification; RM) system induced global transcriptional changes and led to gene amplification, suggesting that the role of RM systems extends beyond protecting host genomes from foreign DNA.
Ethics, Finance, and Automation: A Preliminary Survey of Problems in High Frequency Trading
Science and Engineering Ethics. Nov, 2012 | Pubmed ID: 23138232
All of finance is now automated, most notably high frequency trading. This paper examines the ethical implications of this fact. As automation is an interdisciplinary endeavor, we argue that the interfaces between the respective disciplines can lead to conflicting ethical perspectives; we also argue that existing disciplinary standards do not pay enough attention to the ethical problems automation generates. Conflicting perspectives undermine the protection those who rely on trading should have. Ethics in finance can be expanded to include organizational and industry-wide responsibilities to external market participants and society. As a starting point, quality management techniques can provide a foundation for a new cross-disciplinary ethical standard in the age of automation.
ACAT Inhibition Reduces the Progression of Preexisting, Advanced Atherosclerotic Mouse Lesions Without Plaque or Systemic Toxicity
Arteriosclerosis, Thrombosis, and Vascular Biology. Nov, 2012 | Pubmed ID: 23139293
OBJECTIVE: Acyl-CoA:cholesterol acyltransferase (ACAT) converts cholesterol to cholesteryl esters in plaque foam cells. Complete deficiency of macrophage ACAT has been shown to increase atherosclerosis in hypercholesterolemic mice because of cytotoxicity from free cholesterol accumulation, whereas we previously showed that partial ACAT inhibition by Fujirebio compound F1394 decreased early atherosclerosis development. In this report, we tested F1394 effects on preestablished, advanced lesions of apolipoprotein-E-deficient mice. METHODS AND RESULTS: Apolipoprotein-E-deficient mice on Western diet for 14 weeks developed advanced plaques, and were either euthanized (Baseline), or continued on Western diet with or without F1394 and euthanized after 14 more weeks. F1394 was not associated with systemic toxicity. Compared with the baseline group, lesion size progressed in both groups; however, F1394 significantly retarded plaque progression and reduced plaque macrophage, free and esterified cholesterol, and tissue factor contents compared with the untreated group. Apoptosis of plaque cells was not increased, consistent with the decrease in lesional free cholesterol, no increase in plaque necrosis, and unimpaired efferocytosis (phagocytic clearance of apoptotic cells). The effects of F1394 were independent of changes in plasma cholesterol levels. CONCLUSIONS: Partial ACAT inhibition by F1394 lowered plaque cholesterol content and had other antiatherogenic effects in advanced lesions in apolipoprotein-E-deficient mice without overt systemic or plaque toxicity, suggesting the continued potential of ACAT inhibition for the clinical treatment of atherosclerosis, in spite of recent trial data.
Young Men's Use of Aggressive Tactics to Avoid Condom Use: A Test of a Theoretical Model
Social Work Research. Sep, 2012 | Pubmed ID: 23139623
Although research has demonstrated that men's aggression against women and inconsistent condom use are related phenomena, it is little is known as to what factors increase risk for aggression to avoid condom use. The present article tests a theory-based model of condom avoidance through sexual aggression. Adult male participants (N=289) were recruited nationally through online advertisements. Aggressive tactics to avoid condom use was measured using an adapted version of the revised Sexual Experiences Survey (Abbey et al., 2005) and assessed a variety of aggressive behaviors spanning coercion to physical force. 100 participants (35.3%) reported at least one instance of coercion or aggression to avoid using a condom. Structural equation modeling indicated that, attitudes towards women, inconsistent condom use, and number of sexual partners were significant predictors of aggressive tactics to avoid condom use. A better understanding of the attitudinal and behavioral pathways through which men avoid condom use through aggressive and coercive means will ultimately result in improved education and prevention efforts for at-risk men and women.
Impact of Xpert MTB/RIF Testing on Tuberculosis Management and Outcomes in Hospitalized Patients in Uganda
PloS One. 2012 | Pubmed ID: 23139799
The clinical impact of Xpert MTB/RIF for tuberculosis (TB) diagnosis in high HIV-prevalence settings is unknown.
Rapid Growth from 12 to 23 Months of Life Predicts Obesity in a Population of Pacific Island Children
Ethnicity & Disease. 2012 | Pubmed ID: 23140074
Rapid growth (RG) in early childhood has been associated with increased risk of obesity. The specific intervals when risk is highest have not been well examined and may help identify modifiable risk factors.
UAP56 Couples PiRNA Clusters to the Perinuclear Transposon Silencing Machinery
Cell. Nov, 2012 | Pubmed ID: 23141543
piRNAs silence transposons during germline development. In Drosophila, transcripts from heterochromatic clusters are processed into primary piRNAs in the perinuclear nuage. The nuclear DEAD box protein UAP56 has been previously implicated in mRNA splicing and export, whereas the DEAD box protein Vasa has an established role in piRNA production and localizes to nuage with the piRNA binding PIWI proteins Ago3 and Aub. We show that UAP56 colocalizes with the cluster-associated HP1 variant Rhino, that nuage granules containing Vasa localize directly across the nuclear envelope from cluster foci containing UAP56 and Rhino, and that cluster transcripts immunoprecipitate with both Vasa and UAP56. Significantly, a charge-substitution mutation that alters a conserved surface residue in UAP56 disrupts colocalization with Rhino, germline piRNA production, transposon silencing, and perinuclear localization of Vasa. We therefore propose that UAP56 and Vasa function in a piRNA-processing compartment that spans the nuclear envelope.
Systemic Absorption of Mitomycin-C when Used in Refractive Surgery
Journal of Cataract and Refractive Surgery. Nov, 2012 | Pubmed ID: 23141921
PURPOSE: To determine whether corneal topical application of mitomycin-C (MMC) results in measurable plasma levels of systemic absorption. SETTING: Madigan Army Medical Center, Refractive Surgery Center, Fort Lewis, Washington, and Micro-Constants Laboratory, San Diego, California, USA. DESIGN: Case-control study. METHODS: The study comprised male and female active-duty soldiers having excimer laser photorefractive keratectomy with MMC. Patients who met inclusion criteria were asked to provide a blood sample immediately after being treated with MMC 0.2 mg/mL (0.02%) for 30 seconds. Human plasma samples were evaluated by liquid chromatography mass spectrometry to determine whether MMC was present. RESULTS: Thirty samples were submitted for evaluation. There was zero detection of MMC in the submitted samples. The quantifiable limit was greater than 10.0 ng/mL. All samples were below this. CONCLUSIONS: In this study of 30 patients with topical application of MMC for refractive surgery, there was no measurable evidence of systemic absorption. Although systemic absorption has been found with use in larger quantities, it was not known whether MMC toxicity concerns could be extrapolated to the refractive surgery population. This information allows counseling of patients on the extremely low likelihood of systemic absorption or toxicity following current techniques for refractive surgery. FINANCIAL DISCLOSURE: No author has a financial or proprietary interest in any material or method mentioned.
Development of Doxorubicin-induced Chronic Cardiotoxicity in the B6C3F(1) Mouse Model
Toxicology and Applied Pharmacology. Nov, 2012 | Pubmed ID: 23142469
Serum levels of cardiac troponins serve as biomarkers of myocardial injury. However, troponins are released into the serum only after damage to cardiac tissue has occurred. Here, we report development of a mouse model of doxorubicin (DOX)-induced chronic cardiotoxicity to aid in the identification of predictive biomarkers of early events of cardiac tissue injury. Male B6C3F(1) mice were administered intravenous DOX at 3mg/kg body weight, or an equivalent volume of saline, once a week for 4, 6, 8, 10, 12, and 14weeks, resulting in cumulative DOX doses of 12, 18, 24, 30, 36, and 42mg/kg, respectively. Mice were sacrificed a week following the last dose. A significant reduction in body weight gain was observed in mice following exposure to a weekly DOX dose for 1week and longer compared to saline-treated controls. DOX treatment also resulted in declines in red blood cell count, hemoglobin level, and hematocrit compared to saline-treated controls after the 2nd weekly dose until the 8th and 9th doses, followed by a modest recovery. All DOX-treated mice had significant elevations in cardiac troponin T concentrations in plasma compared to saline-treated controls, indicating cardiac tissue injury. Also, a dose-related increase in the severity of cardiac lesions was seen in mice exposed to 24mg/kg DOX and higher cumulative doses. Mice treated with cumulative DOX doses of 30mg/kg and higher showed a significant decline in heart rate, suggesting drug-induced cardiac dysfunction. Altogether, these findings demonstrate the development of DOX-induced chronic cardiotoxicity in B6C3F(1) mice.
Central Melanin-Concentrating Hormone Influences Liver and Adipose Metabolism Via Specific Hypothalamic Nuclei and Efferent Autonomic/JNK1 Pathways
Gastroenterology. Nov, 2012 | Pubmed ID: 23142626
BACKGROUND & AIMS:: Specific neuronal circuits modulate autonomic outflow to liver and white adipose tissue. Melanin-concentrating hormone (MCH) deficient mice are hypophagic, lean and do not develop hepatosteatosis when fed on high fat diet. Herein, we sought to investigate the role of melanin-concentrating hormone (MCH), an orexigenic neuropeptide specifically expressed in the lateral hypothalamic area (LHA), on hepatic and adipocyte metabolism. METHODS:: Chronic central administration of MCH and adenoviral vectors increasing MCH signalling were performed in rats and mice. Vagal dennervation was done to assess its effect on liver metabolism. The peripheral effects on lipid metabolism were assessed by real-time PCR and western blot. RESULTS:: We demonstrate that the activation of MCH receptors (MCH-R) promotes nonalcoholic fatty liver disease (NAFLD) through the parasympathetic nervous system (PSNS), whereas it increases fat deposition in WAT via the suppression of sympathetic traffic. These metabolic actions are independent of parallel changes in food intake and energy expenditure. In the liver, MCH triggers lipid accumulation and lipid uptake, being c-Jun N-terminal kinase (JNK1) an essential player, while in adipocytes MCH induces metabolic pathways that promote lipid storage and decreases lipid mobilization. Genetic activation of MCH-R or infusion of MCH specifically in the LHA modulated hepatic lipid metabolism, whereas the specific activation of this receptor in the arcuate nucleus (ARC) affected adipocyte metabolism. CONCLUSIONS:: Our findings reveal that central MCH directly controls hepatic and adipocyte metabolism through different pathways.
The Influence of Procedure Delay on Resource Utilization: A National Study of Patients with Open Tibial Fracture
Plastic and Reconstructive Surgery. Nov, 2012 | Pubmed ID: 23142940
BACKGROUND:: The purpose of this study is to 1) understand national variation in delay of emergency procedures in patients with open tibial fracture at the hospital level and 2) compare length of stay (LOS) and cost in patients cared for at the best and worst performing hospitals for delay. METHODS:: We retrospectively analyzed the 2003 - 2009 Nationwide Inpatient Sample. Adult patients with primary diagnosis of open tibial fracture were selected for inclusion. We calculated hospital probability of delay of emergency procedures beyond the day of admission (day 0). Multilevel linear regression random effects models were created to evaluate the relationship between the treating hospital's tendency for delay (in quartiles) and the log-transformed outcomes of LOS and cost, while adjusting for patient and hospital variables. RESULTS:: The final sample included 7,029 patients from 332 hospitals. Adjusted analyses demonstrate that patients treated at hospitals in the fourth (worst) quartile for delay were estimated to have 12% (95% CI 2-21%) higher cost compared to patients treated at hospitals in the first quartile. In addition, patients treated at hospitals in the fourth quartile had an estimated 11% (CI 4-17%) longer LOS compared to patients treated at hospitals in the first quartile. CONCLUSIONS:: Patients with open tibial fracture treated at hospitals with more timely initiation of surgical care had lower cost and shorter LOS than patients treated at hospitals with less timely initiation of care. Policies directed toward mitigating variation in care are not only beneficial for patient outcomes, but may also reduce unnecessary waste.Level II (Prognostic).
Categorising Paediatric Prescribing Errors by Junior Doctors Through Prescribing Competency Assessment: Does Assessment Reflect Actual Practice?
European Journal of Clinical Pharmacology. Nov, 2012 | Pubmed ID: 23143155
PURPOSE: It is recognised that paediatric prescribing errors are prevalent, and that most are made by junior doctors; however, detecting errors in order to demonstrate actual error rates can be difficult. There is evidence to suggest that dosing errors are the most common type of prescribing error in practice, but there has been little research on whether prescribing assessments are an effective reflection of actual practice.This article aims to determine if prescribing error types in a paediatric prescribing competency assessment reflects error types seen in actual practice. METHODS: This study was conducted in Royal Manchester Children's Hospital (RMCH) and the participants were junior doctors working at RMCH in 2010-2011. The intervention was a prescribing competency assessment package at RMCH.The main outcome measurement was the category and rate of prescribing errors. Results were taken from the junior doctors' prescribing competency assessment. The assessment papers were analysed for errors and the errors were then broken down into pre-defined categories. RESULTS: Rates of prescribing errors in the competency assessment are higher than published results shown in practice (23.1 %). The most common type of prescribing error (incorrect calculation of dose) reflects results seen in actual practice. CONCLUSION: The types of prescribing errors made in the competency assessment are reflective of errors made in actual practice. Prescribing teaching can be tailored according to the types of errors noted; and the prescribing competency package as a whole can be used to educate junior doctors on good prescribing practice and reduce prescribing errors.
Interleukin Receptor Activates a MYD88-ARNO-ARF6 Cascade to Disrupt Vascular Stability
Nature. Nov, 2012 | Pubmed ID: 23143332
The innate immune response is essential for combating infectious disease. Macrophages and other cells respond to infection by releasing cytokines, such as interleukin-1β (IL-1β), which in turn activate a well-described, myeloid-differentiation factor 88 (MYD88)-mediated, nuclear factor-κB (NF-κB)-dependent transcriptional pathway that results in inflammatory-cell activation and recruitment. Endothelial cells, which usually serve as a barrier to the movement of inflammatory cells out of the blood and into tissue, are also critical mediators of the inflammatory response. Paradoxically, the cytokines vital to a successful immune defence also have disruptive effects on endothelial cell-cell interactions and can trigger degradation of barrier function and dissociation of tissue architecture. The mechanism of this barrier dissolution and its relationship to the canonical NF-κB pathway remain poorly defined. Here we show that the direct, immediate and disruptive effects of IL-1β on endothelial stability in a human in vitro cell model are NF-κB independent and are instead the result of signalling through the small GTPase ADP-ribosylation factor 6 (ARF6) and its activator ARF nucleotide binding site opener (ARNO; also known as CYTH2). Moreover, we show that ARNO binds directly to the adaptor protein MYD88, and thus propose MYD88-ARNO-ARF6 as a proximal IL-1β signalling pathway distinct from that mediated by NF-κB. Finally, we show that SecinH3, an inhibitor of ARF guanine nucleotide-exchange factors such as ARNO, enhances vascular stability and significantly improves outcomes in animal models of inflammatory arthritis and acute inflammation.
Loss-of-function Mutations in IGSF1 Cause an X-linked Syndrome of Central Hypothyroidism and Testicular Enlargement
Nature Genetics. Nov, 2012 | Pubmed ID: 23143598
Congenital central hypothyroidism occurs either in isolation or in conjunction with other pituitary hormone deficits. Using exome and candidate gene sequencing, we identified 8 distinct mutations and 2 deletions in IGSF1 in males from 11 unrelated families with central hypothyroidism, testicular enlargement and variably low prolactin concentrations. IGSF1 is a membrane glycoprotein that is highly expressed in the anterior pituitary gland, and the identified mutations impair its trafficking to the cell surface in heterologous cells. Igsf1-deficient male mice show diminished pituitary and serum thyroid-stimulating hormone (TSH) concentrations, reduced pituitary thyrotropin-releasing hormone (TRH) receptor expression, decreased triiodothyronine concentrations and increased body mass. Collectively, our observations delineate a new X-linked disorder in which loss-of-function mutations in IGSF1 cause central hypothyroidism, likely secondary to an associated impairment in pituitary TRH signaling.
In Vitro Exposure of Precision-Cut Lung Slices to 2-(4-Amino-3-Methylphenyl)-5-Fluorobenzothiazole Lysylamide Dihydrochloride (NSC 710305, Phortress) Increases Inflammatory Cytokine Content and Tissue Damage
Toxicological Sciences : an Official Journal of the Society of Toxicology. Nov, 2012 | Pubmed ID: 23143926
The anticancer drug [2-(4-Amino-3-Methylphenyl)-5-Fluorobenzothiazole Lysylamide Dihydrochloride] (NSC 710305, Phortress) is a metabolically activated prodrug that causes DNA adduct formation and subsequent toxicity. Preclinically, it was found that hepatic, bone marrow, and pulmonary toxicity presented challenges to developing this drug. An ex vivo precision-cut lung slice (PCLS) model was used to search for concentration dependent effects of NSC 710305 (10, 25, 50, and 100 µM) on cytokine content, protein content and immuno/histological endpoints. Preparation and culture of PCLS caused an initial spike in pro-inflammatory cytokine expression, and therefore treatment with NSC 710305 was delayed until 48 hours after initiating the slice cultures to avoid confounding the response to slicing with any drug response. PCLS were evaluated after 24, 48, and 72 hour exposures to NSC 710305. Reversibility of toxicity due to the 72 hour treatment was evaluated after a 24 hour recovery period. NSC 710305 caused a concentration-dependent cytokine response, and only the toxicity caused by a 72 hour exposure to 25 µM reversed during the 24 hour recovery period. Immuno/histological examination and quantitation of tissue protein levels indicated that tissue destruction, ED-1 (activated macrophage) staining and protein levels were associated with the levels of pro-inflammatory cytokines in the tissue. In conclusion, the concentration- and time-dependent inflammatory response of PCLS to NSC 710305 preceded relevant tissue damage by a few days. The no observable adverse effect level (NOAEL) for 24, 48 and 72 hour exposures was established as 10 µM NSC 710305.
Structural Comparison of ColH and ColG Collagen-binding Domains from Clostridium Histolyticum
Journal of Bacteriology. Nov, 2012 | Pubmed ID: 23144249
Clostridium histolyticum secretes collagenases, ColG and ColH that cause extensive tissue destruction in myonecrosis. The C-terminal collagen-binding domain (CBD) of collagenase is required for insoluble collagen fibril binding and subsequent collagenolysis. The high resolution crystal structures of ColG-CBD (s3b) and ColH-CBD (s3) are reported in this paper. The new X-ray structure of s3 was solved at 2.0 Å resolution (R=17.4%, R(free)=23.3%), while the resolution of the previously determined s3b was extended to 1.4 Å (R=17.9%, R(free)=21.0%). Despite sharing only 30% sequence identity, the molecules resemble one another closely (r.m.s.d. C(α) = 1.5 Å). All but one residue whose sidechain chelates with Ca(2+) are conserved. The dual Ca(2+) binding site in s3 is completed by an unconserved aspartate. Differential scanning calorimetric measurements showed that s3 gains thermal stability, comparable to s3b, by binding to Ca(2+) (holo T(M)=94.1 °C, apo T(M)=70.2 °C). Holo s3 is also stabilized against chemical denaturants, urea and guanidine HCl. The three most critical residues for collagen interaction in s3b are conserved in s3. The general shape of the binding pocket is retained by altered loop structures and side chain positions. Small angle X-ray scattering data revealed that s3 also binds asymmetrically to mini-collagen. Besides the calcium-binding sites and the collagen-binding pocket, architecturally important hydrophobic residues and hydrogen-bonding network around the cis-peptide bond are well-conserved within metallopeptidase subfamily M9B. CBDs were previously shown to bind to extracellular matrix of various tissues. Compactness and extreme stability in physiological Ca(2+) concentration possibly make both CBDs suitable for targeted growth factor delivery.
Human Airway Ciliary Dynamics
American Journal of Physiology. Lung Cellular and Molecular Physiology. Nov, 2012 | Pubmed ID: 23144323
Airway cilia depend on precise changes in shape to transport the mucus gel overlying mucosal surfaces. The ciliary motion can be recorded in several planes using video microscopy. But cilia are densely packed and automated computerized systems are not available to convert these ciliary shape changes into forms that are useful for testing theoretical models of ciliary function. We developed a system for converting planar ciliary motions recorded by video microscopy into an empirical quantitative model which is easy to use in validating mathematical models, or in examining ciliary function, e.g. in primary ciliary dyskinesia (PCD). The system we developed allows the manipulation of a model cilium superimposed over a video of beating cilia. Data were analyzed to determine shear angles and velocity vectors of points along the cilium. Extracted waveforms were used to construct a composite waveform which could be used as a standard. Variability was measured as the mean difference in position of points on individual waveforms and the standard. The shapes analyzed were the end-recovery, end-effective, and fastest moving effective and recovery with mean (±standard error) differences of 0.31(0.04), 0.25(0.06), 0.50(0.12), 0.50(0.10), µm respectively. In contrast, the same measures for three different PCD waveforms had values far outside this range.
Neurobehavioral Risk is Associated with Gestational Exposure to Stress Hormones
Expert Review of Endocrinology & Metabolism. Jul, 2012 | Pubmed ID: 23144647
The developmental origins of disease or fetal programming model predict that early exposures to threat or adverse conditions have lifelong consequences that result in harmful outcomes for health. The maternal endocrine 'fight or flight' system is a source of programming information for the human fetus to detect threats and adjust their developmental trajectory for survival. Fetal exposures to intrauterine conditions including elevated stress hormones increase the risk for a spectrum of health outcomes depending on the timing of exposure, the timetable of organogenesis and the developmental milestones assessed. Recent prospective studies, reviewed here, have documented the neurodevelopmental consequences of fetal exposures to the trajectory of stress hormones over the course of gestation. These studies have shown that fetal exposures to biological markers of adversity have significant and largely negative consequences for fetal, infant and child emotional and cognitive regulation and reduced volume in specific brain structures.
Ranking Transitive Chemical-disease Inferences Using Local Network Topology in the Comparative Toxicogenomics Database
PloS One. 2012 | Pubmed ID: 23144783
Exposure to chemicals in the environment is believed to play a critical role in the etiology of many human diseases. To enhance understanding about environmental effects on human health, the Comparative Toxicogenomics Database (CTD; http://ctdbase.org) provides unique curated data that enable development of novel hypotheses about the relationships between chemicals and diseases. CTD biocurators read the literature and curate direct relationships between chemicals-genes, genes-diseases, and chemicals-diseases. These direct relationships are then computationally integrated to create additional inferred relationships; for example, a direct chemical-gene statement can be combined with a direct gene-disease statement to generate a chemical-disease inference (inferred via the shared gene). In CTD, the number of inferences has increased exponentially as the number of direct chemical, gene and disease interactions has grown. To help users navigate and prioritize these inferences for hypothesis development, we implemented a statistic to score and rank them based on the topology of the local network consisting of the chemical, disease and each of the genes used to make an inference. In this network, chemicals, diseases and genes are nodes connected by edges representing the curated interactions. Like other biological networks, node connectivity is an important consideration when evaluating the CTD network, as the connectivity of nodes follows the power-law distribution. Topological methods reduce the influence of highly connected nodes that are present in biological networks. We evaluated published methods that used local network topology to determine the reliability of protein-protein interactions derived from high-throughput assays. We developed a new metric that combines and weights two of these methods and uniquely takes into account the number of common neighbors and the connectivity of each entity involved. We present several CTD inferences as case studies to demonstrate the value of this metric and the biological relevance of the inferences.
The Impact of Climate Change on Indigenous Arabica Coffee (Coffea Arabica): Predicting Future Trends and Identifying Priorities
PloS One. 2012 | Pubmed ID: 23144840
Precise modelling of the influence of climate change on Arabica coffee is limited; there are no data available for indigenous populations of this species. In this study we model the present and future predicted distribution of indigenous Arabica, and identify priorities in order to facilitate appropriate decision making for conservation, monitoring and future research. Using distribution data we perform bioclimatic modelling and examine future distribution with the HadCM3 climate model for three emission scenarios (A1B, A2A, B2A) over three time intervals (2020, 2050, 2080). The models show a profoundly negative influence on indigenous Arabica. In a locality analysis the most favourable outcome is a c. 65% reduction in the number of pre-existing bioclimatically suitable localities, and at worst an almost 100% reduction, by 2080. In an area analysis the most favourable outcome is a 38% reduction in suitable bioclimatic space, and the least favourable a c. 90% reduction, by 2080. Based on known occurrences and ecological tolerances of Arabica, bioclimatic unsuitability would place populations in peril, leading to severe stress and a high risk of extinction. This study establishes a fundamental baseline for assessing the consequences of climate change on wild populations of Arabica coffee. Specifically, it: (1) identifies and categorizes localities and areas that are predicted to be under threat from climate change now and in the short- to medium-term (2020-2050), representing assessment priorities for ex situ conservation; (2) identifies 'core localities' that could have the potential to withstand climate change until at least 2080, and therefore serve as long-term in situ storehouses for coffee genetic resources; (3) provides the location and characterization of target locations (populations) for on-the-ground monitoring of climate change influence. Arabica coffee is confimed as a climate sensitivite species, supporting data and inference that existing plantations will be neagtively impacted by climate change.
Rapid Antigen Detection Tests for Malaria Diagnosis in Severely Ill Papua New Guinean Children: a Comparative Study Using Bayesian Latent Class Models
PloS One. 2012 | Pubmed ID: 23144935
Although rapid diagnostic tests (RDTs) have practical advantages over light microscopy (LM) and good sensitivity in severe falciparum malaria in Africa, their utility where severe non-falciparum malaria occurs is unknown. LM, RDTs and polymerase chain reaction (PCR)-based methods have limitations, and thus conventional comparative malaria diagnostic studies employ imperfect gold standards. We assessed whether, using Bayesian latent class models (LCMs) which do not require a reference method, RDTs could safely direct initial anti-infective therapy in severe ill children from an area of hyperendemic transmission of both Plasmodium falciparum and P. vivax.
The Putative G-protein Coupled Estrogen Receptor Agonist G-1 Suppresses Proliferation of Ovarian and Breast Cancer Cells in a GPER-independent Manner
American Journal of Translational Research. 2012 | Pubmed ID: 23145207
G-protein coupled estrogen receptor 1 (GPER) plays an important role in mediating estrogen action in many different tissues under both physiological and pathological conditions. G-1 (1-[4-(6-bromobenzo[1,3]dioxol-5yl)-3a,4,5,9b-tetrahydro-3H-cyclopenta [c]quinolin-8-yl]-ethanone) has been developed as a selective GPER agonist to distinguish estrogen actions mediated by GPER from those mediated by classic estrogen receptors. In the present study, we surprisingly found that G-1 suppressed proliferation and induced apoptosis of KGN cells (a human ovarian granulosa cell tumor cell line), actions that were not blocked by a selective GPER antagonist G15 or siRNA knockdown of GPER. G-1 also suppressed proliferation and induced cell apoptosis in GPER-negative HEK-293 cells and MDA-MB 231 breast cancer cells. Our results demonstrate that G-1 suppresses proliferation of ovarian and breast cancer cells in a GPER-independent manner. G-1 may be a candidate for the development of drugs against ovarian and breast cancer.
Thermal and Viscous Effects on Sound Waves: Revised Classical Theory
The Journal of the Acoustical Society of America. Nov, 2012 | Pubmed ID: 23145583
In this paper the recently developed, bi-velocity model of fluid mechanics based on the principles of linear irreversible thermodynamics (LIT) is applied to sound propagation in gases taking account of first-order thermal and viscous dissipation effects. The results are compared and contrasted with the classical Navier-Stokes-Fourier results of Pierce for this same situation cited in his textbook. Comparisons are also made with the recent analyses of Dadzie and Reese, whose molecularly based sound propagation calculations furnish results virtually identical with the purely macroscopic LIT-based bi-velocity results below, as well as being well-supported by experimental data. Illustrative dissipative sound propagation examples involving application of the bi-velocity model to several elementary situations are also provided, showing the disjoint entropy mode and the additional, evanescent viscous mode.
Compositional and Mechanical Properties of Peanuts Roasted to Equivalent Colors Using Different Time/Temperature Combinations
Journal of Food Science. Nov, 2012 | Pubmed ID: 23145904
Peanuts in North America and Europe are primarily consumed after dry roasting. Standard industry practice is to roast peanuts to a specific surface color (Hunter L-value) for a given application; however, equivalent surface colors can be attained using different roast temperature/time combinations, which could affect product quality. To investigate this potential, runner peanuts from a single lot were systematically roasted using 5 roast temperatures (147, 157, 167, 177, and 187 °C) and to Hunter L-values of 53 ± 1, 48.5 ± 1, and 43 ± 1, corresponding to light, medium, and dark roasts, respectively. Moisture contents (MC) ranged from 0.41% to 1.70% after roasting. At equivalent roast temperatures, MC decreased as peanuts became darker; however, for a given color, MC decreased with decreasing roast temperature due to longer roast times required for specified color formation. Initial total tocopherol contents of expressed oils ranged from 164 to 559 μg/g oil. Peanuts roasted at lower temperatures and darker colors had higher tocopherol contents. Glucose content was roast color and temperature dependent, while fructose was only temperature dependent. Soluble protein was lower at darker roast colors, and when averaged across temperatures, was highest when samples were roasted at 187 °C. Lysine content decreased with increasing roast color but was not dependent on temperature. MC strongly correlated with several components including tocopherols (R(2) = 0.67), soluble protein (R(2) = 0.80), and peak force upon compression (R(2) = 0.64). The variation in characteristics related to roast conditions is sufficient to suggest influences on final product shelf life and consumer acceptability. Practical Application: Peanuts are typically dry roasted to a specified surface color for a given food application; however, it is possible to obtain equivalent colors using different temperatures. This simple observation led to the overall goal of this research which was to determine if peanuts roasted to equivalent surface colors using different temperatures are equivalent from a quality perspective. Several compositional and textural measurements important to product quality differed based on the temperature used to achieve a given roast color. Overall, this study suggests there is good potential to optimize peanut quality by simply adjusting the time/temperature profiles during roasting.
Dendrimeric Bowties Featuring Hemispheric-Selective Decoration of Ligands for MicroRNA-Based Therapy
Biomacromolecules. Nov, 2012 | Pubmed ID: 23145944
Dendrimers feature a defined number of terminal groups that may bind RNA or be functionalized with bioactive molecules. These competing uses of terminal groups may create an impasse if the requisite density of ligands depletes the number of terminal groups for binding sufficient RNA, or vice versa. A novel dendrimeric platform is needed that maintains high ligand density while retaining sufficient microRNA-binding terminal groups. Here we present a dendrimeric "bowtie" consisting of one half devoted to microRNA binding and the other half to ligand presentation. We demonstrate its suitability as a transfection agent by delivering miR-126 to HUVECs via polyarginine- and RGD-modified bowties and evaluating the downstream effects on proliferation and tube formation. Our findings indicate that the bowtie elicits desired responses and may possess superior delivery properties compared to non-decorated dendrimeric materials. The bowtie system thereby provides a new design model for developing dendrimeric delivery vehicles for RNAi therapeutics.
Passive Pressure-Diameter Relationship and Structural Composition of Rat Mesenteric Lymphangions
Lymphatic Research and Biology. Nov, 2012 | Pubmed ID: 23145980
Abstract Background: Lymph flow depends on both the rate of lymph production by tissues and the extent of passive and active pumping. Here we aim to characterize the passive mechanical properties of a lymphangion in both mid-lymphangion and valve segments to assess regional differences along a lymphangion, as well as evaluating its structural composition. Methods and Results: Mesenteric lymphatic vessels were isolated and cannulated in a microchamber for pressure-diameter (P-D) testing. Vessels were inflated from 0 to 20 cmH(2)O at a rate of 4 cmH(2)O/min, and vessel diameter was continuously tracked, using an inverted microscope, video camera, and custom LabVIEW program, at both mid-lymphangion and valve segments. Isolated lymphatic vessels were also pressure-fixed at 2 and 7 cmH(2)O and imaged using a nonlinear optical microscope (NLOM) to obtain collagen and elastin structural information. We observed a highly nonlinear P-D response at low pressures (3-5 cmH(2)O), which was modeled using a three-parameter constitutive equation. No significant difference in the passive P-D response was observed between mid-lymphangion and valve regions. NLOM imaging revealed an inner elastin layer and outer collagen layer at all locations. Lymphatic valve leaflets were predominantly elastin with thick axially oriented collagen bands at the insertion points. Conclusions: We observed a highly nonlinear P-D response at low pressures (3-5 cmH(2)O) and developed the first constitutive equation to describe the passive P-D response for a lymphangion. The passive P-D response did not vary among regions, in agreement with the composition of elastin and collagen in the lymphatic wall.
Supraglottic Airway Devices During Neonatal Resuscitation: An Historical Perspective, Systematic Review and Meta-analysis of Available Clinical Trials
Resuscitation. Nov, 2012 | Pubmed ID: 23146881
INTRODUCTION: Various supraglottic airway devices are routinely used to maintain airway patency in children and adults. However, oropharyngeal airways or laryngeal masks (LM) are not routinely used during neonatal resuscitation. METHODS: The aim of this article was to review the available literature about the use of supraglottic airway devices during neonatal resuscitation. We reviewed books, resuscitation manuals and articles from 1830 to the present using the search terms "Infant", "Newborn", "Delivery Room", "Resuscitation", "Airway management", "Positive Pressure Respiration", "Oropharyngeal Airway" and "Laryngeal Mask". RESULTS: No study was identified using oropharyngeal airways during neonatal resuscitation. Four trials including 509 infants compared positive pressure ventilation with a LM, bag and mask or an endotracheal tube. Infants in the LM group were intubated less frequently compared to infants in the bag and mask ventilation group 4/275 vs. 28/234 (OR 0.13, 95% CI 0.05-0.34). Infants resuscitated with the LM had significantly less unsuccessful resuscitations 4/275 vs. 31/234 (OR 0.10, 95% CI 0.03-0.28). Two trials including 34 preterm infants compared surfactant administration via LM vs. endotracheal tube. LM surfactant administration was safe and no adverse events were reported. CONCLUSION: The efficacy and safety of oropharyngeal airways during neonatal resuscitation remain unclear and randomized trials are required. The current evidence suggests that resuscitation with a LM is a feasible and safe alternative to mask ventilation in infants >34 weeks gestation and birth weight >2000g. However, further randomized control trials are needed to evaluate short- and long-term outcomes following use of laryngeal masks. In addition, surfactant administration via LM should be used only within clinical trials.
Impact of Adaptive Statistical Iterative Reconstruction on Radiation Dose in Evaluation of Trauma Patients
The Journal of Trauma and Acute Care Surgery. Dec, 2012 | Pubmed ID: 23147183
A recent study showed that computed tomographic (CT) scans contributed 93% of radiation exposure of 177 patients admitted to our Level I trauma center. Adaptive statistical iterative reconstruction (ASIR) is an algorithm that reduces the noise level in reconstructed images and therefore allows the use of less ionizing radiation during CT scans without significantly affecting image quality. ASIR was instituted on all CT scans performed on trauma patients in June 2009. Our objective was to determine if implementation of ASIR reduced radiation dose without compromising patient outcomes.
Incorporating Indels As Phylogenetic Characters: Impact for Interfamilial Relationships Within Arctoidea (Mammalia: Carnivora)
Molecular Phylogenetics and Evolution. Nov, 2012 | Pubmed ID: 23147269
Insertion and deletion events (indels) provide a suite of markers with enormous potential for molecular phylogenetics. Using many more indel characters than those in previous studies, we here for the first time address the impact of indel inclusion on the phylogenetic inferences of Arctoidea (Mammalia: Carnivora). Based on 6843 indel characters from 22 nuclear intron loci of 16 species of Arctoidea, our analyses demonstrate that when the indels were not taken into consideration, the monophyly of Ursidae and Pinnipedia tree and the monophyly of Pinnipedia and Musteloidea tree were both recovered, whereas inclusion of indels by using three different indel coding schemes give identical phylogenetic tree topologies supporting the monophyly of Ursidae and Pinnipedia. Our work brings new perspectives on the previously controversial placements among Arctoidea families, and provides another example demonstrating the importance of identifying and incorporating indels in the phylogenetic analyses of introns. In addition, comparison of indel incorporation methods revealed that the three indel coding methods are all advantageous over treating indels as missing data, given that incorporating indels produces consistent results across methods. This is the first report of the impact of different indel coding schemes on phylogenetic reconstruction at the family level in Carnivora, which indicates that indels should be taken into account in the future phylogenetic analyses.
Depletion of the Ubiquitin Binding Adaptor Molecule SQSTM1/p62 from Macrophages Harboring Cftr {Delta}F508 Mutation Improves the Delivery of Burkholderia Cenocepacia to the Autophagic Machinery
The Journal of Biological Chemistry. Nov, 2012 | Pubmed ID: 23148214
Cystic fibrosis (CF) is the most common inherited lethal disease in Caucasians. It is caused by mutations in the cystic fibrosis transmembrane conductance regulator (CFTR) of which the cftr ΔF508 mutation is the most common. ΔF508 macrophages are intrinsically defective in autophagy due to the sequestration of essential autophagy molecules within unprocessed CFTR aggregates. Defective autophagy allows Burkholderia cenocepacia (B. cepacia) to survive and replicate in ΔF508 macrophages. Infection by B. cepacia poses great risk to CF patients because it causes accelerated lung inflammation and in some cases a lethal necrotizing pneumonia. Autophagy is a cell survival mechanism whereby an autophagosome engulfs non-functional organelles and delivers them to the lysosome for degradation. The ubiquitin binding adaptor protein SQSTM1/p62 is required for the delivery of several ubiquitinated cargos to the autophagosome. In wild-type (WT) macrophages, p62 depletion and overexpression lead to increased and decreased bacterial intracellular survival, respectively. In contrast, depletion of p62 in ΔF508 macrophages results in decreased bacterial survival, whereas overexpression of p62 leads to increased B. cepacia intracellular growth. Interestingly, the depletion of p62 from ΔF508 macrophages results in the release of the autophagy molecule beclin1 (BECN1), from the mutant CFTR aggregates and allows its redistribution and recruitment to the B. cepacia vacuole, mediating the acquisition of the autophagy marker LC3 and bacterial clearance via autophagy. These data demonstrate that p62 differentially dictates the fate of B. cepacia infection in WT and F508 macrophages.
Variations in the RBE for Cell Killing Along the Depth-Dose Profile of a Modulated Proton Therapy Beam
Radiation Research. Nov, 2012 | Pubmed ID: 23148508
Considerable evidence now exists to show that that the relative biological effectiveness (RBE) changes considerably along the proton depth-dose distribution, with progressively higher RBE values at the distal part of the modulated, or spread out Bragg peak (SOBP) and in the distal dose fall-off (DDF). However, the highly variable nature of the existing studies (with regards to cell lines, and to the physical properties and dosimetry of the various proton beams) precludes any consensus regarding the RBE weighting factor at any position in the depth-dose profile. We have thus conducted a systematic study on the variation in RBE for cell killing for two clinical modulated proton beams at Indiana University and have determined the relationship between the RBE and the dose-averaged linear energy transfer (LETd) of the protons at various positions along the depth-dose profiles. Clonogenic assays were performed on human Hep2 laryngeal cancer cells and V79 cells at various positions along the SOBPs of beams with incident energies of 87 and 200 MeV. There was a marked variation in the radiosensitivity of both cell lines along the SOBP depth-dose profile of the 87 MeV proton beam. Using Hep2 cells, the D(0.1) isoeffect dose RBE values (normalized against (60)Co) were 1.46 at the middle of SOBP, 2.1 at the distal end of the SOBP and 2.3 in the DDF. For V79 cells, the D(0.1) isoeffect RBE for the 87 MEV beam were 1.23 for the proximal end of the SOBP: 1.46 for the distal SOBP and 1.78 for the DDF. Similar D(0.1) isoeffect RBE values were found for Hep2 cells irradiated at various positions along the depth-dose profile of the 200 MeV beam. Our experimentally derived RBE values were significantly correlated (P = 0.001) with the mean LETd of the protons at the various depths, which confirmed that proton RBE is highly dependent on LETd. These in vitro data suggest that the RBE of the proton beam at certain depths is greater than 1.1, a value currently used in most treatment planning algorithms. Thus, the potential for increased cell killing and normal tissue damage in the distal regions of the proton SOBP may be greater than originally thought.
Visualising Associations Between Paired `omics' Data Sets
BioData Mining. Nov, 2012 | Pubmed ID: 23148523
ABSTRACT: BACKGROUND: Each omics platform is now able to generate a large amount of data. Genomics, proteomics,metabolomics, interactomics are compiled at an ever increasing pace and now form a core part of thefundamental systems biology framework. Recently, several integrative approaches have beenproposed to extract meaningful information. However, these approaches lack of visualisation outputsto fully unravel the complex associations between different biological entities. RESULTS: The multivariate statistical approaches 'regularized Canonical Correlation Analysis' and 'sparsePartial Least Squares regression' were recently developed to integrate two types of highlydimensional 'omics' data and to select relevant information. Using the results of these methods, wepropose to revisit few graphical outputs to better understand the relationships between two 'omics'data and to better visualise the correlation structure between the different biological entities. Thesegraphical outputs include Correlation Circle plots, Relevance Networks and Clustered Image Maps.We demonstrate the usefulness of such graphical outputs on several biological data sets and furtherassess their biological relevance using gene ontology analysis. CONCLUSIONS: Such graphical outputs are undoubtedly useful to aid the interpretation of these promising integrativeanalysis tools and will certainly help in addressing fundamental biological questions andunderstanding systems as a whole. AVAILABILITY: The graphical tools described in this paper are implemented in the freely available R packagemixOmics and in its associated web application.
Aromatase Inhibitors Associated with Knee Subchondral Bone Expansion Without Cartilage Loss
Climacteric : the Journal of the International Menopause Society. Nov, 2012 | Pubmed ID: 23148546
ABSTRACT Background: The profound estrogen depletion caused by aromatase inhibitors (AIs) is associated with musculoskeletal symptoms, but the underlying pathophysiology remains unclear. Objective: To assess the effects of AI therapy on structural changes in knee cartilage and subchondral bone over 2 years in postmenopausal women. Setting and Participants: 30 women with breast cancer, mean age 58.5 (SD±5.6) years and 62 healthy controls, mean age 56.5 (SD±4.6) years. Main Outcome Measures: Annualized changes in tibial cartilage volume and subchondral bone area, and worsening of tibiofemoral cartilage defects from paired knee magnetic resonance imaging 2 years apart were compared between the two groups. Results: The AI-treated women had significantly greater expansion of the tibial plateau than the control group. The mean annualized difference, after adjusting for age, body mass index and baseline bone area, was 22.1 mm(2) (95% confidence interval (CI) 7.6-36.6, p=0.003) for the medial tibial plateau and 19.1 mm(2) (95% CI 9.6-28.5, p<0.001) for the lateral tibial plateau. The annual change in tibial cartilage volume and the worsening of cartilage defects did not differ between women taking AI therapy and controls. Conclusions: AI therapy is associated with knee subchondral bone expansion knee with no effect on knee cartilage in postmenopausal women without pre-existing joint symptoms. This suggests the effect of severe estrogen depletion on knee is on bone with the tibial bone expansion most likely a response to mechanical load in the setting of bone loss. Whether this then results in an increased risk of knee osteoarthritis will need to be determined.
The Efficacy of Vigorous-intensity Exercise As an Aid to Smoking Cessation in Adults with Elevated Anxiety Sensitivity: Study Protocol for a Randomized Controlled Trial
Trials. Nov, 2012 | Pubmed ID: 23148822
ABSTRACT: BACKGROUND: Although cigarette smoking is a leading cause of death and disability in the United States (US), over 40 million adults in the US currently smoke. Quitting smoking is particularly difficult for smokers with certain types of psychological vulnerability. Researchers have frequently called attention to the relation between smoking and anxiety-related states and disorders, and evidence suggests that panic and related anxiety vulnerability factors, specifically anxiety sensitivity (AS or fear of somatic arousal), negatively impact cessation. Accordingly, there is merit to targeting AS among smokers to improve cessation outcome. Aerobic exercise has emerged as a promising aid for smoking cessation for this high-risk (for relapse) group because exercise can effectively reduce AS and other factors predicting smoking relapse (for example, withdrawal, depressed mood, anxiety), and it has shown initial efficacy for smoking cessation. The current manuscript presents the rationale, study design and procedures, and design considerations of the Smoking Termination Enhancement Project (STEP). METHODS: STEP is a randomized clinical trial that compares a vigorous-intensity exercise intervention to a health and wellness education intervention as an aid for smoking cessation in adults with elevated AS. One hundred and fifty eligible participants will receive standard treatment (ST) for smoking cessation that includes cognitive behavioral therapy (CBT) and nicotine replacement therapy (NRT). In addition, participants will be randomly assigned to either an exercise intervention (ST+EX) or a health and wellness education intervention (ST+CTRL). Participants in both arms will meet 3 times a week for 15 weeks, receiving CBT once a week for the first 7 weeks, and 3 supervised exercise or health and wellness education sessions (depending on randomization) per week for the full 15-week intervention. Participants will be asked to set a quit date for 6 weeks after the baseline visit, and smoking cessation outcomes as well as putative mediator variables will be measured up to 6 months following the quit date. DISCUSSION: The primary objective of STEP is to evaluate whether vigorous-intensity exercise can aid smoking cessation in anxiety vulnerable adults. If effective, the use of vigorous-intensity exercise as a component of smoking cessation interventions would have a significant public health impact. Specifically, in addition to improving smoking cessation treatment outcome, exercise is expected to offer benefits to overall health, which may be particularly important for smokers. The study is also designed to test putative mediators of the intervention effects and therefore has the potential to advance the understanding of exercise-anxiety-smoking relations and guide future research on this topic.Clinical trials registryClinicalTrials.gov, NCT01065506, http://clinicaltrials.gov/ct2/show/NCT01065506.
Impact of Gestational Diabetes Mellitus on Pubertal Changes in Adiposity and Metabolic Profiles in Latino Offspring
The Journal of Pediatrics. Nov, 2012 | Pubmed ID: 23149173
OBJECTIVE: To examine the impact of maternal gestational diabetes mellitus (GDM) status on longitudinal changes in adiposity and metabolic variables in overweight Latino offspring (from age 8-20 years) across puberty. STUDY DESIGN: This longitudinal cohort of 210 overweight Latino children was measured annually for a period of 3 ± 1 years for Tanner stage through physical examination, adiposity by dual-energy X-ray absorptiometry and magnetic resonance imaging, lipids, and glucose and insulin action via the oral glucose tolerance test and frequently sampled intravenous glucose tolerance test. Linear mixed-effects modeling estimated the impact of maternal GDM status on baseline and changes in adiposity and metabolic variables across puberty. RESULTS: In our cohort, 22% of offspring were from GDM pregnancies. At baseline, the GDM offspring were heavier at birth, more likely to have a family history of type 2 diabetes, and less likely to have been breastfed (for any duration). Compared with the non-GDM offspring, the GDM offspring had greater increases in total body fat (+6.5% vs +4.5%; P = .03) and steeper declines in acute insulin response (-39% vs -17%; P < .001) and disposition index (-57% vs -35%; P < .001) across Tanner stages, independent of ethnicity, sex, breastfeeding status, family history of diabetes, and baseline and changes in body composition. CONCLUSION: These findings confirm the elevated risk for excess adiposity and type 2 diabetes in GDM offspring, and further underscore the need for interventions targeting Latino GDM and their offspring.
Gastric Band Adjustment Credentialing Guidelines for Physician Extenders
Surgery for Obesity and Related Diseases : Official Journal of the American Society for Bariatric Surgery. Nov, 2012 | Pubmed ID: 23149262
Patterns of Family Doctor Decision Making in Practice Context. What Are the Implications for Medical Practice Variation and Social Disparities?
Social Science & Medicine (1982). Nov, 2012 | Pubmed ID: 23149333
Medical practice variation and social disparities in health are pervasive features of health care systems. But what impact might everyday clinical decision making have in shaping such aggregate patterns, and could this in turn be influenced by the immediate environment in which family doctors practise? We investigate this by studying inter-practitioner variation in clinical activity across four payment types in New Zealand, a "gatekeeper" primary care system. We do this for four measures of clinical activity by patient ethnic and socio-economic status in a 2001/2002 representative sample of 9272 encounters at 185 family practices. Initial analysis showed little variation in clinical activity either by patient status or by practice type. However, with the application of multi-level statistical techniques it was evident that, while there was still little systematic difference in practitioner activity rates by patient status, inter-practitioner variation was greater for patients of ethnic minority background and from socio-economically deprived areas. Furthermore, this variability was particularly marked in fee-for-service practice settings. Thus, to the extent that family doctor decision-making behaviour within practice context helps shape aggregate patterns of medical practice variation and social disparity, treatment differences are likely associated not with the level of service but with its variability.
Pilot Intervention Outcomes of an Educational Program for Biospecimen Research Participation
Journal of Cancer Education : the Official Journal of the American Association for Cancer Education. Nov, 2012 | Pubmed ID: 23150142
Biospecimen banking programs are critically dependent on participation of diverse population members. The purpose of this study was to test a pilot intervention to enhance recruitment to a biospecimen bank among racially diverse community members. A mixed methods, community-based participatory research (CBPR) orientation was used to develop and pilot an intervention to educate and recruit participants to a biospecimen bank. Pre- and post-assessments of knowledge about research, perceived costs and benefits of participation (expected utility), and emotional states associated with research participation (affective associations) as well as post-intervention participation in biobanking were examined to determine intervention effectiveness. The pilot intervention educated 148 community members; 107 (73 %) donated blood and 77 (52 %) completed a 36-page lifestyle questionnaire. Thirty-two percent of participants were African American and 11 % were Native American. Participating in the educational program significantly reduced negative affect associated with research involving collection of genetic material or completion of a survey. Improved knowledge and understanding of biobanking and research through a CBPR approach are likely to increase participation rates in biobanking for diverse community members. Accurate information and improved knowledge can reduce individual anxiety and concerns that serve as barriers to research participation.
An Investigation of Risk Factors for Renal Cell Carcinoma by Histologic Subtype in Two Case-control Studies
International Journal of Cancer. Journal International Du Cancer. Nov, 2012 | Pubmed ID: 23150424
To investigate whether renal cell carcinoma (RCC) histologic subtypes possess different etiologies, we conducted analyses of established RCC risk factors by subtype (clear cell, papillary, chromophobe) in two case-control studies conducted in the United States (1,217 cases, 1,235 controls) and Europe (1,097 cases, 1,476 controls). Histology was ascertained for 706 U.S. cases (58% of total) and 917 European cases (84%) through a central slide review conducted by a single pathologist. For the remaining cases, histology was abstracted from the original diagnostic pathology report. Case-only analyses were performed to compute odds ratios (ORs) and 95% confidence intervals (CI) summarizing subtype differences by age, sex, and race. Case-control analyses were performed to compute subtype-specific ORs for other risk factors using polytomous regression. In case-only analyses, papillary cases (N=237) were older (OR=1.2, 95% CI=1.1-1.4 per 10-year increase), less likely to be female (OR=0.5, 95 % CI=0.4- 0.8) and more likely to be black (OR=2.6, 95% CI=1.8-3.9) compared to clear cell cases (N=1,524). In case-control analyses, BMI was associated with clear cell (OR=1.2, 95% CI=1.1-1.3 per 5kg/m(2) increase) and chromophobe RCC (N=80; OR=1.2, 95% CI=1.1- 1.4), but not papillary RCC (OR=1.1, 95% CI=1.0-1.2; test vs. clear cell, P=0.006). No subtype differences were observed for associations with smoking, hypertension or family history of kidney cancer. Our findings support the existence of distinct age, sex and racial distributions for RCC subtypes, and suggest that the obesity-RCC association differs by histology. © 2012 Wiley Periodicals, Inc.
Author Response: Axial Length Changes with Shifts of Gaze in Myopes and Emmetropes
Investigative Ophthalmology & Visual Science. Dec, 2012 | Pubmed ID: 23150636
Surgical Treatment of Primary Dupuytren's Contractures of the Fingers in the UK: Surgeons' Preferences and Research Priorities
The Journal of Hand Surgery, European Volume. Nov, 2012 | Pubmed ID: 23151352
Development and Validation of an Assessment of Adult Educators' Reading Instructional Knowledge
Annals of Dyslexia. Nov, 2012 | Pubmed ID: 23152145
The purpose of this paper is to describe briefly the development and utility of the Assessment of Reading Instructional Knowledge-Adults (ARIK-A), the only nationally normed (n = 468) measure of adult reading instructional knowledge, created to facilitate professional development of adult educators. Developmental data reveal reliabilities ranging from 0.73 to 0.85 for five ARIK-A scales (alphabetics, fluency, vocabulary, comprehension, and assessment) and 0.91 for the composite score; factor analytic data and expert review provide support for construct validity as well. Information on how to use the ARIK-A to determine mastery and relative standing is presented. With two alternate forms, the ARIK-A is a promising and needed tool for adult education practitioners within continuing education and professional development contexts.
Fish Utilisation of Wetland Nurseries with Complex Hydrological Connectivity
PloS One. 2012 | Pubmed ID: 23152857
The physical and faunal characteristics of coastal wetlands are driven by dynamics of hydrological connectivity to adjacent habitats. Wetlands on estuary floodplains are particularly dynamic, driven by a complex interplay of tidal marine connections and seasonal freshwater flooding, often with unknown consequences for fish using these habitats. To understand the patterns and subsequent processes driving fish assemblage structure in such wetlands, we examined the nature and diversity of temporal utilisation patterns at a species or genus level over three annual cycles in a tropical Australian estuarine wetland system. Four general patterns of utilisation were apparent based on CPUE and size-structure dynamics: (i) classic nursery utlisation (use by recently settled recruits for their first year) (ii) interrupted peristence (iii) delayed recruitment (iv) facultative wetland residence. Despite the small self-recruiting 'facultative wetland resident' group, wetland occupancy seems largely driven by connectivity to the subtidal estuary channel. Variable connection regimes (i.e. frequency and timing of connections) within and between different wetland units (e.g. individual pools, lagoons, swamps) will therefore interact with the diversity of species recruitment schedules to generate variable wetland assemblages in time and space. In addition, the assemblage structure is heavily modified by freshwater flow, through simultaneously curtailing persistence of the 'interrupted persistence' group, establishing connectivity for freshwater spawned members of both the 'facultative wetland resident' and 'delayed recruitment group', and apparently mediating use of intermediate nursery habitats for marine-spawned members of the 'delayed recruitment' group. The diversity of utilisation pattern and the complexity of associated drivers means assemblage compositions, and therefore ecosystem functioning, is likely to vary among years depending on variations in hydrological connectivity. Consequently, there is a need to incorporate this diversity into understandings of habitat function, conservation and management.
The Plant-Derived Glucocorticoid Receptor Agonist Endiandrin A Acts As Co-Stimulator of Colonic Epithelial Sodium Channels (ENaC) Via SGK-1 and MAPKs
PloS One. 2012 | Pubmed ID: 23152905
In a search for secondary plant compounds that bind to the glucocorticoid receptor (GR), the cyclobutane lignan endiandrin A was discovered from the rainforest tree Endiandra anthropophagorum Domin. Our present study aims to characterize the effect of endiandrin A on GR-dependent induction of colonic sodium transport. The effect of endiandrin A was analyzed in GR-expressing colonic HT-29/B6 cells (HT-29/B6-GR). GR transactivation and subcellular localization were investigated by reporter gene assay and immunofluorescence. Epithelial sodium channel (ENaC) was analyzed by qRT-PCR and by measuring amiloride-sensitive short-circuit current (I(sc)) in Ussing chambers. Endiandrin A (End A) has been identified as GR receptor binder. However, it did not cause significant GR transactivation as pGRE-luciferase activity was only 7% of that of the maximum effect of dexamethasone. Interestingly, endiandrin A had a significant impact on dexamethasone-dependent sodium absorption in cells co-exposed to tumor necrosis factor (TNF)-α. This was in part due to up-regulation of β- and γ-ENaC subunit expression. Endiandrin A potentiated GR-mediated transcription by increasing GR protein expression and phosphorylation. It inhibited c-Jun N-terminal kinase (JNK) activation induced by dexamethasone and/or TNF-α and increased levels of GR localized to the nucleus. Additionally, endiandrin A increased the serum- and glucocorticoid-induced kinase (sgk)-1 via activation of p38. Finally, the regulation of ENaC function by endiandrin A was confirmed in rat native colon. In conclusion, endiandrin A potentiates glucocorticoid-driven activation of colonic epithelial sodium channels via JNK inhibition and p38 activation due to transcriptional up-regulation of β- and γ-ENaC-subunits along with induction of sgk-1.
A TaqMan-based Real Time PCR Assay for Specific Detection and Quantification of Xylella Fastidiosa Strains Causing Bacterial Leaf Scorch in Oleander
Journal of Microbiological Methods. Nov, 2012 | Pubmed ID: 23165115
A TaqMan-based real-time PCR assay was developed for specific detection of strains of X. fastidiosa causing oleander leaf scorch. The assay uses primers WG-OLS-F1 and WG-OLS-R1 and the fluorescent probe WG-OLS-P1, designed based on unique sequences found only in the genome of oleander strain Ann1. The assay is specific, allowing detection of only oleander-infecting strains, not other strains of X. fastidiosa nor other plant-associated bacteria tested. The assay is also sensitive, with a detection limit of 10.4fg DNA of X. fastidiosa per reaction in vitro and in planta. The assay can also be applied to detect low numbers of X. fastidiosa in insect samples, or further developed into a multiplex real-time PCR assay to simultaneously detect and distinguish diverse strains of X. fastidiosa that may occupy the same hosts or insect vectors. Specific and sensitive detection and quantification of oleander strains of X. fastidiosa should be useful for disease diagnosis, epidemiological studies, management of oleander leaf scorch disease, and resistance screening for oleander shrubs.
Association of Aspirin Resistance With Increased Stroke Severity and Infarct Size
Archives of Neurology. Nov, 2012 | Pubmed ID: 23165316
OBJECTIVE To investigate the relationship between aspirin resistance and clinical and neuroimaging measures of stroke severity in acute stroke patients. DESIGN Prospective single-center survey of acute ischemic stroke patients receiving aspirin therapy. SETTING The Royal Melbourne Hospital, Parkville, Victoria, Australia. PATIENTS Ninety acute stroke patients who previously received aspirin therapy were enrolled. MAIN OUTCOME MEASURES Clinical stroke severity was measured using the National Institutes of Health Stroke Scale (NIHSS) and stroke infarct size was measured using the Alberta Stroke Program Early CT Score (ASPECTS). Aspirin resistance was measured using the VerifyNow system. RESULTS The mean (SD) age was 75 (9.9) years and 64.4% were male. The median NIHSS score and ASPECTS were 4 (interquartile range [IQR], 3-10) and 9 (IQR, 6-10), respectively. Aspirin resistance was detected in 28.9% (95% CI, 0.19 to 0.38) of all patients. The median aspirin reaction unit (ARU) was 486.0 (IQR, 432.3-557.0). Every 1-point increase in ARU was associated with a 0.03-point increase in NIHSS score (95% CI, 0.01 to 0.04; P < .001) and a 0.02-point decrease in ASPECTS (95% CI, -0.03 to -0.01; P < .001). This corresponded to an approximate median increase of 1 point in NIHSS score for every 33-point increase in ARU or a decrease of 1 point in ASPECTS for every 50-point increase in ARU. CONCLUSIONS Aspirin resistance is associated with increased clinical severity and stroke infarct volume in acute stroke patients. Our results support the need for a randomized controlled study to investigate alternative antiplatelet therapy in patients with aspirin resistance.
Rapid Healing of Scar-associated Chronic Wounds After Ablative Fractional Resurfacing
Archives of Dermatology. Nov, 2012 | Pubmed ID: 23165834
BACKGROUND Skin compromised by traumatic scars and contractures can manifest decreased resistance to shearing and other forces, while increased tension and skin fragility contribute to chronic erosions and ulcerations. Chronic wounds possess inflammatory mediator profiles and other characteristics, such as the presence of biofilms, that can inhibit healing. OBSERVATIONS Three patients with multiple traumatic scars related to blast injuries initiated a course of ablative fractional laser therapy for potential mitigation of contractures, poor pliability, and textural irregularity. Patients also had chronic focal erosions or ulcerations despite professional wound care. All patients experienced incidental rapid healing of their chronic wounds within 2 weeks of their initial ablative fractional laser treatment. Healing was sustained throughout the treatment course and beyond and was associated with gradual enhancements in scar pliability, texture, durability, and range of motion. CONCLUSIONS The unique pattern of injury associated with ablative fractional laser treatment may have various potential wound-healing advantages. These advantages include the novel concept of photomicrodebridement, including biofilm disruption and the stimulation of de novo growth factor secretion and collagen remodeling. If confirmed, ablative fractional resurfacing could be a potent new addition to traditional wound and scar treatment paradigms.
Experimental Infection of Plants with an Herbivore-associated Bacterial Endosymbiont Influences Herbivore Host Selection Behavior
PloS One. 2012 | Pubmed ID: 23166641
Although bacterial endosymbioses are common among phloeophagous herbivores, little is known regarding the effects of symbionts on herbivore host selection and population dynamics. We tested the hypothesis that plant selection and reproductive performance by a phloem-feeding herbivore (potato psyllid, Bactericera cockerelli) is mediated by infection of plants with a bacterial endosymbiont. We controlled for the effects of herbivory and endosymbiont infection by exposing potato plants (Solanum tuberosum) to psyllids infected with "Candidatus Liberibacter solanacearum" or to uninfected psyllids. We used these treatments as a basis to experimentally test plant volatile emissions, herbivore settling and oviposition preferences, and herbivore population growth. Three important findings emerged: (1) plant volatile profiles differed with respect to both herbivory and herbivory plus endosymbiont infection when compared to undamaged control plants; (2) herbivores initially settled on plants exposed to endosymbiont-infected psyllids but later defected and oviposited primarily on plants exposed only to uninfected psyllids; and (3) plant infection status had little effect on herbivore reproduction, though plant flowering was associated with a 39% reduction in herbivore density on average. Our experiments support the hypothesis that plant infection with endosymbionts alters plant volatile profiles, and infected plants initially recruited herbivores but later repelled them. Also, our findings suggest that the endosymbiont may not place negative selection pressure on its host herbivore in this system, but plant flowering phenology appears correlated with psyllid population performance.
Low Prevalence of Pneumocystis Pneumonia (PCP) but High Prevalence of Pneumocystis Dihydropteroate Synthase (dhps) Gene Mutations in HIV-Infected Persons in Uganda
PloS One. 2012 | Pubmed ID: 23166805
Pneumocystis jirovecii pneumonia (PCP) is an important opportunistic infection in patients infected with HIV, but its burden is incompletely characterized in those areas of sub-Saharan Africa where HIV is prevalent. We explored the prevalence of both PCP in HIV-infected adults admitted with pneumonia to a tertiary-care hospital in Uganda and of putative P. jirovecii drug resistance by mutations in fungal dihydropteroate synthase (dhps) and dihydrofolate reductase (dhfr). In 129 consecutive patients with sputum smears negative for mycobacteria, 5 (3.9%) were diagnosed with PCP by microscopic examination of Giemsa-stained bronchoalveolar lavage fluid. Concordance was 100% between Giemsa stain and PCR (dhps and dhfr). PCP was more prevalent in patients newly-diagnosed with HIV (11.4%) than in patients with known HIV (1.1%; p = 0.007). Mortality at 2 months after discharge was 29% overall: 28% among PCP-negative patients, and 60% (3 of 5) among PCP-positive patients. In these 5 fungal isolates and an additional 8 from consecutive cases of PCP, all strains harbored mutant dhps haplotypes; all 13 isolates harbored the P57S mutation in dhps, and 3 (23%) also harbored the T55A mutation. No non-synonymous dhfr mutations were detected. PCP is an important cause of pneumonia in patients newly-diagnosed with HIV in Uganda, is associated with high mortality, and putative molecular evidence of drug resistance is prevalent. Given the reliability of field diagnosis in our cohort, future studies in sub-Saharan Africa can investigate the clinical impact of these genotypes.
Diet Quality of Americans Differs by Age, Sex, Race/Ethnicity, Income, and Education Level
Journal of the Academy of Nutrition and Dietetics. Nov, 2012 | Pubmed ID: 23168270
An index that assesses the multidimensional components of the diet across the lifecycle is useful in describing diet quality. The purpose of this study was to use the Healthy Eating Index-2005, a measure of diet quality in terms of conformance to the 2005 Dietary Guidelines for Americans, to describe the diet quality of Americans by varying sociodemographic characteristics in order to provide insight as to where diets need to improve. The Healthy Eating Index-2005 scores were estimated using 1 day of dietary intake data provided by participants in the 2003-2004 National Health and Nutrition Examination Survey. Mean daily intakes of foods and nutrients, expressed per 1,000 kilocalories, were estimated using the population ratio method and compared with standards that reflect the 2005 Dietary Guidelines for Americans. Participants included 3,286 children (2 to 17 years), 3,690 young and middle-aged adults (18 to 64 years), and 1,296 older adults (65+ years). Results are reported as percentages of maximum scores and tested for significant differences (P≤0.05) by age, sex, race/ethnicity, income, and education levels. Children and older adults had better-quality diets than younger and middle-aged adults; women had better-quality diets than men; Hispanics had better-quality diets than blacks and whites; and diet quality of adults, but not children, generally improved with income level, except for sodium. The diets of Americans, regardless of socioeconomic status, are far from optimal. Problematic dietary patterns were found among all sociodemographic groups. Major improvements in the nutritional health of the American public can be made by improving eating patterns.
The ER Stress Transducer IRE1β is Required for Airway Epithelial Mucin Production
Mucosal Immunology. Nov, 2012 | Pubmed ID: 23168839
Inflammation of human bronchial epithelia (HBE) activates the endoplasmic reticulum (ER) stress transducer inositol-requiring enzyme 1 (IRE1)α, resulting in IRE1α-mediated cytokine production. Previous studies demonstrated ubiquitous expression of IRE1α and gut-restricted expression of IRE1β. We found that IRE1β is also expressed in HBE, is absent in human alveolar cells, and is upregulated in cystic fibrosis and asthmatic HBE. Studies with Ire1β(-/-) mice and Calu-3 airway epithelia exhibiting IRE1β knockdown or overexpression revealed that IRE1β is expressed in airway mucous cells, is functionally required for airway mucin production, and this function is specific for IRE1β vs. IRE1α. IRE1β-dependent mucin production is mediated, at least in part, by activation of the transcription factor X-box binding protein-1 (XBP-1) and the resulting XBP-1-dependent transcription of anterior gradient homolog 2, a gene implicated in airway and intestinal epithelial mucin production. These novel findings suggest that IRE1β is a potential mucous cell-specific therapeutic target for airway diseases characterized by mucin overproduction.Mucosal Immunology advance online publication 21 November 2012; doi:10.1038/mi.2012.105.
Patch Testing with Textile Allergens: the Mayo Clinic Experience
Dermatitis : Contact, Atopic, Occupational, Drug : Official Journal of the American Contact Dermatitis Society, North American Contact Dermatitis Group. Nov, 2012 | Pubmed ID: 23169208
Recognition of allergic contact dermatitis attributed to textile dyes and resins is steadily increasing.
Very Low PSA Concentrations and Deletions of the KLK3 Gene
Clinical Chemistry. Nov, 2012 | Pubmed ID: 23169475
BACKGROUND:Prostate-specific antigen (PSA), a widely used biomarker for prostate cancer (PCa), is encoded by a kallikrein gene (KLK3, kallikrein-related peptidase 3). Serum PSA concentrations vary in the population, with PCa patients generally showing higher PSA concentrations than control individuals, although a small proportion of individuals in the population display very low PSA concentrations. We hypothesized that very low PSA concentrations might reflect gene-inactivating mutations in KLK3 that lead to abnormally reduced gene expression.METHODS:We have sequenced all KLK3 exons and the promoter and searched for gross deletions or duplications in KLK3 in the 30 individuals with the lowest observed PSA concentrations in a sample of approximately 85 000 men from the Prostate Testing for Cancer and Treatment (ProtecT) study. The ProtecT study examines a community-based population of men from across the UK with little prior PSA testing.RESULTS:We observed no stop codons or frameshift mutations, but we did find 30 single-base genetic variants, including 3 variants not described previously. These variants included missense variants that could be functionally inactivating and splicing variants. At this stage, however, we cannot confidently conclude whether these variants markedly lower PSA concentration or activity. More importantly, we identified 3 individuals with different large heterozygous deletions that encompass all KLK3 exons. The absence of a functional copy of KLK3 in these individuals is consistent with their reduced serum PSA concentrations.CONCLUSIONS:The clinical interpretation of the PSA test for individuals with KLK3 gene inactivation could lead to false-negative PSA findings used for screening, diagnosis, or monitoring of PCa.
Delayed 2009 Pandemic Influenza A Virus Subtype H1N1 Circulation in West Africa, May 2009-April 2010
The Journal of Infectious Diseases. Dec, 2012 | Pubmed ID: 23169954
To understand 2009 pandemic influenza A virus subtype H1N1 (A[H1N1]pdm09) circulation in West Africa, we collected influenza surveillance data from ministries of health and influenza laboratories in 10 countries, including Cameroon, from 4 May 2009 through 3 April 2010. A total of 10 203 respiratory specimens were tested, of which 25% were positive for influenza virus. Until the end of December 2009, only 14% of all detected strains were A(H1N1)pdm09, but the frequency increased to 89% from January through 3 April 2010. Five West African countries did not report their first A(H1N1)pdm09 case until 6 months after the emergence of the pandemic in North America, in April 2009. The time from first detection of A(H1N1)pdm09 in a country to the time of A(H1N1)pdm09 predominance varied from 0 to 37 weeks. Seven countries did not report A(H1N1)pdm09 predominance until 2010. Introduction and transmission of A(H1N1)pdm09 were delayed in this region.
Influenza Surveillance in 15 Countries in Africa, 2006-2010
The Journal of Infectious Diseases. Dec, 2012 | Pubmed ID: 23169960
Background. In response to the potential threat of an influenza pandemic, several international institutions and governments, in partnership with African countries, invested in the development of epidemiologic and laboratory influenza surveillance capacity in Africa and the African Network of Influenza Surveillance and Epidemiology (ANISE) was formed. Methods. We used a standardized form to collect information on influenza surveillance system characteristics, the number and percent of influenza-positive patients with influenza-like illness (ILI), or severe acute respiratory infection (SARI) and virologic data from countries participating in ANISE. Results. Between 2006 and 2010, the number of ILI and SARI sites in 15 African countries increased from 21 to 127 and from 2 to 98, respectively. Children 0-4 years accounted for 48% of all ILI and SARI cases of which 22% and 10%, respectively, were positive for influenza. Influenza peaks were generally discernible in North and South Africa. Substantial cocirculation of influenza A and B occurred most years. Conclusions. Influenza is a major cause of respiratory illness in Africa, especially in children. Further strengthening influenza surveillance, along with conducting special studies on influenza burden, cost of illness, and role of other respiratory pathogens will help detect novel influenza viruses and inform and develop targeted influenza prevention policy decisions in the region.
Cardiac Dysfunction and Preeclampsia: Can Imaging Give Clues to Mechanism?
Circulation. Cardiovascular Imaging. Nov, 2012 | Pubmed ID: 23169981
The United States Chiropractic Workforce: An Alternative or Complement to Primary Care?
Chiropractic & Manual Therapies. Nov, 2012 | Pubmed ID: 23171540
ABSTRACT: BACKGROUND: In the United States (US) a shortage of primary care physicians has become evident. Other health care providers such as chiropractors might help address some of the nation's primary care needs simply by being located in areas of lesser primary care resources. Therefore, the purpose of this study was to examine the distribution of the chiropractic workforce across the country and compare it to that of primary care physicians. METHODS: We used nationally representative data to estimate the per 100,000 capita supply of chiropractors and primary care physicians according to the 306 predefined Hospital Referral Regions. Multiple variable Poisson regression was used to examine the influence of population characteristics on the supply of both practitioner-types. RESULTS: According to these data, there are 74,623 US chiropractors and the per capita supply of chiropractors varies more than 10-fold across the nation. Chiropractors practice in areas with greater supply of primary care physicians (Pearson's correlation 0.17, p-value < 0.001) and appear to be more responsive to market conditions (i.e. more heavily influenced by population characteristics) in regards to practice location than primary care physicians. CONCLUSION: These findings suggest that chiropractors practice in areas of greater primary care physician supply. Therefore chiropractors may be functioning in more complementary roles to primary care as opposed to an alternative point of access.
Chronic Interstitial Fibrosis in the Rat Kidney Induced by Long Term (6 Months) Exposure to Lithium
American Journal of Physiology. Renal Physiology. Nov, 2012 | Pubmed ID: 23171555
There is a lack of suitable animal models, which replicate the slowly progressive chronic interstitial fibrosis that is characteristic of many human chronic nephropathies. We describe a chronic long-term (6 month) model of lithium-induced renal fibrosis, with minimal active inflammation, which mimics chronic kidney interstitial fibrosis seen in the human kidney. Rats received lithium via their chow (60 mmol lithium/kg food) daily for 6 months. No animals died during the exposure. Nephrogenic diabetes insipidus was established by 3 weeks and persisted for the 6 months. Following metabolic studies, the animals were sacrificed at 1, 3 and 6 months and the kidneys were processed for histological and immunohistochemical studies. Progressive interstitial fibrosis, characterised by increasing numbers of myofibroblasts, enhanced TGFβ1 expression, interstitial collagen deposition and a minimal inflammatory cellular response, was evident. Elucidation of the underlying mechanisms of injury in this model will provide a greater understanding of chronic interstitial fibrosis and allow the development of intervention strategies to prevent injury.
Farm Animal Contact As Risk Factor for Transmission of Bovine-associated Salmonella Subtypes
Emerging Infectious Diseases. Dec, 2012 | Pubmed ID: 23171627
Salmonellosis is usually associated with foodborne transmission. To identify risk from animal contact, we compared animal exposures of case-patients infected with bovine-associated Salmonella subtypes with those of control-patients infected with non-bovine-associated subtypes. We used data collected in New York and Washington, USA, from March 1, 2008, through March 1, 2010. Contact with farm animals during the 5 days before illness onset was significantly associated with being a case-patient (odds ratio 3.2, p = 0.0008), after consumption of undercooked ground beef and unpasteurized milk were controlled for. Contact with cattle specifically was also significantly associated with being a case-patient (odds ratio 7.4, p = 0.0002), after food exposures were controlled for. More cases of bovine-associated salmonellosis in humans might result from direct contact with cattle, as opposed to ingestion of foods of bovine origin, than previously recognized. Efforts to control salmonellosis should include a focus on transmission routes other than foodborne.
Cohort Profile: The Skin Cancer After Organ Transplant Study
International Journal of Epidemiology. Nov, 2012 | Pubmed ID: 23171871
The Skin Cancer after Organ Transplant (SCOT) study was designed to investigate the link between genus beta human papillomavirus (HPV) and squamous cell skin cancer (SCSC). We focused on a population receiving immunosuppressive therapy for extended periods, transplant patients, as they are at extremely high risk for developing SCSC. Two complementary projects were conducted in the Seattle area: (i) a retrospective cohort with interview data from 2004 recipients of renal or cardiac transplants between 1995 and 2010 and (ii) a prospective cohort with interview data from 328 people on the transplant waiting lists between 2009 and 2011. Within the retrospective cohort, we developed a nested case-control study (172 cases and 337 control subjects) to assess risk of SCSC associated with markers of HPV in SCSC tumour tissue and eyebrow hair bulb DNA (HPV genotypes) and blood (HPV antibodies). In the prospective cohort, 135 participants had a 1-year post-transplant visit and 71 completed a 2-year post-transplant visit. In both arms of the cohort, we collected samples to assess markers of HPV infection such as acquisition of new types, proportion positive for each type, persistence of types at consecutive visits and number of HPV types detected. In the prospective cohort, we will also examine these HPV markers in relation to levels of cell-mediated immunity. The goal of the SCOT study is to use the data we collected to gain a more complete understanding of the role of immune suppression in HPV kinetics and of genus beta HPV types in SCSC. For more information, please contact the principal investigator through the study website: http://www.fhcrc.org/science/phs/cerc/The_SCOT_Study.html.
Water Structural Transformation at Molecular Hydrophobic Interfaces
Nature. Nov, 2012 | Pubmed ID: 23172216
Hydrophobic hydration is considered to have a key role in biological processes ranging from membrane formation to protein folding and ligand binding. Historically, hydrophobic hydration shells were thought to resemble solid clathrate hydrates, with solutes surrounded by polyhedral cages composed of tetrahedrally hydrogen-bonded water molecules. But more recent experimental and theoretical studies have challenged this view and emphasized the importance of the length scales involved. Here we report combined polarized, isotopic and temperature-dependent Raman scattering measurements with multivariate curve resolution (Raman-MCR) that explore hydrophobic hydration by mapping the vibrational spectroscopic features arising from the hydrophobic hydration shells of linear alcohols ranging from methanol to heptanol. Our data, covering the entire 0-100 °C temperature range, show clear evidence that at low temperatures the hydration shells have a hydrophobically enhanced water structure with greater tetrahedral order and fewer weak hydrogen bonds than the surrounding bulk water. This structure disappears with increasing temperature and is then, for hydrophobic chains longer than ~1 nm, replaced by a more disordered structure with weaker hydrogen bonds than bulk water. These observations support our current understanding of hydrophobic hydration, including the thermally induced water structural transformation that is suggestive of the hydrophobic crossover predicted to occur at lengths of ~1 nm (refs 5, 9, 10, 14).
Optimizing Transition of Care Through the Facilitation of a Pharmacist-Managed Deep Vein Thrombosis Treatment Program
Journal of Pharmacy Practice. Nov, 2012 | Pubmed ID: 23172896
A pharmacist-managed deep vein thrombosis (DVT) treatment program was put into operation at Jackson Memorial Hospital in Miami, Florida to provide appropriate transition of care to the outpatient setting for patients diagnosed with DVT. A postgraduate year 1 pharmacy practice resident partnered with a clinical pharmacist to establish and implement the DVT pilot program in the emergency department (ED). Once contacted, the pharmacy resident or the clinical pharmacist communicated with the ED physician and made recommendations regarding appropriate anticoagulation. The pharmacist met with the patient to obtain informed consent and provide counseling regarding the anticoagulants. A timely outpatient appointment at the pharmacy-managed warfarin clinic was arranged for the patient and contact information was exchanged between the patient and the pharmacist. On average, patients enrolled in the DVT program from the ED were released 18.29 hours (±7.06) following the time of arrival. Following release from the hospital, 91% of patients attended their outpatient follow-up appointment at the warfarin clinic. Since the initiation of the DVT program, 1 patient experienced a recurrent DVT and major bleed during their treatment course. Due to successful implementation of this pharmacist-managed DVT program in the ED, the services were subsequently extended to inpatients with DVT.
Emergence of Embryonic Pattern Through Contact Inhibition of Locomotion
Development (Cambridge, England). Dec, 2012 | Pubmed ID: 23172914
The pioneering cell biologist Michael Abercrombie first described the process of contact inhibition of locomotion more than 50 years ago when migrating fibroblasts were observed to rapidly change direction and migrate away upon collision. Since then, we have gleaned little understanding of how contact inhibition is regulated and only lately observed its occurrence in vivo. We recently revealed that Drosophila macrophages (haemocytes) require contact inhibition for their uniform embryonic dispersal. Here, to investigate the role that contact inhibition plays in the patterning of haemocyte movements, we have mathematically analysed and simulated their contact repulsion dynamics. Our data reveal that the final pattern of haemocyte distribution, and the details and timing of its formation, can be explained by contact inhibition dynamics within the geometry of the Drosophila embryo. This has implications for morphogenesis in general as it suggests that patterns can emerge, irrespective of external cues, when cells interact through simple rules of contact repulsion.
Epidemiological and Economic Trends in Inpatient and Outpatient Thyroidectomy in the United States, 1996-2006
Thyroid : Official Journal of the American Thyroid Association. Nov, 2012 | Pubmed ID: 23173840
Background: Traditionally, thyroid surgery has been an inpatient procedure due to the risk of several well-documented complications. Recent research suggests that for selected patients, outpatient thyroid surgery is safe and feasible, with the additional potential benefit of cost savings. In recognition of these observations, we hypothesized that there would be an increase in U.S. outpatient thyroidectomies with a concurrent decline in inpatient thyroidectomies over time. Methods: Comparative cross-sectional analyses of the National Survey of Ambulatory Surgery (NSAS) and Nationwide Inpatient Sample (NIS) databases from 1996 and 2006 were performed. All cases of thyroid surgery were extracted, as well as data on age, gender, and insurance status. Diagnoses and surgical cases were identified using International Classification of Diseases, Ninth Revision (ICD-9) diagnostic and treatment codes. Hospital charges were acquired from the NIS 1996 and 2006 and NSAS 2006 releases, plus imputed data where necessary. After survey weights were applied, patient characteristics, diagnoses, and procedures were compared for inpatient versus outpatient procedures. Results: The total number of thyroidectomies increased 39% from 66,864 to 92,931 cases per year during the study timeframe. Outpatient procedures increased by 61%, while inpatient procedures increased by 30%. The proportion of privately-insured inpatients declined slightly from 63.8% to 60.1%, while those covered by Medicare increased from 22.8% to 25.8%. In contrast, the proportion of privately-insured outpatients declined sharply from 76.8% to 39.9%, while those covered by Medicare rose from 17.2% to 45.7%. These trends coincided with a small increase in mean inpatient age from 50.2 to 52.3 years and larger increase in mean outpatient age from 50.7 to 58.1 years. Inflation-adjusted per capita charges for inpatient thyroidectomies more than doubled from $9,934 in 1996 to $22,537 in 2006, while aggregate national inpatient charges tripled from $464 million to $1.37 billion. By comparison, in 2006 per capita charges for outpatient thyroidectomy totaled $7,222. Conclusions: From 1996 to 2006, there has been a concurrent modest increase in inpatient and pronounced increase in outpatient thyroidectomies in the U.S., with a consequential demographic shift and economic impact.
Design of a Model to Predict Surge Capacity Bottlenecks for Burn Mass Casualties at a Large Academic Medical Center
Prehospital and Disaster Medicine. Oct, 2012 | Pubmed ID: 23174042
OBJECTIVES: To design and test a model to predict surge capacity bottlenecks at a large academic medical center in response to a mass-casualty incident (MCI) involving multiple burn victims. METHODS: Using the simulation software ProModel, a model of patient flow and anticipated resource use, according to principles of disaster management, was developed based upon historical data from the University Hospital of the University of Michigan Health System. Model inputs included: (a) age and weight distribution for casualties, and distribution of size and depth of burns; (b) rate of arrival of casualties to the hospital, and triage to ward or critical care settings; (c) eligibility for early discharge of non-MCI inpatients at time of MCI; (d) baseline occupancy of intensive care unit (ICU), surgical step-down, and ward; (e) staff availability-number of physicians, nurses, and respiratory therapists, and the expected ratio of each group to patients; (f) floor and operating room resources-anticipating the need for mechanical ventilators, burn care and surgical resources, blood products, and intravenous fluids; (g) average hospital length of stay and mortality rate for patients with inhalation injury and different size burns; and (h) average number of times that different size burns undergo surgery. Key model outputs include time to bottleneck for each limiting resource and average waiting time to hospital bed availability. RESULTS: Given base-case model assumptions (including 100 mass casualties with an inter-arrival rate to the hospital of one patient every three minutes), hospital utilization is constrained within the first 120 minutes to 21 casualties, due to the limited number of beds. The first bottleneck is attributable to exhausting critical care beds, followed by floor beds. Given this limitation in number of patients, the temporal order of the ensuing bottlenecks is as follows: Lactated Ringer's solution (4 h), silver sulfadiazine/Silvadene (6 h), albumin (48 h), thrombin topical (72 h), type AB packed red blood cells (76 h), silver dressing/Acticoat (100 h), bismuth tribromophenate/Xeroform (102 h), and gauze bandage rolls/Kerlix (168 h). The following items do not precipitate a bottleneck: ventilators, topical epinephrine, staplers, foams, antimicrobial non-adherent dressing/Telfa types A, B, or O blood. Nurse, respiratory therapist, and physician staffing does not induce bottlenecks. CONCLUSIONS: This model, and similar models for non-burn-related MCIs, can serve as a real-time estimation and management tool for hospital capacity in the setting of MCIs, and can inform supply decision support for disaster management. Abir M , Davis MM , Sankar P , Wong AC , Wang SC . Design of a model to predict surge capacity bottlenecks for burn mass casualties at a large academic medical center. Prehosp Disaster Med. 2013;28(1):1-10.
Silent Spring After 50 Years
Endeavour. Nov, 2012 | Pubmed ID: 23174334
As Silent Spring passed the half-century mark, historians have continued to reflect on its significance. For this issue of Endeavour, we drew together six articles that explore a few of the many legacies of this remarkable book. Given the impressive scope and breadth of the papers in this issue, it is clear that Silent Spring, and the shock waves surrounding its publication, continue to provide rich fodder for historical analysis.
The Role of Daily Activities in Youths' Stress Physiology
The Journal of Adolescent Health : Official Publication of the Society for Adolescent Medicine. Dec, 2012 | Pubmed ID: 23174474
This study examined links between diurnal patterns of the stress hormone cortisol and time spent by adolescents in nine common daily activities.
A Qualitative Exploration of Patients' Attitudes Towards the 'Participate Inform Notice Know' (PINK) Patient Safety Video
International Journal for Quality in Health Care : Journal of the International Society for Quality in Health Care / ISQua. Nov, 2012 | Pubmed ID: 23175533
OBJECTIVE: /st>To explore patients' attitudes towards the PINK video, a patient education video aimed at encouraging hospital patients' involvement in safety-relevant behaviours. DESIGN: /st>Qualitative semi-structured interviews. Detailed field notes were taken during the interviews which were analysed using content analysis. SETTING: /st>One National Health System (NHS) teaching hospital based in London, UK. PARTICIPANTS: /st>Thirty-six in-patients aged between 20 and 79 years, 18 of them males. INTERVENTION: /st>The PINK video is a short animated educational video aimed at encouraging patients to be involved in the safety of their care during hospitalization. MAIN OUTCOME MEASURES: /st>Patients' perceptions of how informative, relevant and acceptable the video is; attitudes towards participating in the recommended safety-related behaviours and; potential negative side effects of watching the video. RESULTS: /st>Overall the video was received favourably among the interviewees. Commonly cited benefits included raising awareness and facilitating patients to be involved in their care during their hospital stay. More variability was found in participants' views with regard to the video's role as a patient safety enhancement tool. A number of suggestions for improvement of the video were provided relating to tailoring its content and design to meet the needs of individual patients and their circumstances. CONCLUSIONS: /st>Educational videos such as PINK have significant potential to empower patients in the safety and quality of their care. However, efforts to implement patient safety educational videos in practice need to consider different patient groups' needs and characteristics instead of trying to adopt 'a one size fits all' approach.
5'-Terminal Chemical Capping of Spliced Leader RNAs
Tetrahedron Letters. Sep, 2012 | Pubmed ID: 23175583
Spliced leader (SL) RNA trans-splicing adds a 2,2,7-trimethylguanosine cap (TMG) and a 22-nucleotide sequence, the SL, to the 5' end of mRNAs. Both non-trans-spliced with a monomethylguanosine cap (MMG) and trans-spliced mRNAs co-exist in trans-splicing metazoan cells. Efficient translation of TMG-capped mRNAs in nematodes requires a defined core of nucleotides within the SL sequence. Here we present a chemical procedure for the preparation and purification of 5'-terminal capped MMG and TMG wild-type, and mutant 22 nt spliced leader RNAs (GGU/ACUUAAUUACCCAAGUUUGAG) with or without a 3' biotin tag.
RIM Controls Homeostatic Plasticity Through Modulation of the Readily-Releasable Vesicle Pool
The Journal of Neuroscience : the Official Journal of the Society for Neuroscience. Nov, 2012 | Pubmed ID: 23175813
Rab3 interacting molecules (RIMs) are evolutionarily conserved scaffolding proteins that are located at presynaptic active zones. In the mammalian nervous system, RIMs have two major activities that contribute to the fidelity of baseline synaptic transmission: they concentrate calcium channels at the active zone and facilitate synaptic vesicle docking/priming. Here we confirm that RIM has an evolutionarily conserved function at the Drosophila neuromuscular junction and then define a novel role for RIM during homeostatic synaptic plasticity. We show that loss of RIM disrupts baseline vesicle release, diminishes presynaptic calcium influx, and diminishes the size of the readily-releasable pool (RRP) of synaptic vesicles, consistent with known activities of RIM. However, loss of RIM also completely blocks the homeostatic enhancement of presynaptic neurotransmitter release that normally occurs after inhibition of postsynaptic glutamate receptors, a process termed synaptic homeostasis. It is established that synaptic homeostasis requires enhanced presynaptic calcium influx as a mechanism to potentiate vesicle release. However, despite a defect in baseline calcium influx in rim mutants, the homeostatic modulation of calcium influx proceeds normally. Synaptic homeostasis is also correlated with an increase in the size of the RRP of synaptic vesicles, although the mechanism remains unknown. Here we demonstrate that the homeostatic modulation of the RRP is blocked in the rim mutant background. Therefore, RIM-dependent modulation of the RRP is a required step during homeostatic plasticity. By extension, homeostatic plasticity appears to require two genetically separable processes, the enhancement of presynaptic calcium influx and a RIM-dependent modulation of the RRP.
QuickTox Kit for QuickScan Aflatoxin
Journal of AOAC International. Sep-Oct, 2012 | Pubmed ID: 23175981
The QuickTox Kit for QuickScan Aflatoxin uses lateral flow technology and a reader-based system for quantitative determination of total aflatoxins. The performance of this assay was examined using corn samples naturally contaminated with aflatoxins in internal and independent laboratory evaluations and was judged against previously established acceptance criteria. Performance was evaluated for linearity, selectivity, matrix, robustness, and stability experiments. All data points in these studies fell within the ranges defined in the acceptance criteria. The assay exhibits linear dose response over the range tested, 0-100 ppb, with R2 values exceeding 0.98. RSDr values for results ranged from 4.7 to 17.7% across all tested levels. The four major aflatoxin types in corn are detected in the assay, with highest sensitivity for the most prevalent type, B1. Assay results are unaffected by the presence of other common mycotoxins. Robustness studies co-varied assay timing (-20%, 60% compared to the standard assay), temperature (18-30 degrees C), and sample volume (+/- 20% compared to the standard assay). Judged against the acceptance criteria, results were unaffected by these changes. The QuickTox Kit for QuickScan Aflatoxin assay is a user-friendly and reliable method for determination of total aflatoxins.
The Molecular Biogeochemistry of Manganese(II) Oxidation
Biochemical Society Transactions. Dec, 2012 | Pubmed ID: 23176462
Micro-organisms capable of oxidizing the redox-active transition metal manganese play an important role in the biogeochemical cycle of manganese. In the present mini-review, we focus specifically on Mn(II)-oxidizing bacteria. The mechanisms by which bacteria oxidize Mn(II) include a two-electron oxidation reaction catalysed by a novel multicopper oxidase that produces Mn(IV) oxides as the primary product. Bacteria also produce organic ligands, such as siderophores, that bind to and stabilize Mn(III). The realization that this stabilized Mn(III) is present in many environments and can affect the redox cycles of other elements such as sulfur has made it clear that manganese and the bacteria that oxidize it profoundly affect the Earth's biogeochemistry.
Smart Surface for Elution of Protein-Protein Bound Particles: Nanonewton Dielectrophoretic Forces Using Atomic Layer Deposited Oxides
Analytical Chemistry. Nov, 2012 | Pubmed ID: 23176521
By increasing the strength of the negative dielectrophoresis force, we demonstrated a significantly improved electrokinetic actuation and switching microsystem that can be used to elute specifically-bound beads from the surface. In this work using Atomic Layer Deposition we deposited a pinhole free nanometer-scale thin film oxide as a protective layer to prevent electrodes from corrosion, when applying high voltages (> 20 Vpp) at the electrodes. Then, by exciting the electrodes at high frequency, we capacitively coupled the electrodes to the buffer in order to avoid electric field degradation, and hence, reduction in dielectrophoresis force due to the presence of the insulating oxide layer. To illustrate the functionality of our system, we demonstrated 100% detachment of anti-IgG and IgG bound beads (which is on the same order of magnitude in strength as typical antibody-antigen interactions) from the surface, upon applying the improved negative dielectrophoresis force. The significantly enhanced switching performance presented in this work shows orders of magnitude of improvement in on-to-off ratio and switching response time, without any need for chemical eluting agents, as compared to the previous work. The promising results from this work vindicates that the functionality of this singleplexed platform can be extended to perform a multiplexed bead-based assay where in a single channel an array of proteins are patterned each targeting a different antigen or protein.
Ascorbic Acid Alleviates Toxicity of Paclitaxel Without Interfering with the Anticancer Efficacy in Mice
Nutrition Research (New York, N.Y.). Nov, 2012 | Pubmed ID: 23176798
Paclitaxel is used extensively as a chemotherapeutic agent against a broad range of tumors but often leads to the early termination of treatment due to severe toxic side effects. In this study, we hypothesized that ascorbic acid could reduce the toxic side effects without interfering with the anticancer effect of paclitaxel. To demonstrate this, we examined the effect of the combinational treatment of ascorbic acid and paclitaxel using H1299 (a non-small cell lung cancer cell line) and BALB/c mice implanted with or without sarcoma 180 cancer cells. In H1299 cells, the anticancer effects of the combinational treatment with paclitaxel and ascorbic acid were up to 1.7-foldhigher than those of single-agent paclitaxel treatment. In addition, it was shown that the viability of the HEL299 normal cells was up to 1.6-fold higher with the combinational treatment than with paclitaxel treatment alone. In vivo mouse experiments also showed that mice co-treated with paclitaxel and ascorbic acid did not exhibit the typical side effects induced by paclitaxel, such as a reduction in the numbers of white blood cells and red blood cells and the level of hemoglobin (P < .05). The analysis of cancer-related gene expression by quantitative real-time polymerase chain reaction and immunohistochemistry revealed that the combinational treatment suppressed cancer cell multiplication. Taken together, these results suggest that combinational chemotherapy with ascorbic acid and paclitaxel not only does not block the anticancer effects of paclitaxel but also alleviates the cytotoxicity of paclitaxel in vivo and in vitro.
Salbutamol Tolerance to Bronchoprotection: Course of Onset
Annals of Allergy, Asthma & Immunology : Official Publication of the American College of Allergy, Asthma, & Immunology. Dec, 2012 | Pubmed ID: 23176887
Regular use of inhaled β-agonist leads to tolerance to its bronchoprotective effect. This occurs within 12 hours with salmeterol and has been documented at 1 week for salbutamol. The course of onset after introduction of salbutamol has not been investigated.
Correction of a Postpneumonectomy Intracardiac Shunt Using a Tissue Expander
The Annals of Thoracic Surgery. Dec, 2012 | Pubmed ID: 23176953
Right-to-left interatrial shunt (RLIAS) resulting in platypnea orthodeoxia after a right pneumonectomy is an infrequent postoperative complication. Percutaneous device closure or surgical closures using cardiopulmonary bypass have been the standard interventions for RLIAS correction. We describe a technique using a tissue expander to correct a RLIAS.
Initiation of Nanopits at MnS Nano-inclusions on Carbon Steel Exposed to Anaerobic Sulfate-reducing Bacterium Desulfoglaeba Alkanexedens
Microscopy and Microanalysis : the Official Journal of Microscopy Society of America, Microbeam Analysis Society, Microscopical Society of Canada. Jul, 2012 | Pubmed ID: 23177420
Extended abstract of a paper presented at Microscopy and Microanalysis 2012 in Phoenix, Arizona, USA, July 29 - August 2, 2012.
NAADP Activates Two-Pore Channels on T Cell Cytolytic Granules to Stimulate Exocytosis and Killing
Current Biology : CB. Nov, 2012 | Pubmed ID: 23177477
A cytotoxic T lymphocyte (CTL) kills an infected or tumorigenic cell by Ca(2+)-dependent exocytosis of cytolytic granules at the immunological synapse formed between the two cells. Although inositol 1,4,5-trisphosphate (IP(3))-mediated Ca(2+) release from the endoplasmic reticulum activates the store-operated Ca(2+)-influx pathway that is necessary for exocytosis, it is not a sufficient stimulus [1-4]. Here we identify the Ca(2+)-mobilizing messenger nicotinic acid adenine dinucleotide phosphate (NAADP) and its recently identified molecular target, two-pore channels (TPCs) [5-7], as being important for T cell receptor signaling in CTLs. We demonstrate that cytolytic granules are not only reservoirs of cytolytic proteins but are also the acidic Ca(2+) stores mobilized by NAADP via TPC channels on the granules themselves, so that TPCs migrate to the immunological synapse upon CTL activation. Moreover, NAADP activates TPCs to drive exocytosis in a way that is not mimicked by global Ca(2+) signals induced by IP(3) or ionomycin, suggesting that critical, local Ca(2+) nanodomains around TPCs stimulate granule exocytosis. Hence, by virtue of the NAADP/TPC pathway, cytolytic granules generate Ca(2+) signals that lead to their own exocytosis and to cell killing. This study highlights a selective role for NAADP in stimulating exocytosis crucial for immune cell function and may impact on stimulus-secretion coupling in wider cellular contexts.
Addressing the Nursing Shortage: the Need for Nurse Residency Programs
AORN Journal. Dec, 2012 | Pubmed ID: 23178013
'Like a Keen North Wind': How Charles Elton Influenced Silent Spring
Endeavour. Nov, 2012 | Pubmed ID: 23178091
Drawing upon archival and published sources, 'Like a Keen North Wind,' suggests that Charles Elton's book-The Ecology of Invasions by Animals and Plants-served to galvanize Rachel Carson's ideas while she was writing Silent Spring. Carson had already amassed numerous cases of the poisoning of the environment and wildlife as well as humans. Elton's book helped Carson to draw connections between the various kinds of exposures. Yet, it was Carson's genius to animate Silent Spring with vivid examples that captivated her readers and convinced them to question indiscriminate use of pesticides. Moreover, Carson adroitly bridged the growing divide between scientists and the public.
Drosophila Patterning is Established by Differential Association of MRNAs with P Bodies
Nature Cell Biology. Dec, 2012 | Pubmed ID: 23178881
The primary embryonic axes in flies, frogs and fish are formed through translational regulation of localized transcripts before fertilization. In Drosophila melanogaster, the axes are established through the transport and translational regulation of gurken (grk) and bicoid (bcd) messenger RNA in the oocyte and embryo. Both transcripts are translationally silent while being localized within the oocyte along microtubules by cytoplasmic dynein. Once localized, grk is translated at the dorsoanterior of the oocyte to send a TGF- α signal to the overlying somatic cells. In contrast, bcd is translationally repressed in the oocyte until its activation in early embryos when it forms an anteroposterior morphogenetic gradient. How this differential translational regulation is achieved is not fully understood. Here, we address this question using ultrastructural analysis, super-resolution microscopy and live-cell imaging. We show that grk and bcd ribonucleoprotein (RNP) complexes associate with electron-dense bodies that lack ribosomes and contain translational repressors. These properties are characteristic of processing bodies (P bodies), which are considered to be regions of cytoplasm where decisions are made on the translation and degradation of mRNA. Endogenous grk mRNA forms dynamic RNP particles that become docked and translated at the periphery of P bodies, where we show that the translational activator Oo18 RNA-binding protein (Orb, a homologue of CEPB) and the anchoring factor Squid (Sqd) are also enriched. In contrast, an excess of grk mRNA becomes localized inside the P bodies, where endogenous bcd mRNA is localized and translationally repressed. Interestingly, bcd mRNA dissociates from P bodies in embryos following egg activation, when it is known to become translationally active. We propose a general principle of translational regulation during axis specification involving remodelling of transport RNPs and dynamic partitioning of different transcripts between the translationally active edge of P bodies and their silent core.
Evolution of the Evidence on the Effectiveness and Cost-effectiveness of Acetylcholinesterase Inhibitors and Memantine for Alzheimer's Disease: Systematic Review and Economic Model
Age and Ageing. Nov, 2012 | Pubmed ID: 23179169
Introduction: in 2007 the National Institute of Health and Clinical Excellence (NICE) restricted the use of acetylcholinesterase inhibitors and memantine. METHODS: we conducted a health technology assessment (HTA) of the effectiveness and cost-effectiveness of donepezil, galantamine, rivastigmine and memantine for the treatment of AD to re-consider and up-date the evidence base used to inform the 2007 NICE decision. The systematic review of effectiveness targeted randomised controlled trials. A comprehensive search, including MEDLINE, Embase and the Cochrane Library, was conducted from January 2004 to March 2010. All key review steps were done by two reviewers. Random effects meta-analysis was conducted. The cost-effectiveness was assessed using a cohort-based model with three health states: pre-institutionalised, institutionalised and dead. The perspective was NHS and Personal Social Services and the cost year 2009. RESULTS: confidence about the size and statistical significance of the estimates of effect of galantamine, rivastigmine and memantine improved on function and global impact in particular. Cost-effectiveness also changed. For donepezil, galantamine and rivastigmine, the incremental cost per quality-adjusted life year (QALY) in 2004 was above £50,000; in 2010 the same drugs 'dominated' best supportive care (improved clinical outcome at reduced cost). This was primarily because of changes in the modelled costs of introducing the drugs. For memantine, the cost-effectiveness also improved from a range of £37-53,000 per QALY gained to a base-case of £32,000. CONCLUSION: there has been a change in the evidence base between 2004 and 2010 consistent with the change in NICE guidance. Further evolution in cost-effectiveness estimates is possible particularly if there are changes in drug prices.
Simvastatin Inhibits Smoke-induced Airway Epithelial Injury: Implications for COPD Therapy
The European Respiratory Journal : Official Journal of the European Society for Clinical Respiratory Physiology. Nov, 2012 | Pubmed ID: 23180589
COPD is the third leading cause of death. The statin drugs may have therapeutic potential in respiratory diseases such as COPD, but whether they prevent bronchial epithelial injury is unknown. We hypothesized that simvastatin attenuates acute tobacco smoke-induced neutrophilic lung inflammation and airway epithelial injury. Spontaneously hypertensive rats were given simvastatin (20 mg·kg(-1) i.p.) daily for either seven days prior to tobacco smoke exposure and during 3 days of smoke exposure, or only during tobacco smoke exposure.Pre-treatment with simvastatin prior to and continued throughout smoke exposure reduced the influx of total leukocytes, neutrophils, and macrophages into the lung and airways. Simvastatin attenuated tobacco smoke-induced cellular infiltration into lung parenchymal and airway subepithelial and interstitial spaces. One week of simvastatin pre-treatment almost completely prevented smoke-induced denudation of the airway epithelial layer, while simvastatin given only concurrently with the smoke exposure had no effect.Simvastatin may be a novel adjunctive therapy for smoke-induced lung diseases such as COPD. Given the need for statin pre-treatment there may be a critical process of conditioning that is necessary for statins' anti-inflammatory effects. Future work is needed to elucidate the mechanisms of this statin protective effect.
Collaborative Biocuration--text-mining Development Task for Document Prioritization for Curation
Database : the Journal of Biological Databases and Curation. 2012 | Pubmed ID: 23180769
The Critical Assessment of Information Extraction systems in Biology (BioCreAtIvE) challenge evaluation is a community-wide effort for evaluating text mining and information extraction systems for the biological domain. The 'BioCreative Workshop 2012' subcommittee identified three areas, or tracks, that comprised independent, but complementary aspects of data curation in which they sought community input: literature triage (Track I); curation workflow (Track II) and text mining/natural language processing (NLP) systems (Track III). Track I participants were invited to develop tools or systems that would effectively triage and prioritize articles for curation and present results in a prototype web interface. Training and test datasets were derived from the Comparative Toxicogenomics Database (CTD; http://ctdbase.org) and consisted of manuscripts from which chemical-gene-disease data were manually curated. A total of seven groups participated in Track I. For the triage component, the effectiveness of participant systems was measured by aggregate gene, disease and chemical 'named-entity recognition' (NER) across articles; the effectiveness of 'information retrieval' (IR) was also measured based on 'mean average precision' (MAP). Top recall scores for gene, disease and chemical NER were 49, 65 and 82%, respectively; the top MAP score was 80%. Each participating group also developed a prototype web interface; these interfaces were evaluated based on functionality and ease-of-use by CTD's biocuration project manager. In this article, we present a detailed description of the challenge and a summary of the results.
Preparation of H,(4) PyrrolidineQuin-BAM (PBAM)
Organic Syntheses; an Annual Publication of Satisfactory Methods for the Preparation of Organic Chemicals. 2012 | Pubmed ID: 23180898
Factors Associated with Pain Among Ambulatory Patients with Cancer with Advanced Disease at a Comprehensive Cancer Center
Journal of Oncology Practice / American Society of Clinical Oncology. Jul, 2012 | Pubmed ID: 23180994
The prevalence and severity of pain have not been well described among oncology patients in ambulatory care. To better understand the burden of pain among patients with advanced cancer, we examined the prevalence of pain reported during office and treatment visits.
Progress in Gene Therapy for Prostate Cancer
Frontiers in Oncology. 2012 | Pubmed ID: 23181221
Gene therapy has held promise to correct various disease processes. Prostate cancer represents the second leading cause of cancer death in American men. A number of clinical trials involving gene therapy for the treatment of prostate cancer have been reported. The ability to efficiently transduce tumors with effective levels of therapeutic genes has been identified as a fundamental barrier to effective cancer gene therapy. The approach utilizing gene therapy in prostate cancer patients at our institution attempts to address this deficiency. The sodium-iodide symporter (NIS) is responsible for the ability of the thyroid gland to transport and concentrate iodide. The characteristics of the NIS gene suggest that it could represent an ideal therapeutic gene for cancer therapy. Published results from Mayo Clinic researchers have indicated several important successes with the use of the NIS gene and prostate gene therapy. Studies have demonstrated that transfer of the human NIS gene into prostate cancer using adenovirus vectors in vitro and in vivo results in efficient uptake of radioactive iodine and significant tumor growth delay with prolongation of survival. Preclinical successes have culminated in the opening of a phase I trial for patients with advanced prostate disease which is currently accruing patients. Further study will reveal the clinical promise of NIS gene therapy in the treatment of prostate as well as other malignancies.
Hands and Water As Vectors of Diarrheal Pathogens in Bagamoyo, Tanzania
Environmental Science & Technology. Nov, 2012 | Pubmed ID: 23181394
Diarrheal disease is a leading cause of under-five childhood mortality worldwide, with at least half of these deaths occurring in sub-Saharan Africa. Transmission of diarrheal pathogens occurs through several exposure routes including drinking water and hands, but the relative importance of each route is not well understood. Using molecular methods, this study examines the relative importance of different exposure routes by measuring enteric bacteria (pathogenic Escherichia coli) and viruses (rotavirus, enterovirus, adenovirus) in hand rinses, stored water, and source waters in Bagamoyo, Tanzania. Viruses were most frequently found on hands, suggesting that hands are important vectors for viral illness. The occurrence of E. coli virulence genes (ECVG) was equivalent across all sample types, indicating that both water and hands are important for bacterial pathogen transmission. Fecal indicator bacteria and turbidity were good predictors of ECVG, whereas turbidity and human-specific Bacteroidales were good predictors of viruses. ECVG were more likely found in unimproved water sources, but both ECVG and viral genes were detected in improved water sources. ECVG were more likely found in stored water of households with unimproved sanitation facilities. The results provide insights into the distribution of pathogens in Tanzanian households and offer evidence that hand-washing and improved water management practices could alleviate viral and bacterial diarrhea.
Rehabilitation in Advanced, Progressive, Recurrent Cancer: A Randomized Controlled Trial
Journal of Pain and Symptom Management. Nov, 2012 | Pubmed ID: 23182307
CONTEXT: Two million people across the U.K. are living with cancer, often experienced as a long-term condition. They may have unmet needs after active treatment. Rehabilitation aims to address these needs, maximize psychological and physical function, and enable minimum dependency regardless of life expectancy. OBJECTIVES: We aimed to test, in a randomized controlled trial, the clinical and cost-effectiveness of a rehabilitation intervention for patients with advanced, recurrent cancer. METHODS: We conducted a two-arm, wait-list control, randomized trial of a complex rehabilitation intervention delivered by a hospice-based multidisciplinary team vs. usual care for active, progressive, recurrent hematological and breast malignancies, with a follow-up at three months. The primary outcome was the psychological subscale of the Supportive Care Needs Survey (SCNS). Secondary outcomes were other domains on SCNS, psychological status, continuity of care, quality of life, and resource use. RESULTS: Forty-one participants were enrolled and 36 completed the trial. The primary outcome was significantly lower in the intervention arm (adjusted difference -16.8, 95% CI -28.34 to -5.3; P = 0.006). The SCNS physical and patient care subscales (-14.2, 95% CI -26.2 to -2.2; P = 0.02 and -7.4, 95% CI -13.7 to -1.1; P = 0.02, respectively) and self-reported health state (12.8, 95% CI 3.2 to 22.4; P = 0.01) also differed significantly. The incremental cost-effectiveness ratio was £19,390 per quality-adjusted life year. CONCLUSION: This intervention significantly reduced the unmet needs of cancer survivors and it is likely that it is cost-effective. Despite small numbers, the main effect size was robust. We recommend implementation alongside evaluation in wider clinical settings and patient populations.
Validating an Objective Video-based Dyskinesia Severity Score in Parkinson's Disease Patients
Parkinsonism & Related Disorders. Nov, 2012 | Pubmed ID: 23182314
Dyskinesia is a common side effect of prolonged dopaminergic therapy in Parkinson's disease patients. Assessing the severity of dyskinesia could help develop better pharmacological and surgical interventions. We have developed a semi-automatic video-based objective dyskinesia quantifying measure called the severity score (SVS) that was evaluated on 35 patient videos. We present a study to evaluate the utility of our severity score and compare its performance to clinical ratings of neurologists. In addition to the Unified Dyskinesia Rating Scale (UDysRS) score for each video, four neurologists provided three sets of time lapsed ratings and rankings of the 35 videos using a specifically developed protocol. The statistical analysis of our data using Kendall's tau-b and intra-class correlations shows that (a) ranking patient videos based on severity is suitable for studying the utility of the SVS, and (b) SVS exhibits moderate utility to quantify dyskinesia severity when compared to manual assessment of dyskinesia by neurologists using the UDysRS. These results support the effective use of SVS as an objective measure to quantify dyskinesia and the rationale for a ranking system that complements traditional rating scales.
Core Elements of Transition Support Programs: The Experiences of Newly Qualified Australian Midwives
Sexual & Reproductive Healthcare : Official Journal of the Swedish Association of Midwives. Dec, 2012 | Pubmed ID: 23182448
This article reports on newly qualified midwives' experiences of the core elements of their transition support program; clinical rotations, supernumerary time, study days and midwife-to-midwife support.
Assisting Women to Make Informed Choices About Screening for Group B Streptococcus in Pregnancy: A Critical Review of the Evidence
Women and Birth : Journal of the Australian College of Midwives. Nov, 2012 | Pubmed ID: 23182754
The approach to the prevention of early onset GBS disease in the newborn varies considerably from country to country. The Centre for Disease Control in the United States advocates universal culture based screening with the administration of intra-partum antibiotics, usually benzylpenicillin or ampicillin, to women who are colonised with GBS. National groups in the UK and New Zealand advocate a risk-based approach where intra-partum antibiotics are given to women with identified risk factors. The Canadian Taskforce on preventive health care has identified a third approach; where intra-partum antibiotics are given to women with a positive GBS culture and an identified risk factor. There are no national guidelines or consensus in Australia. The aim of this paper is to explore the evidence for screening and intrapartum prophylaxis for GBS. The three main methods of detection and management of GBS in pregnancy are described and the implications for women and midwifery practice are addressed. It is hoped that this discussion will provide women, midwives and other clinicians with a summary of the evidence, risks and benefits to enable informed decision making.
A Comparison of the Impact of 'seagrass-friendly' Boat Mooring Systems on Posidonia Australis
Marine Environmental Research. Nov, 2012 | Pubmed ID: 23182893
Permanent boat moorings have contributed to the decline of seagrasses worldwide, prompting the development of 'seagrass-friendly' moorings. We contrasted seagrass cover and density (predominantly Posidonia australis) in the vicinity of three mooring types and nearby reference areas lacking moorings in Jervis Bay, Australia. We examined two types of 'seagrass-friendly' mooring and a conventional 'swing' mooring. 'Swing' moorings produced significant seagrass scour, denuding patches of ∼9 m radius. Seagrass-friendly 'cyclone' moorings produced extensive denuded patches (average radius of ∼18 m). Seagrass-friendly 'screw' moorings, conversely, had similar seagrass cover to nearby reference areas. Our findings reinforce previous work highlighting the negative effects of 'swing' and 'cyclone' moorings. In contrast, the previously unstudied 'screw' moorings were highly effective. We conclude that regular maintenance of moorings and the monitoring of surrounding seagrass are required to ensure that 'seagrass-friendly' moorings are operating effectively. This is important, as following damage Posidonia will take many decades to recover.
Travel-associated Sexually Transmitted Infections: an Observational Cross-sectional Study of the GeoSentinel Surveillance Database
The Lancet Infectious Diseases. Nov, 2012 | Pubmed ID: 23182931
BACKGROUND: Travel is thought to be a risk factor for the acquisition of sexually transmitted infections (STIs), but no multicentre analyses have been done. We aimed to describe the range of diseases and the demographic and geographical factors associated with the acquisition of travel-related STIs through analysis of the data gathered by GeoSentinel travel medicine clinics worldwide. METHODS: We gathered data from ill travellers visiting GeoSentinel clinics worldwide between June 1, 1996, and Nov 30, 2010, and analysed them to identify STIs in three clinical settings: after travel, during travel, or immigration travel. We calculated proportionate morbidity for each of the three traveller groups and did logistic regression to assess the association between STIs and demographic, geographical, and travel variables. FINDINGS: Our final analysis was of 112 180 ill travellers-64 335 patients seen after travel, 38 287 patients seen during travel, and 9558 immigrant patients. 974 patients (0·9%) had diagnoses of STIs, and 1001 STIs were diagnosed. The proportionate STI morbidities were 6·6, 10·2, and 16·8 per 1000 travellers in the three groups, respectively. STIs varied substantially according to the traveller category. The most common STI diagnoses were non-gonococcal or unspecified urethritis (30·2%) and acute HIV infection (27·6%) in patients seen after travel; non-gonococcal or unspecified urethritis (21·1%), epididymitis (15·2%), and cervicitis (12·3%) in patients seen during travel; and syphilis in immigrant travellers (67·8%). In ill travellers seen after travel, significant associations were noted between diagnosis of STIs and male sex, travelling to visit friends or relatives, travel duration of less than 1 month, and not having pretravel health consultations. INTERPRETATION: The range of STIs varies substantially according to traveller category. STI preventive strategies should be particularly targeted at men and travellers visiting friends or relatives. Our data suggest target groups for pretravel interventions and should assist in post-travel screening and decision making. FUNDING: US Centers for Disease Control and Prevention, and International Society of Travel Medicine.
A Novel Approach for the Simultaneous Quantification of a Therapeutic Monoclonal Antibody in Serum Produced from Two Distinct Host Cell Lines
MAbs. Nov, 2012 | Pubmed ID: 23182963
Therapeutic monoclonal antibodies (mAbs) possess a high degree of heterogeneity associated with the cell expression system employed in manufacturing, most notably glycosylation. Traditional immunoassay formats used to quantify therapeutic mAbs are unable to discriminate between different glycosylation patterns that may exist on the same protein amino acid sequence. Mass spectrometry provides a technique to distinguish specific glycosylation patterns of the therapeutic antibody within the same sample, thereby allowing for simultaneous quantification of the same mAb with different glycosylation patterns. Here we demonstrate a two-step approach to successfully differentiate and quantify serum mixtures of a recombinant therapeutic mAb produced in two different host cell lines (CHO vs. Sp2/0) with distinct glycosylation profiles. Glycosylation analysis of the therapeutic mAb, CNTO 328 (siltuximab), was accomplished through sample pretreatment consisting of immunoaffinity purification (IAP) and enrichment, followed by liquid chromatography (LC) and mass spectrometry (MS). LC-MS analysis was used to determine the percentage of CNTO 328 in the sample derived from either cell line based on the N-linked G1F oligosaccharide on the mAb. The relative amount of G1F derived from each cell line was compared with ratios of CNTO 328 reference standards prepared in buffer. Glycoform ratios were converted to concentrations using an immunoassay measuring total CNTO 328 that does not distinguish between the different glycoforms. Validation of the IAP/LC-MS method included intra-run and inter-run variability, method sensitivity and freeze-thaw stability. The method was accurate (%bias range = -7.30-13.68%) and reproducible (%CV range = 1.49-10.81%) with a LOQ of 2.5 μg/mL.
Epizootics of Sudden Death in Tammar Wallabies (Macropus Eugenii) Associated with an Orbivirus Infection
Australian Veterinary Journal. Dec, 2012 | Pubmed ID: 23186095
Epizootics of sudden death in tammar wallabies (Macropus eugenii) occurred at six research facilities and zoological gardens in New South Wales, Australia, in late 1998 and at one Queensland research facility in March 1999. There were 120 confirmed tammar wallaby deaths during this period; however, population censuses indicated that up to 230 tammar wallabies may have died. The majority of animals died without premonitory signs. A small proportion of wallabies exhibited increased respiratory rate, sat with a lowered head shortly before death or were discovered in lateral recumbency, moribund and with muscle fasciculations. Gross postmortem findings consistently included massive pulmonary congestion, mottled hepatic parenchyma and subcutaneous oedema throughout the hindlimbs and inguinal region. Approximately 30% of the animals examined also had extensive haemorrhage within the fascial planes and skeletal muscle of the hindlimb adductors, inguinal region, ventral thorax, dorsal cervical region and perirenal retroperitoneal area. The tissues of affected animals became autolytic within a short period after death. Bacteriological examination of tissues from 14 animals did not provide any significant findings. Toxicological examination of the gastric and colonic contents of four animals did not reveal evidence of brodifacoume or other rodenticides. Viruses from the Eubenangee serogroup of the Orbivirus genus were isolated from the cerebral cortex of nine, and the myocardium of two, tammar wallabies and the liver and intestine of another tammar wallaby. A similar orbivirus was also isolated from the cerebrospinal fluid of another tammar wallaby that died suddenly. The disease agent appears to be a previously unrecognised orbivirus in the Eubenangee serogroup. This is the first report of epizootics of sudden deaths in tammar wallabies apparently associated with an orbivirus infection.
Spatial and Temporal Characteristics of V1 Microstimulation During Chronic Implantation of a Microelectrode Array in a Behaving Macaque
Journal of Neural Engineering. Dec, 2012 | Pubmed ID: 23186948
Objective. It has been hypothesized that a vision prosthesis capable of evoking useful visual percepts can be based upon electrically stimulating the primary visual cortex (V1) of a blind human subject via penetrating microelectrode arrays. As a continuation of earlier work, we examined several spatial and temporal characteristics of V1 microstimulation. Approach. An array of 100 penetrating microelectrodes was chronically implanted in V1 of a behaving macaque monkey. Microstimulation thresholds were measured using a two-alternative forced choice detection task. Relative locations of electrically-evoked percepts were measured using a memory saccade-to-target task. Main results. The principal finding was that two years after implantation we were able to evoke behavioural responses to electric stimulation across the spatial extent of the array using groups of contiguous electrodes. Consistent responses to stimulation were evoked at an average threshold current per electrode of 204 ± 49 µA (mean ± std) for groups of four electrodes and 91 ± 25 µA for groups of nine electrodes. Saccades to electrically-evoked percepts using groups of nine electrodes showed that the animal could discriminate spatially distinct percepts with groups having an average separation of 1.6 ± 0.3 mm (mean ± std) in cortex and 1.0° ± 0.2° in visual space. Significance. These results demonstrate chronic perceptual functionality and provide evidence for the feasibility of a cortically-based vision prosthesis for the blind using penetrating microelectrodes.
Variability in Infection Control Measures for the Percutaneous Lead Among Programs Implanting Long-term Ventricular Assist Devices in the United States
Progress in Transplantation (Aliso Viejo, Calif.). Dec, 2012 | Pubmed ID: 23187051
Ventricular assist devices (VADs) are a surgical treatment for heart failure. These devices may be implanted as a bridge to transplant or as destination therapy. After surgical recovery and education regarding device care, patients are discharged home. Meticulous care of the driveline must be taken to prevent infection and trauma of the site throughout the perioperative event and for the duration of support. Currently a standardized protocol for care of the driveline and exit site does not exist. VAD coordinators from across the country discussed the variability in care at different centers in the United States through a series of conference calls. A survey consisting of 16 questions was developed. The survey included questions on preoperative antibiotic recommendations, driveline placement and exit site suturing, frequency of dressing changes, and showering practices. VAD coordinators shared center-specific dressing protocols and any driveline success stories. This survey was sent to 73 centers; 38 centers (52%) responded. The purpose of the survey was to define current practice in order to move toward a standard of practice or protocol based on expert opinion for VAD driveline care and to assess the need for future studies.
An Unusual Cause of Massive Pleural Effusion
The American Journal of the Medical Sciences. Dec, 2012 | Pubmed ID: 23187121
ABSTRACT:: Pleural effusions in ovarian hyperstimulation syndrome, whether transudative or exudative, can occur in up to 30% of cases. This disorder is always reversible but may have various clinical presentations and degrees of severity. Although assessing for risk factors to predict clinical severity is helpful, it is rare for ovarian hyperstimulation syndrome to present as a massive pleural effusion requiring emergent intervention. In this study, such a case is reported.
Coccidioidomycosis: ADA Levels, Serologic Parameters, Culture Results, and PCR Testing in Pleural Fluid
Chest. Sep, 2012 | Pubmed ID: 23187746
ABSTRACT BACKGROUND: In a patient with positive serum serology for coccidioidomycosis, the differential diagnosis of concurrent pleural effusions can be challenging. We therefore sought to clarify the performance characteristics of biochemical, serologic and nucleic-acid based testing in an attempt to avoid invasive procedures. The utility of adenosine deaminase (ADA), coccidioidal serology, and polymerase chain reaction (PCR) in the evaluation of pleuropulmonary coccidioidomycosis have not been previously reported. METHODS: Forty consecutive patients evaluated for pleuropulmonary coccidioidomycosis were included. Demographic data, pleural fluid values, culture results, and clinical diagnoses were obtained from patient chart review. ADA testing was performed by ARUP laboratories, coccidioidal serologic testing was performed by the UC-Davis coccidioidomycosis serology laboratory and PCR testing was performed by the Translational Genomics Research Institute using a previously published methodology. RESULTS: Fifteen patients were diagnosed with pleuropulmonary coccidioidomycosis by EORTC/MSG criteria. Pleural fluid ADA concentrations were below 40 IU/L in all patients (range <1.0 - 28.6 IU/L; median 4.7). The sensitivity and specificity of coccidioidal serologic testing was 100% in this study. The specificity of PCR testing was high (100%), although the overall sensitivity remained low, and comparable to the experience of others in the clinical use of PCR for coccidioidal diagnostics. CONCLUSION: Contrary to prior speculation, ADA levels in pleuropulmonary coccidioidomycosis are not elevated. The sensitivity and specificity of coccidioidal serologic testing in non-serum samples remained high, while the clinical usefulness of PCR testing in pleural fluid was disappointing and was comparable to pleural fluid culture.1Department of Medical Microbiology and Immunology, Coccidioidomycosis Serology Laboratory, University of California - Davis2Department of Internal Medicine, Division of Infectious Diseases, University of California Davis Medical Center3Department of Internal Medicine, Division of Infectious Diseases, University of California at San Francisco - Fresno Medical Center, Fresno CA4Translational Genomics Research Institute, Flagstaff, Arizona, United States of America5Doctors Hospital of Manteca, Manteca CACorrespondence to: George R. Thompson, M.D., Assistant Professor of Medicine, Coccidioidomycosis Serology Laboratory, Department of Medical Microbiology and Immunology, Department of Medicine, Division of Infectious Diseases, University of California - Davis, Davis, CA 95616 email: grthompson@ucdmc.ucdavis.eduFinancial disclosures: All authors - no conflictsFunding: This research was funded in part by NIH Grant #R21AI076773.
CoMPASs: IOn Programme (Care Of Memory Problems in Advanced Stages of Dementia: Improving Our Knowledge): Protocol for a Mixed Methods Study
BMJ Open. 2012 | Pubmed ID: 23187973
INTRODUCTION: Approximately 700 000 people in the UK have dementia, rising to 1.2 million by 2050; one-third of people aged over 65 will die with dementia. Good end-of-life care is often neglected, and detailed UK-based research on symptom burden and needs is lacking. Our project examines these issues from multiple perspectives using a rigorous and innovative design, collecting data which will inform the development of pragmatic interventions to improve care. METHODS AND ANALYSIS: To define in detail symptom burden, service provision and factors affecting care pathways we shall use mixed methods: prospective cohort studies of people with advanced dementia and their carers; workshops and interactive interviews with health professionals and carers, and a workshop with people with early stage dementia. Interim analyses of cohort data will inform new scenarios for workshops and interviews. Final analysis will include cohort demographics, the symptom burden and health service use over the follow-up period. We shall explore the level and nature of unmet needs, describing how comfort and quality of life change over time and differences between those living in care homes and those remaining in their own homes. Data from workshops and interviews will be analysed for thematic content assisted by textual grouping software. Findings will inform the development of a complex intervention in the next phase of the research programme. ETHICS AND DISSEMINATION: Ethical approval was granted by National Health Service ethical committees for studies involving people with dementia and carers (REC refs. 12/EE/0003; 12/LO/0346), and by university ethics committee for work with healthcare professionals (REC ref. 3578/001). We shall present our findings at conferences, and in peer-reviewed journals, prepare detailed reports for organisations involved with end-of-life care and dementia, publicising results on the Marie Curie website. A summary of the research will be provided to participants if requested.
Association of Pain Score Documentation and Analgesic Use in a Pediatric Emergency Department
Pediatric Emergency Care. Nov, 2012 | Pubmed ID: 23187984
OBJECTIVES: This study characterizes the association between pain score documentation and analgesic administration among pediatric emergency department patients. METHODS: This is a secondary analysis of a prospectively collected research database from an academic emergency department. Records of randomly sampled pediatric patients seen between August 2005 and October 2006 were reviewed. Pain scores from age-appropriate 0 to 10 numeric pain rating scales were abstracted (≥7 considered severe). Descriptive statistics and 95% confidence intervals (CIs) were calculated. RESULTS: An initial pain score was documented in 87.4% of 4514 patients enrolled, 797 (17.7%) with severe pain. Of these, 63.1% (95% CI, 59.7%-66.5%) received an analgesic, and 16.7% (95% CI, 14.2%-19.5%) received it parenterally. Initial pain score documentation was similar across age groups. Patients younger than 2 years with severe pain were less likely to receive analgesics compared with teenaged patients with severe pain (32.1%; 95% CI, 15.9%-52.3%) versus 67.6% (95% CI, 63.2%-71.7%). Of 502 patients with documented severe pain who received analgesic, 23.3% (95% CI, 19.7%-27.3%) had a second pain score documented within 2 hours of the first. Documentation of a second pain score was associated with the use of parenteral analgesic and a second dose of analgesic. CONCLUSIONS: In this population, initial pain score documentation was common, but severe pain was frequently untreated, most often in the youngest patients. Documentation of a second pain score was not common but was associated with more aggressive pain management when it occurred. Further study is needed to investigate causation and to explore interventions that increase the likelihood of severe pain being treated.
Western Trauma Association Critical Decisions in Trauma: Resuscitative Thoracotomy
The Journal of Trauma and Acute Care Surgery. Dec, 2012 | Pubmed ID: 23188227
In the past three decades, there has been a significant clinical shift in the performance of resuscitative thoracotomy (RT), from a nearly obligatory procedure before declaring any trauma patient deceased to a more selective application of RT. We have sought to formulate an evidence-based guideline for the current indications for RT after injury in the patient.
Western Trauma Association Critical Decisions in Trauma: Management of Complicated Diverticulitis
The Journal of Trauma and Acute Care Surgery. Dec, 2012 | Pubmed ID: 23188229
Observation of Inhibited Electron-ion Coupling in Strongly Heated Graphite
Scientific Reports. 2012 | Pubmed ID: 23189238
Creating non-equilibrium states of matter with highly unequal electron and lattice temperatures (T(ele)≠T(ion)) allows unsurpassed insight into the dynamic coupling between electrons and ions through time-resolved energy relaxation measurements. Recent studies on low-temperature laser-heated graphite suggest a complex energy exchange when compared to other materials. To avoid problems related to surface preparation, crystal quality and poor understanding of the energy deposition and transport mechanisms, we apply a different energy deposition mechanism, via laser-accelerated protons, to isochorically and non-radiatively heat macroscopic graphite samples up to temperatures close to the melting threshold. Using time-resolved x ray diffraction, we show clear evidence of a very small electron-ion energy transfer, yielding approximately three times longer relaxation times than previously reported. This is indicative of the existence of an energy transfer bottleneck in non-equilibrium warm dense matter.
Understanding Antioxidants: Using Various Arsenals to Impact the Oral Environment
Dentistry Today. Nov, 2012 | Pubmed ID: 23189908
Dynamic Versus Radiographic Alignment in Relation to Medial Knee Loading in Symptomatic Osteoarthritis
Journal of Applied Biomechanics. Nov, 2012 | Pubmed ID: 23193067
Dynamic knee alignment is speculated to have a stronger relationship to medial knee loading than radiographic alignment. Therefore, we aimed to determine what frontal plane knee kinematic variable correlated most strongly to the knee adduction moment. That variable was then compared with radiographic alignment as a predictor of the knee adduction moment. Therefore, 55 subjects with medial knee OA underwent three-dimensional gait analysis. A subset of 21 subjects also underwent full-limb radiographic assessment for knee alignment. Correlations and regression analyses were performed to assess the relationships between the kinematic, kinetic and radiographic findings. Peak knee adduction angle most strongly correlated to the knee adduction moment of the kinematic variables. In comparison with radiographic alignment, peak knee adduction angle was the stronger predictor. Given that most epidemiological studies on knee OA use radiographic alignment in an attempt to understand progression, these results are meaningful.
It's a Small World ... Looking from a Different Perspective
Clinical Chemistry. Dec, 2012 | Pubmed ID: 23193152
NCBI GEO: Archive for Functional Genomics Data Sets--update
Nucleic Acids Research. Nov, 2012 | Pubmed ID: 23193258
The Gene Expression Omnibus (GEO, http://www.ncbi.nlm.nih.gov/geo/) is an international public repository for high-throughput microarray and next-generation sequence functional genomic data sets submitted by the research community. The resource supports archiving of raw data, processed data and metadata which are indexed, cross-linked and searchable. All data are freely available for download in a variety of formats. GEO also provides several web-based tools and strategies to assist users to query, analyse and visualize data. This article reports current status and recent database developments, including the release of GEO2R, an R-based web application that helps users analyse GEO data.
Elucidating Capacitance and Resistance Terms in Confined Electroactive Molecular Layers
Analytical Chemistry. Nov, 2012 | Pubmed ID: 23194102
Electrochemical analyses of electroactive self-assembled monolayers sample current contributions that are strongly influenced by parasitic and uncompensated resistance effects that, though unresolved, can strongly distort redox analysis. Prior work has shown that impedance derived capacitance spectroscopy approaches can cleanly resolve all contributions generated at such films, including those which are related to the layer dipolar/electrostatic relaxation characteristics. We show herein that, in isolating the faradaic and non faradaic contributions present within an improved equivalent circuit description of such interfaces, it is possible to accurately simulate subsequently observed cyclic voltammograms (that is, generated current versus potential patterns map accurately onto frequency domain measurements). Not only does this enable a frequency resolved quantification of all components present, and, in so doing, a full validation of the equivalent circuit model utilised, but also facilitates the generation of background subtracted cyclic voltammograms remarkably free from all but faradaic contributions.
Evaluating Animal-assisted Therapy in Group Treatment for Child Sexual Abuse
Journal of Child Sexual Abuse. Nov, 2012 | Pubmed ID: 23194140
This study evaluates and compares the effectiveness of three group interventions on trauma symptoms for children who have been sexually abused. All of the groups followed the same treatment protocol, with two of them incorporating variations of animal-assisted therapy. A total of 153 children ages 7 to 17 who were in group therapy at a Child Advocacy Center participated in the study. Results indicate that children in the groups that included therapy dogs showed significant decreases in trauma symptoms including anxiety, depression, anger, post-traumatic stress disorder, dissociation, and sexual concerns. In addition, results show that children who participated in the group with therapeutic stories showed significantly more change than the other groups. Implications and suggestions for further research are discussed.
Cardiovascular Risk Assessment: Addition of CKD and Race to the Framingham Equation
American Heart Journal. Dec, 2012 | Pubmed ID: 23194494
The value of the Framingham equation in predicting cardiovascular risk in African Americans and patients with chronic kidney disease (CKD) is unclear. The purpose of the study was to evaluate whether the addition of CKD and race to the Framingham equation improves risk stratification in hypertensive patients.
Characterization and Molecular Differentiation of 16SrI-E and 16SrIX-E Phytoplasmas Associated with Blueberry Stunt Disease in New Jersey
Molecular and Cellular Probes. Nov, 2012 | Pubmed ID: 23195601
A nested PCR assay was employed to detect the presence of phytoplasmas in 127 blueberry plants exhibiting typical or a portion of blueberry stunt (BBS) syndrome collected in 2010 and 2011, from 11 commercial farms predominantly located in two counties in New Jersey, USA. Ninety plants exhibiting typical stunt syndrome tested positive for phytoplasma infection. Restriction fragment length polymorphism (RFLP) analysis indicated that two distinct phytoplasmas were associated with BBS-diseased plants. About 95% of phytoplasmas detected were very closely related to BBS phytoplasma strains BBS3-AR (subgroup 16SrI-E) and BBS1-MI (unidentified) identified previously, and 4.4 % of phytoplasmas detected belonged to the pigeon pea witches'-broom phytoplasma group (16SrIX). Sequence and phylogenetic analysis of cloned 16S rDNA further indicated the subgroup 16SrI-E related phytoplasmas represented a variant of 16SrI-E reference strain BBS3-AR, while the 16SrIX related phytoplasmas were closely related to juniper witches'- broom (JunWB) phytoplasma (16SrIX-E), representing a 16SrIX-E variant. Ribosomal protein (rp) and secY gene-based phylogenies revealed that BBS3-AR and BBS-NJ 16SrI-E strains belonged to a closely related lineage, while BBS-NJ 16SrIX-E strains and JunWB strains represented two distinct lineages. Single nucleotide polymorphisms (SNPs) analyses of rp and secY gene sequences further revealed that no specific rp gene SNPs and only two specific secY gene SNPS were present between BBS-NJ 16SrI-E strains and BBS3-AR. In contrast, BBS-NJ 16SrIX-E strains/clones had 15 consensus rp SNPs and 28 consensus secY SNPs that separated them from JunWB strains/clones. For the first time, two distinct phytoplasmas that cause BBS-disease in the U.S. was revealed.
Intraocular Lymphoma: a Clinical Perspective
Eye (London, England). Nov, 2012 | Pubmed ID: 23196650
Primary vitreoretinal lymphoma (PVRL) is a rare malignancy that is speculated to arise extraocularly, and preferentially invade and flourish in the ocular and CNS microenvironments. The eye is involved in about 20% of primary central nervous system lymphomas, but the brain is eventually involved in about 80% of PVRL. Most are B-cell lymphomas with small numbers of T-cell lymphomas metastatic to the vitreous and retina. Metastatic systemic B-cell lymphoma usually involves choroid. Primary choroidal lymphoma is rare. Intraocular lymphoma can usually be distinguished from uveitis clinically, although there are overlaps, which may be pronounced in eyes with a large component of reactive inflammation related to tumor surveillance and control. There are controversies in diagnosis and treatment. Diagnosis through examination of ocular fluid is technically difficult and can utilize cytology, immunohistochemistry, flow cytometry, molecular detection of gene rearrangements, and cytokine profiling. Treatment of intraocular lymphoma without detectable CNS disease could consist of a full course of systemic chemotherapy with ocular adjunctive treatment, or ocular treatment alone depending on the preference of the clinical center. In ocular only cases where the vitreous has been debulked to improve vision and there is no sight-threatening involvement of the RPE, orbital irradiation or intravitreal chemotherapy stabilizes the intraocular process but does not seem to modify the CNS component, which can present symptomatically in an advanced state. This is a highly malignant disease with a poor prognosis. Close collaboration with a pathologist and oncologist, and good communication with patients is essential.Eye advance online publication, 30 November 2012; doi:10.1038/eye.2012.250.
Functional Impairment of Human Resident Cardiac Stem Cells by the Cardiotoxic Antineoplastic Agent Trastuzumab
Stem Cells Translational Medicine. Apr, 2012 | Pubmed ID: 23197808
Trastuzumab (TZM), a monoclonal antibody against the ERBB2 protein, increases survival in ERBB2-positive breast cancer patients. Its clinical use, however, is limited by cardiotoxicity. We sought to evaluate whether TZM cardiotoxicity involves inhibition of human adult cardiac-derived stem cells, in addition to previously reported direct adverse effects on cardiomyocytes. To test this idea, we exposed human cardiosphere-derived cells (hCDCs), a natural mixture of cardiac stem cells and supporting cells that has been shown to exert potent regenerative effects, to TZM and tested the effects in vitro and in vivo. We found that ERBB2 mRNA and protein are expressed in hCDCs at levels comparable to those in human myocardium. Although clinically relevant concentrations of TZM had no effect on proliferation, apoptosis, or size of the c-kit-positive hCDC subpopulation, in vitro assays demonstrated diminished potential for cardiogenic differentiation and impaired ability to form microvascular networks in TZM-treated cells. The functional benefit of hCDCs injected into the border zone of acutely infarcted mouse hearts was abrogated by TZM: infarcted animals treated with TZM + hCDCs had a lower ejection fraction, thinner infarct scar, and reduced capillary density in the infarct border zone compared with animals that received hCDCs alone (n = 12 per group). Collectively, these results indicate that TZM inhibits the cardiomyogenic and angiogenic capacities of hCDCs in vitro and abrogates the morphological and functional benefits of hCDC transplantation in vivo. Thus, TZM impairs the function of human resident cardiac stem cells, potentially contributing to TZM cardiotoxicity.
Moving Boundary Problems Governed by Anomalous Diffusion
Proceedings. Mathematical, Physical, and Engineering Sciences / the Royal Society. Nov, 2012 | Pubmed ID: 23197935
Anomalous diffusion can be characterized by a mean-squared displacement 〈x(2)(t)〉 that is proportional to t(α) where α≠1. A class of one-dimensional moving boundary problems is investigated that involves one or more regions governed by anomalous diffusion, specifically subdiffusion (α<1). A novel numerical method is developed to handle the moving interface as well as the singular history kernel of subdiffusion. Two moving boundary problems are solved: the first involves a subdiffusion region to the one side of an interface and a classical diffusion region to the other. The interface will display non-monotone behaviour. The subdiffusion region will always initially advance until a given time, after which it will always recede. The second problem involves subdiffusion regions to both sides of an interface. The interface here also reverses direction after a given time, with the more subdiffusive region initially advancing and then receding.
Pyridocoumarin, Aristolactam and Aporphine Alkaloids from the Australian Rainforest Plant Goniothalamus Australis
Phytochemistry. Nov, 2012 | Pubmed ID: 23158725
Chemical investigation of the CH(2)Cl(2)/CH(3)OH extracts from aerial parts of the Australian plant Goniothalamus australis has resulted in the isolation of two pyridocoumarin alkaloids, goniothalines A (1) and B (2) as well as eight known natural products, aristolactam AII (3), enterocarpam II (4), caldensine (5), sauristolactam (6), (-)-anonaine (7), asimilobine (8), altholactone (9) and (+)-goniofufurone (10). The chemical structures of all compounds were determined by extensive spectroscopic and spectrometric analysis. Methylation of 2 using TMS-diazomethane afforded 1, which unequivocally established that both 1 and 2 possessed a 10-methyl-2H-pyrano[2,3-f]quinolin-2-one skeleton. These pyridocoumarin alkaloids are putatively proposed to arise biosynthetically from an aporphinoid precursor. Compounds 1-10 were evaluated for in vitro antimalarial activity against a chloroquine-sensitive Plasmodium falciparum line (3D7). Sauristolactam (6) and (-)-anonaine (7) exhibited the most potent antiparasitic activity with IC(50) values of 9 and 7μM, respectively.
Psychosocial Risk, Prenatal Counseling and Maternal Behavior: Findings from PRAMS, 2004-2008
American Journal of Obstetrics and Gynecology. Nov, 2012 | Pubmed ID: 23159699
OBJECTIVE: To determine the impact of prenatal counseling regarding psychosocial risk factors on maternal behavior. STUDY DESIGN: We analyzed data from 198,323 women participating in the Pregnancy Risk Assessment Monitoring System (PRAMS). Chi-square and logistic regression analyses assessed the relationship between psychosocial risk, prenatal counseling and maternal behavior. RESULTS: The odds of receiving risk-appropriate prenatal counseling were significantly greater for participants who used alcohol (OR=1.13;95% CI 1.08-1.17) and tobacco (2.02;1.91-2.13). After receiving counseling, women quit using alcohol (72.9% vs. 27.1%;p<0.01) and tobacco (79.9% vs. 20.1%;p<0.01) at a significantly greater rate and women with unintended pregnancies were more likely to use postpartum contraception (83.6% vs. 16.4%;p<0.01) than women who were not counseled. However, no significant differences were found in the rates of IPV during pregnancy (56.1% vs. 43.9%; p=0.09) between women who did and did not receive counseling. CONCLUSION: Counseling regarding psychosocial risk factors during pregnancy may positively impact maternal behavior.
Topical Amitriptyline-ketamine for Treatment of Rectal, Genital, and Perineal Pain and Discomfort
Pain Physician. Nov, 2012 | Pubmed ID: 23159965
Pain in the rectal, genital, and perineal area is a common condition treated by pain physicians. These chronic pain syndromes are therapeutically challenging because both interventional and drug therapies often are ineffective.
Intracellular Nitric Oxide Delivery from Stable NO-polymeric Nanoparticle Carriers
Chemical Communications (Cambridge, England). Nov, 2012 | Pubmed ID: 23160081
The encapsulation of S-nitrosoglutathione into polymeric nanoparticles substantially improves NO stability in aqueous media without affecting the efficacy of intracellular delivery. The combination of nano-NO delivery and chemotherapy has been found to enhance antitumour activity of chemotherapeutics, as demonstrated using preliminary in vitro experiments with neuroblastoma cells.
Inhalation Injury Severity and Systemic Immune Perturbations in Burned Adults
Annals of Surgery. Nov, 2012 | Pubmed ID: 23160150
OBJECTIVE:: We aimed to determine whether the severity of inhalation injury evokes an immune response measurable at the systemic level and to further characterize the balance of systemic pro- and anti-inflammation early after burn and inhalation injury. BACKGROUND:: Previously, we reported that the pulmonary inflammatory response is enhanced with worse grades of inhalation injury and that those who die of injuries have a blunted pulmonary immune profile compared with survivors. METHODS:: From August 2007 to June 2011, bronchoscopy was performed on 80 patients admitted to the burn intensive care unit when smoke inhalation was suspected. Of these, inhalation injury was graded into 1 of 5 categories (0, 1, 2, 3, and 4), with grade 0 being the absence of visible injury and grade 4 corresponding to massive injury. Plasma was collected at the time of bronchoscopy and analyzed for 28 immunomodulating proteins via multiplex bead array or enzyme-linked immunosorbent assay. RESULTS:: The concentrations of several plasma immune mediators were increased with worse inhalation injury severity, even after adjusting for age and % total body surface area (TBSA) burn. These included interleukin (IL)-1RA (P = 0.002), IL-6 (P = 0.002), IL-8 (P = 0.026), granulocyte colony-stimulating factor (P = 0.002), and monocyte chemotactic protein 1 (P = 0.007). Differences in plasma immune mediator concentrations in surviving and deceased patients were also identified. Briefly, plasma concentrations of IL-1RA, IL-6, IL-8, IL-15, eotaxin, and monocyte chemotactic protein 1 were higher in deceased patients than in survivors (P < 0.05 for all), whereas IL-4 and IL-7 were lower (P < 0.05). After adjusting for the effects of age, % TBSA burn, and inhalation injury grade, plasma IL-1RA remained significantly associated with mortality (odds ratio, 3.12; 95% confidence interval, 1.03-9.44). Plasma IL-1RA also correlated with % TBSA burn, inhalation injury grade, fluid resuscitation, Baux score, revised Baux score, Denver score, and the Sequential Organ Failure Assessment score. CONCLUSIONS:: The severity of smoke inhalation injury has systemically reaching effects, which argue in favor of treating inhalation injury in a graded manner. In addition, several plasma immune mediators measured early after injury were associated with mortality. Of these, IL-1RA seemed to have the strongest correlation with injury severity and outcomes measures, which may explain the blunted pulmonary immune response we previously found in nonsurvivors.
IL-2 and IL-15 Signaling Complexes: Different but the Same
Nature Immunology. Dec, 2012 | Pubmed ID: 23160210
Pteridine-, Thymidine-, Choline- and Imidazole-derived Alkaloids from the Australian Ascidian, Leptoclinides Durus
Organic & Biomolecular Chemistry. Nov, 2012 | Pubmed ID: 23160826
Four new acylated pteridine alkaloids, duramidines A-D, two new acylated thymidine alkaloids, leptoclinidines A and B, two new 1-acylglyceryl-3-(O-carboxyhydroxymethylcholine) alkaloids, durabetaines A and B, three new 1,3-dimethyl-5-methylsulfanylimidazole alkaloids, leptoclinidamines D-F, and the known alkaloids leptoclinidamines B and C and 6-bromo-1H-indolo-3-yl-oxoacetic acid methyl ester were isolated from the Australian ascidian Leptoclinides durus. The duramidines are the first pteridine alkaloids, possessing a three carbon side chain esterified at C-1' with a 4-hydroxy-2'-methoxycinnamic acid, and are either hydroxylated or sulfated at C-2'. The leptoclinidines are the first 3'-indole-3-carboxylic acid ester derivatives of thymidine to be reported in the literature. The durabetaines are the first glyceryl-3-(O-carboxyhydroxymethylcholine) alkaloids to be reported from an animal source and are also the only known derivatives from this class to be acylated with aromatic carboxylic acids. MS and NMR data analysis established the structures of the new compounds. All compounds were shown to be inactive when tested for cytotoxic activity against prostate (LNCaP) and breast (MDA-MB-231) cancer cell lines and antimicrobial activity against Pseudomonas aeruginosa and Staphylococcus aureus.
The Nutrition Needs of Low-income Families Regarding Living Healthier Lifestyles: Findings from a Qualitative Study
Journal of Child Health Care : for Professionals Working with Children in the Hospital and Community. Nov, 2012 | Pubmed ID: 23162049
Pediatric obesity and nutrition-related problems continue to be problematic around the world. The purpose of the current qualitative study was to learn more about the barriers low-income, minority families face to healthy living and where they turn for health-related information. Five focus groups were conducted using open-ended standardized questions. Standardized transcript analysis and coding techniques were used to arrive at five saturated themes. The project was conducted in partnership with a community based Early/Head Start agency. Adult parents of preschool children were invited to participate. Results indicate that low-income minority families face many barriers to eating healthily: while families do eat some healthy foods, they also eat many unhealthy foods; they rely primarily on family members for their nutrition information; they have some desire to change their own health habits (but generally not those of their children); and they have inadequate nutritional knowledge. Options for better reaching this population with important health information are discussed.
Sculpting Humoral Immunity Through Dengue Vaccination to Enhance Protective Immunity
Frontiers in Immunology. 2012 | Pubmed ID: 23162552
Dengue viruses (DENV) are the most important mosquito transmitted viral pathogens infecting humans. DENV infection produces a spectrum of disease, most commonly causing a self-limiting flu-like illness known as dengue fever; yet with increased frequency, manifesting as life-threatening dengue hemorrhagic fever (DHF). Waning cross-protective immunity from any of the four dengue serotypes may enhance subsequent infection with another heterologous serotype to increase the probability of DHF. Decades of effort to develop dengue vaccines are reaching the finishing line with multiple candidates in clinical trials. Nevertheless, concerns remain that imbalanced immunity, due to the prolonged prime-boost schedules currently used in clinical trials, could leave some vaccinees temporarily unprotected or with increased susceptibility to enhanced disease. Here we develop a DENV serotype 1 (DENV-1) DNA vaccine with the immunodominant cross-reactive B cell epitopes associated with immune enhancement removed. We compare wild-type (WT) with this cross-reactivity reduced (CRR) vaccine and demonstrate that both vaccines are equally protective against lethal homologous DENV-1 challenge. Under conditions mimicking natural exposure prior to acquiring protective immunity, WT vaccinated mice enhanced a normally sub-lethal heterologous DENV-2 infection resulting in DHF-like disease and 95% mortality in AG129 mice. However, CRR vaccinated mice exhibited redirected serotype-specific and protective immunity, and significantly reduced morbidity and mortality not differing from naїve mice. Thus, we demonstrate in an in vivo DENV disease model, that non-protective vaccine-induced immunity can prime vaccinees for enhanced DHF-like disease and that CRR DNA immunization significantly reduces this potential vaccine safety concern. The sculpting of immune memory by the modified vaccine and resulting redirection of humoral immunity provide insight into DENV vaccine-induced immune responses.
Modeling the Combined Influence of Host Dispersal and Waterborne Fate and Transport on Pathogen Spread in Complex Landscapes
Water Quality, Exposure, and Health. Sep, 2012 | Pubmed ID: 23162675
Environmental models, often applied to questions on the fate and transport of chemical hazards, have recently become important in tracing certain environmental pathogens to their upstream sources of contamination. These tools, such as first order decay models applied to contaminants in surface waters, offer promise for quantifying the fate and transport of pathogens with multiple environmental stages and/or multiple hosts, in addition to those pathogens whose environmental stages are entirely waterborne. Here we consider the fate and transport capabilities of the human schistosome Schistosoma japonicum, which exhibits two waterborne stages and is carried by an amphibious intermediate snail host. We present experimentally-derived dispersal estimates for the intermediate snail host and fate and transport estimates for the passive downstream diffusion of cercariae, the waterborne, human-infective parasite stage. Using a one dimensional advective transport model exhibiting first-order decay, we simulate the added spatial reach and relative increase in cercarial concentrations that dispersing snail hosts contribute to downstream sites. Simulation results suggest that snail dispersal can substantially increase the concentrations of cercariae reaching downstream locations, relative to no snail dispersal, effectively putting otherwise isolated downstream sites at increased risk of exposure to cercariae from upstream sources. The models developed here can be applied to other infectious diseases with multiple life-stages and hosts, and have important implications for targeted ecological control of disease spread.
Epinephrine, Cortisol, Endotoxin, Nutrition, and the Neutrophil
Surgical Infections. Oct, 2012 | Pubmed ID: 23163310
Abstract Background: Neutrophil dysfunction has been documented after injury in animals and human beings. This review evaluates the relative effects of the hormonal and endotoxin response to injury on immune resistance. Method: Review of the pertinent English-language literature. Results: In volunteers given total parenteral nutrition, neutrophils demonstrate a robust response to leukotriene B4 but none to zymosan/activated serum or the bacterial metabolite formyl-methionyl-leucyl-phenylalanine (FMLP). This finding suggests subclinical exposure to activated complement and FMLP that does not occur during enteral feeding. Additional evidence of neutrophil activation is the release of lactoferrin to the same degree with the two routes of feeding. When normal volunteers are challenged with endotoxin, uniform impairment of the neutrophil response to chemotactic stimuli except LTB4 is demonstrated. Epinephrine increases the total circulating neutrophil pool for a few hours, whereas when cortisol is administered, the neutrophil counts continue to increase through 6 h. A combined epinephrine and cortisol infusion extends the half-life of neutrophils. The role of genomic and central nervous system control through the vagus nerve also is reviewed. Conclusion: Normal volunteers have provided insight into the stress response to infection that is understood only partially.
Optical Coherence Tomography Evaluation in the Multicenter Uveitis Steroid Treatment (MUST) Trial
Ocular Immunology and Inflammation. Nov, 2012 | Pubmed ID: 23163490
Purpose: To describe the evaluation of optical coherence tomography (OCT) scans in the Muliticenter Uveitis Steroid Treatment (MUST) trial and report baseline OCT features of enrolled participants. Methods: Time-domain OCTs acquired by certified photographers using a standardized scan protocol were evaluated at a reading center. Accuracy of retinal thickness data was confirmed with quality evaluation, and caliper measurement of centerpoint thickness (CPT) was performed when retinal thickness data were unreliable. Morphological evaluation included cysts, subretinal fluid, epiretinal membranes (ERMs), and vitreomacular traction. Results: Of the 453 OCTs evaluated, automated retinal thickness was accurate in 69.5% of scans, caliper measurement was performed in 26%, and 4% were ungradable. Intraclass correlation was.98 for reproducibility of caliper measurement. Macular edema (centerpoint thickness ≥ 240 μm) was present in 36%. Cysts were present in 36.6% of scans and ERMs in 27.8%, predominantly central. Intergrader agreement ranged from 78 to 82% for morphological features. Conclusion: Retinal thickness data can be retrieved in a majority of OCT scans in clinical trial submissions for uveitis studies. Small cysts and ERMs involving the center are common in intermediate and posterior/panuveitis requiring systemic corticosteroid therapy.
Validation of an FFQ to Assess Short-term Antioxidant Intake Against 30 D Food Records and Plasma Biomarkers
Public Health Nutrition. Nov, 2012 | Pubmed ID: 23164175
OBJECTIVE: To validate a brief FFQ developed for capturing short-term antioxidant intake in a sample of US college students. DESIGN: A seventy-four-item antioxidant FFQ was developed based on major antioxidant sources in the American diet. The FFQ was validated against 30 d food records (FR) and plasma antioxidant concentrations. The reliability of the FFQ was evaluated by two FFQ administered at a 1-month interval. Settings University of Connecticut, CT, USA. SUBJECTS: Sixty healthy college students. RESULTS: Estimates of dietary antioxidants from the FFQ were moderately to highly correlated with those estimated from the 30 d FR (r = 0·29-0·80; P < 0·05) except for γ-tocopherol and β-cryptoxanthin. Total antioxidant capacity from diet only or from diet and supplements estimated by the 30 d FR and FFQ were highly correlated (r = 0·67 and 0·71, respectively; P < 0·0001). The FFQ categorized 91 % of participants into the same or adjacent tertiles of antioxidant intake as the 30 d FR. Most dietary carotenoids estimated from the FFQ were correlated with plasma levels (P < 0·05). Correlation coefficients for test-retest reliability ranged from 0·39 to 0·86. More than 94 % of the participants were classified in the same or adjacent tertiles between the two administrations of the FFQ. CONCLUSIONS: The brief FFQ demonstrated reasonable validity for capturing a comprehensive antioxidant intake profile. This FFQ is applicable in epidemiological or clinical studies to capture short-term antioxidant intake or to simply document the variations of antioxidant intake in intervention trials. Cross-validation studies are warranted in other target populations.
Is a Sexual Dysfunction Domain Important for Quality of Life in Men with Urological Chronic Pelvic Pain Syndrome? Signs "UPOINT" to Yes
The Journal of Urology. Nov, 2012 | Pubmed ID: 23164384
PURPOSE: Clinical phenotyping to guide treatment for urological chronic pelvic pain syndrome is a promising strategy. The UPOINT (urinary, psychosocial, organ specific, infection, neurological/systemic and tenderness of the pelvic floor) phenotyping system evaluates men and women on 6 domains. However, this study focused on men only. Due to the high prevalence of sexual dysfunction in men with urological chronic pelvic pain syndrome, debate exists about the usefulness of adding an (S) (sexual dysfunction) domain to UPOINT. We examined the usefulness in terms of quality of life and delineated urological chronic pelvic pain syndrome subcategories using UPOINT(S) domains. MATERIALS AND METHODS: We assessed 162 men using UPOINT criteria and after adding the sexual dysfunction domain. Using multiple regression analysis UPOINT(S) criteria were then compared to quality of life, as measured by the SF-36® health outcome survey and Chronic Prostatitis Symptoms Index. Sample subgroups were assessed using k-means cluster analysis. RESULTS: The total number of UPOINT(S) domains correlated with SF-36 and Chronic Prostatitis Symptoms Index scores. Using regression analysis the 2 significant predictors of SF-36 scores were the psychosocial and sexual domains. Men with sexual dysfunction had significantly worse quality of life than men without the condition. In addition, 6 potentially clinically meaningful subgroups were identified using cluster analysis. Sexual dysfunction was differentially present in these groups. CONCLUSIONS: Adding a sexual dysfunction domain to UPOINT may help improve quality of life in men treated for urological chronic pelvic pain syndrome.
Provision of Vascular Surgery in England in 2012
European Journal of Vascular and Endovascular Surgery : the Official Journal of the European Society for Vascular Surgery. Nov, 2012 | Pubmed ID: 23164806
INTRODUCTION: In 2009 the Vascular Society of Great Britain and Ireland reported its recommendations for The Provision of Vascular Services for Patients with Vascular Disease. The objective is to halve the UK elective surgery mortality rate for Abdominal Aortic Aneurysm to 3.5% by 2013. From 16th March 2012, statutory approval has been given by Parliament to recognise Vascular Surgery as a Specialty in the UK. This study assesses the provision of vascular surgery in acute trusts across England. METHOD: From the Department of Health, 169 acute trusts were identified in England and each acute trust was emailed under the Freedom of Information Act. RESULTS: There was a 98.8% response rate. There are currently 80 trusts in England providing acute and elective arterial and aortic surgery, with 48 vascular hubs and 32 trusts which either provide a local on call network or are currently under review. Within the 48 vascular hubs there are a mean of 4.8 consultants and 3.75 middle grades. The on call rota was on average a 1 in 6. CONCLUSION: This study has shown that currently 80 trusts in England provide acute and elective arterial and aortic surgery with 48 centralised complex and arterial vascular services. An integrated vascular service will provide the best quality of care, develop the latest techniques and improve clinical standards.
A Four Factor Model of Systems-based Practices in Psychiatry
Academic Psychiatry : the Journal of the American Association of Directors of Psychiatric Residency Training and the Association for Academic Psychiatry. Nov, 2012 | Pubmed ID: 23154697
Transforming Growth Factor Alpha (TGFα) Regulates Granulosa Cell Tumor (GCT) Cell Proliferation and Migration Through Activation of Multiple Pathways
PloS One. 2012 | Pubmed ID: 23155381
Granulosa cell tumors (GCTs) are the most common ovarian estrogen producing tumors, leading to symptoms of excessive estrogen such as endometrial hyperplasia and endometrial adenocarcinoma. These tumors have malignant potential and often recur. The etiology of GCT is unknown. TGFα is a potent mitogen for many different cells. However, its function in GCT initiation, progression and metastasis has not been determined. The present study aims to determine whether TGFα plays a role in the growth of GCT cells. KGN cells, which are derived from an invasive GCT and have many features of normal granulosa cells, were used as the cellular model. Immunohistochemistry, Western blot and RT-PCR results showed that the ErbB family of receptors is expressed in human GCT tissues and GCT cell lines. RT-PCR results also indicated that TGFα and EGF are expressed in the human granulosa cells and the GCT cell lines, suggesting that TGFα might regulate GCT cell function in an autocrine/paracrine manner. TGFα stimulated KGN cell DNA synthesis, cell proliferation, cell viability, cell cycle progression, and cell migration. TGFα rapidly activated EGFR/PI3K/Akt and mTOR pathways, as indicated by rapid phosphorylation of Akt, TSC2, Rictor, mTOR, P70S6K and S6 proteins following TGFα treatment. TGFα also rapidly activated the EGFR/MEK/ERK pathway, and P38 MAPK pathways, as indicated by the rapid phosphorylation of EGFR, MEK, ERK1/2, P38, and CREB after TGFα treatment. Whereas TGFα triggered a transient activation of Akt, it induced a sustained activation of ERK1/2 in KGN cells. Long-term treatment of KGN cells with TGFα resulted in a significant increase in cyclin D2 and a decrease in p27/Kip1, two critical regulators of granulosa cell proliferation and granulosa cell tumorigenesis. In conclusion, TGFα, via multiple signaling pathways, regulates KGN cell proliferation and migration and may play an important role in the growth and metastasis of GCTs.
Adiponectin and Arterial Stiffness in Youth with Type 1 Diabetes: the SEARCH for Diabetes in Youth Study
Journal of Pediatric Endocrinology & Metabolism : JPEM. 2012 | Pubmed ID: 23155699
Persons with type 1 diabetes are at increased risk of developing vascular disease. Adiponectin concentrations may play an intermediate role in this process. We sought to determine whether adiponectin is correlated with vascular stiffness in adolescents with type 1 diabetes. Plasma adiponectin, pulse wave velocity (PWV), augmentation index (AIx-75), and brachial distensibility (BrachD) were collected in 225 adolescents. Outcomes were evaluated by sex, and regression models were used to determine whether adiponectin was an independent determinant of arterial stiffness. Males had lower adiponectin levels and stiffer vessels (lower BrachD, p < 0.01) than females. Unadjusted correlations revealed that adiponectin was correlated with BrachD (p < 0.01) but not PWV and AIx-75. After adjustment, adiponectin was not a significant predictor of BrachD. The most consistent predictors of increased stiffness were age, male sex, blood pressure, obesity, and total cholesterol (p < 0.05). Adiponectin's contributions to arterial stiffness appear to be masked by other cardiovascular risk factors in persons with type 1 diabetes.
The Effect of Public Deposit of Scientific Articles on Readership
The Physiologist. Oct, 2012 | Pubmed ID: 23155924
A longitudinal cohort analysis of 3,499 articles published in 12 physiology journals reveals a 14% reduction in full text article downloads when they are made publicly available from the PubMed Central archive. The loss of article readership from the journal website may weaken the ability of the publisher to build communities of interest around the research article, impede the communication of news and events with society members and reduce the perceived value of the journal to institutional subscribers.
Toxicity and Horizontal Transfer of 0.5% Fipronil Dust Against Formosan Subterranean Termites
Journal of Economic Entomology. Oct, 2012 | Pubmed ID: 23156175
The toxicity and horizontal transfer of a new formulation of fipronil, 0.5% fipronil dust, was tested against Coptotermes formosanus Shiraki in the laboratory. The formulation was applied in three different ways: 1) Directly applied to termites (donors) and mixed with untreated termites (recipients) at three ratios, viz., 50 donors: 50 recipients, 20 donors: 80 recipients and 10 donors: 90 recipients. 2) Applied onto the surface of 3 mm thick sand or soil substrate in a petri dish and then topped with another 3 mm thick sand or soil layer whereupon termites were released. 3) Applied to the inner surface of a tube (either 5 cm or 15 cm long) that connected two foraging dishes, one containing dry sand and the other moist sand plus a wood block and termites were released into the dry sand dish. All donors and >93% of the recipients were dead by 42 h after treatment in the direct treatment experiment. Significant mortalities of both donors and recipients were observed at 5 h after treatment at all donor: recipient ratios. During this period, the mortality of the recipients (but not donors) at 10:90 was significantly lower than those at the other two ratios. All termites were dead at 65 h after exposure (HAE) on the sand treatment and at 190 HAE on soil treatment. More than 96% mortality was observed at 40 HAE on the sand treatment as compared with only 6% mortality onsoil treatment during the same time period. In the tube treatment experiment, > 97% mortality was observed at 90 h after release for both tube lengths as compared with < 3% mortality in controls. About half of the termites were dead by 15 h after release regardless of the tube length. Our results showed that 0.5% fipronil dust is nonrepellent and readily transferred from treated to nontreated termites.
Cusp Catastrophe Models for Cognitive Workload and Fatigue in a Verbally Cued Pictorial Memory Task
Human Factors. Oct, 2012 | Pubmed ID: 23156625
The aim of this study was to evaluate two cusp catastrophe models for cognitive workload and fatigue. They share similar cubic polynomial structures but derive from different underlying processes and contain variables that contribute to flexibility with respect to load and the ability to compensate for fatigue.
Monitoring Unmet Needs: Using 2-1-1 During Natural Disasters
American Journal of Preventive Medicine. Dec, 2012 | Pubmed ID: 23157762
Hurricanes Katrina and Rita struck the Gulf Coast forcing unprecedented mass evacuation and devastation. Texas 2-1-1 is a disaster communication hub between callers with unmet needs and community services at disaster sites and evacuation destinations.
Diseases of the Sella and Parasellar Region: an Overview
Seminars in Roentgenology. Jan, 2013 | Pubmed ID: 23158049
Association Genetics of Chemical Wood Properties in Black Poplar (Populus Nigra)
The New Phytologist. Jan, 2013 | Pubmed ID: 23157484
Black poplar (Populus nigra) is a potential feedstock for cellulosic ethanol production, although breeding for this specific end use is required. Our goal was to identify associations between single nucleotide polymorphism (SNP) markers within candidate genes encoding cellulose and lignin biosynthetic enzymes, with chemical wood property phenotypic traits, toward the aim of developing genomics-based breeding technologies for bioethanol production. Pyrolysis molecular beam mass spectrometry was used to determine contents of five- and six-carbon sugars, lignin, and syringyl : guaiacyl ratio. The association population included 599 clones from 17 half-sib families, which were successfully genotyped using 433 SNPs from 39 candidate genes. Statistical analyses were performed to estimate genetic parameters, linkage disequilibrium (LD), and single marker and haplotype-based associations. A moderate to high heritability was observed for all traits. The LD, across all candidate genes, showed a rapid decay with physical distance. Analysis of single marker-phenotype associations identified six significant marker-trait pairs, whereas nearly 280 haplotypes were associated with phenotypic traits, in both an individual and multiple trait-specific manner. The rapid decay of LD within candidate genes in this population and the genetic associations identified suggest a close relationship between the associated SNPs and the causative polymorphisms underlying the genetic variation of lignocellulosic traits in black poplar.
High Signal Contrast Gating with Biomodified Gd Doped Mesoporous Nanoparticles
Chemical Communications (Cambridge, England). Jan, 2013 | Pubmed ID: 23164954
Internally Gd doped mesoporous nanoparticles have been prepared and exhibit unprecedented relaxivities that are retained on external biomodification. In tuning diffusive water access, image contrast can be reversibly switched in the presence of a specific protein target.
Complications of Colorectal Anastomoses: Leaks, Strictures, and Bleeding
The Surgical Clinics of North America. Feb, 2013 | Pubmed ID: 23177066
Intestinal anastomosis is an essential part of surgical practice, and with it comes the inherent risk of complications including leaks, strictures, and bleeding, which result in significant morbidity and occasional mortality. Understanding the myriad of risk factors and the strength of the data helps guide a surgeon as to the safety of undertaking an operation in which a primary anastomosis is to be considered. This article reviews the risk factors, management, and outcomes associated with anastomotic complications.
Controversies in the Care of the Enterocutaneous Fistula
The Surgical Clinics of North America. Feb, 2013 | Pubmed ID: 23177074
Enterocutaneous fistula and its variations are some of the most difficult problems encountered in the practice of general surgery. Reliable evidence that can be used to direct the care of patients afflicted with this malady is limited. There are controversies in several areas of care. This article addresses some of the gray areas of care for the patient with enterocutaneous fistula. There is particular attention directed toward the phenomenon of enteroatmospheric fistula, as well as prevention and abdominal wall reconstruction, which is often required in these individuals.
Disposable Screen-printed Sensors for the Electrochemical Detection of TNT and DNT
The Analyst. Jan, 2013 | Pubmed ID: 23152954
Due to the heightened level of national security currently prevalent due to the possibility of terrorist incidents, highly portable, miniaturised and sensitive monitoring devices for trace levels of injurious materials, such as explosives are now of the upmost importance. One method that offers a possible route for the development of a detection system for such species is via an electrochemical regime, coupled to the use of disposable sensor technology. Within this study, the use of carbon screen-printed sensors for the detection and analysis of the classical explosive trinitrotoluene (TNT) and the related dinitrotoluene (DNT) is described, with the eventual objective to develop an inexpensive, accurate and sensitive detection system for trace quantities of explosives in field settings. Commercially available screen-printed carbon sensors have been used as the base platform for this investigation and the electrochemistry of both TNT and DNT studied at these surfaces. Two reductive peaks and one oxidative peak were observed for both analytes. The best linear fits and sensitivities were obtained using the reductive peak at -0.72 V vs. Ag/AgCl. A linear range from 1 to 200 μM could be obtained for TNT and DNT in pH 7.0 phosphate buffer with limits of detection as low as 0.4 μM (TNT) and 0.7 μM (DNT). A second system which utilised the addition of the enzyme, nitroreductase, and the coenzyme, NADPH, into the solution matrix prior to electrochemical interrogations with screen-printed carbon electrodes was found to increase the resulting signal magnitude at the oxidation peak at +0.3 V, improving the performance of the sensor at these values.
Effects of Inorganic Nutrients in Recycled Water on Freshwater Phytoplankton Biomass and Composition
Water Research. Jan, 2013 | Pubmed ID: 23131396
Planned indirect potable reuse water treated with advanced wastewater technologies (AWWT) to remove pollutants is increasingly being used to augment drinking water and groundwater supplies. While the treatment process substantially reduces the high nitrogen (N) and phosphorus (P) concentrations typically of wastewater, both nutrients can remain at concentrations and in biologically available forms that may stimulate phytoplankton growth in nutrient-deficient systems. This study examined the short-term effect of N plus P additions, at a range of concentrations, on phytoplankton growth and species composition in mesocosm experiments in a subtropical reservoir. Nitrate (NO(3)) plus orthophosphate (PO(4)) concentrations as low as 50 and 5 μg L(-1), respectively, resulted in significant increases in phytoplankton biomass, with a 3.99 μg L(-1) increase in chlorophyll a concentration with every 10 μg L(-1) increase in N plus 1 μg L(-1) in P. The system was likely to be co-limited because the addition of N or P alone did not result in increased chlorophyll a concentrations compared with the control. However, the toxic cyanobacterium, Cylindrospermopsis raciborskii, had higher growth rates with P addition alone. This study has shown that inputs of AWWT water have the potential to increase the phytoplankton biomass in this subtropical reservoir, at least in the short term. Therefore, the effect of AWWT water on water quality in reservoirs should be further investigated before widespread application occurs.
