59 Histone Deacetylase 1 Knock-down in Bovine Fibroblast Cells and Cloned Embryos

Reproduction, Fertility, and Development. Dec, 2011  |  Pubmed ID: 22394781

Histone deacetylase 1 (HDAC1) is one of the most conserved enzymes present in the nuclei of cells. It was thought to be the most important enzyme in the regulation of histone deacetylation process. However, the function of HDAC1 in bovine fibroblast cells and nuclear transfer embryos is not clear. In the present study, sh299 (5'GCAAGCAGATGCAGAGATTTCAAGA GAATCTCTGCATCTGCTTGCTT3') targeting of HDAC1 mRNA sequence was designed in the PGP/U6/GFP vector (short hairpin RNA, shRNA, expression vector). The sh299 vector was transfected into bovine fibroblast cells by transfection reagent FuGENE HD and the positive cells were identified by the expression of green fluorescent protein (GFP). Histone deacetylase 1 down-regulation in bovine fibroblast cells was measured by quantitative real-time PCR (qRT-PCR with the 2(-ΔΔCT) method) at 48h after sh299 vector transfection at mRNA level. Immunocytochemistry was performed at 96h after sh299 vector transfection to examine the HDAC1 protein level. Bovine fibroblast cells of the control group, negative control vector transfection group and sh299 vector transfection group were used as donor cells for nuclear transfer. Cleavage rates and expression of HDAC1 mRNA in bovine cloned embryos were examined at 48h after nuclear transfer. Blastocyst rates and total cell numbers of blastocysts were examined on Day 7 post-nuclear transfer. Data were analysed with Statistics Production for Service Solution (version 16.0; SPSS) by 1-way ANOVA. A value of P<0.05 was considered to be significantly different. Our results showed that the expression level of HDAC1 was significantly reduced by transfection of the sh299 expression vector. The GFP-positive cells showed decreased signal for HDAC1 by immunocytochemistry. It was suggested that the transfection of the sh299 expression vector reduced HDAC1 expression in bovine fibroblast cells at both mRNA level and protein level. Following nuclear transfer, expression of HDAC1 was significantly reduced in the sh299 vector transfection group (donor cells were transfected by the sh299 vector) compared to the other 2 groups. No significant difference (P>0.05) was seen in cleavage rates among bovine cloned embryos in the sh299 vector transfection group (52.3±3.4%), control group (51.1±5.4%) and negative control vector transfection group (56.2±3.1%). However, blastocyst rates and total cell numbers of blastocysts were significantly lower (P<0.05) in the sh299 vector transfection group (4.2±1.3% and 75.4±9.2, n=89) compared to the control group (18.2±3.7% and 97.6±7.3, n=78) and negative control vector transfection group (18.9±1.7% and 104.2±10.3, n=83). In conclusion, HDAC1 down-regulation in bovine fibroblast cells and cloned embryos by the sh299 expression vector indicated that HDAC1 was essential for the development of bovine cloned embryos.

185 Parthenogenetic Activation of Sika Deer (cervus Nippon Temminck) Oocytes with Chemicals

Reproduction, Fertility, and Development. Dec, 2011  |  Pubmed ID: 22394907

Parthenogenetic activation of the oocyte represents an important step in the somatic cell nuclear transfer. The aim of the present study was to establish optimizing conditions for parthenogenetic activation of Sika deer oocytes necessary for cloning Sika deer. Sika deer ovaries were collected from a slaughter house during oestrus season (October and November), placed into saline (25°C) supplemented with 1% (v/v) penicillin and streptomycin and transported into the laboratory within 4h. The small vesicular follicles (diameter, 2-5mm) on the ovarian surface were incised with a scalpel in a Petri dish containing PBS to release the cumulus-oocyte complexes (COC). Only COC with uniform cytoplasm and at least 3 layers of compact cumulus cells were cultured in vitro for 24h. The media of in vitro maturation (IVM) was TCM-199 supplemented with 10% fetal bovine serum, 10μgmL(-1) FSH, 1μgmL(-1) LH, 0.2mM cysteamine and 50ngmL(-1) epidermal growth factor. After IVM, the cumulus cells were denuded with 0.2% hyaluronidase in TCM-199 at 38.5°C by pipetting. The cumulus-free Sika deer oocytes were stimulated by 1 of the following treatments: 1) ethanol+6-DMAP, treated with 7% ethanol for 7min and 2mM 6-dimethylaminopurine (6-DMAP) in DSOF for 4h; or 2) ionomycin+6-DMAP, treated with 5μM ionomycin for 5min and 2mM 6-DMAP in DSOF for 4h. Then, oocytes were transferred into culture media for 7 days [Day 0 (D0)=activation]. On D3, embryos were transferred into fresh DSOF drops supplemented with 10% (v/v) fetal bovine serum. All cultures were overlaid with mineral oil and kept in a humidified modular incubation chamber gassed with 5% CO(2). Effects of these chemicals on oocyte activation were then examined and compared with the controls, in which oocytes were cultured in TCM-199 for 4h without chemical supplement. Our results showed that rates of cleavage, morula and blastocyst were 72.7, 43.9 and 32.4% (n=139), respectively, by treatment with ionomycin+6-DMAP. And rates of cleavage, morula and blastocyst were 61.1, 29.7 and 17.8% (n=134), respectively, by treatment with ethanol+6-DMAP. However, the rates of cleavage, morula and blastocyst were 5, 0 and 0% (n=101) in the control group. Meanwhile, the rates of oocyte cleavage (72.7% vs 61.1%), morula (43.9% vs 29.7%) and blastocyst (32.4% vs 17.8%) between 2 treatments of ionomycin+6-DMAP and ethanol+6-DMAP were significantly different (P<0.05). In conclusion, parthenogenetic activation of Sika deer oocytes with ionomycin+6-DMAP is more effective than that with ethanol+6-DMAP. These results have begun to elucidate parameters important for animal modeling and cloning with the Sika deer and should facilitate the development of genetically defined animal models in this species.

[Comparative Study on Pharmacokinetics of Six Major Alkaloids in Zuojin Wan Microemulsion Based Gel and Hydrogel]

Zhongguo Zhong Yao Za Zhi = Zhongguo Zhongyao Zazhi = China Journal of Chinese Materia Medica. Dec, 2011  |  Pubmed ID: 22393745

To compare the pharmcoknetic parameters of six major alkaloids in the two drug delivery system of Zuojin Wan, by LC-MS assaying the six major alkaloids plasma concentration.

Reduction of Ordering Temperature of Self-assembled FePt Nanoparticles by Addition of Au and Ag

Journal of Nanoscience and Nanotechnology. Dec, 2011  |  Pubmed ID: 22408945

The [FePt]94Au6 and [FePt]90Ag10 nanoparticle arrays were synthesized on Si substrates by a reverse micellar method, combined with plasma treatment and in-situ deposition of a SiO2 overlayer, and the post annealing step was performed to drive the face-centered cubic to tetragonal phase transition. These FePt nanoparticles exhibit a quasi-hexagonal order with tailored inter-particle spacing and particle size. The effects of the Ag and Au on the structural and magnetic properties of FePt were investigated. The results indicate that both Au and Ag additives can remarkably enhance the coercivity and reduce the ordering temperature, however, the optimum composition is different for them. The optimum composition is determined to be [FePt]94Au6 and [FePt]90Ag10, respectively, for which the ordering temperature of FePt nanoparticles is reduced by -100 degrees C. After 600 degrees C annealing, the [FePt]94Au6 and [FePt]90Ag10 nanoparticles are totally ferromagnetic with apparent larger coercivities of -7.0 kOe, which is about 3.8 kOe larger than that of the pure FePt nanoparticles. The mechanism of the chemical ordering acceleration may be attributed to the defects and strains caused by the Au/Ag additives.

Effect of Food Azo Dye Tartrazine on Learning and Memory Functions in Mice and Rats, and the Possible Mechanisms Involved

Journal of Food Science. Aug, 2011  |  Pubmed ID: 22417523

Tartrazine is an artificial azo dye commonly used in human food and pharmaceutical products. The present study was conducted to evaluate the toxic effect of tartrazine on the learning and memory functions in mice and rats. Animals were administered different doses of tartrazine for a period of 30 d and were evaluated by open-field test, step-through test, and Morris water maze test, respectively. Furthermore, the biomarkers of the oxidative stress and pathohistology were also measured to explore the possible mechanisms involved. The results indicated that tartrazine extract significantly enhanced active behavioral response to the open field, increased the escape latency in Morris water maze test and decreased the retention latency in step-through tests. The decline in the activities of catalase, glutathione peroxidase (GSH-Px), and superoxide dismutase (SOD) as well as a rise in the level of malonaldehyde (MDA) were observed in the brain of tartrazine-treated rats, and these changes were associated with the brain from oxidative damage. The dose levels of tartrazine in the present study produced a few adverse effects in learning and memory functions in animals. The mechanisms might be attributed to promoting lipid peroxidation products and reactive oxygen species, inhibiting endogenous antioxidant defense enzymes and the brain tissue damage. Practical Application:  Tartrazine is an artificial azo dye commonly used in human food and pharmaceutical products. Since the last assessment carried out by the Joint FAO/WHO Expert Committee on Food Additives in 1964, many new studies have been conducted. However, there is a little information about the effects on learning and memory performance. The present study was conducted to evaluate the toxic effect of tartrazine on the learning and memory functions in animals and its possible mechanism involved. Based on our results, we believe that more extensive assessment of food additives in current use is warranted.

Characterization of ACE-Inhibitory Peptide Associated with Antioxidant and Anticoagulation Properties

Journal of Food Science. Oct, 2011  |  Pubmed ID: 22417578

A bioactive peptide Arg-Val-Pro-Ser-Leu (RVPSL) obtained from egg white protein was characterized by LC-MS and further chemically synthesized by the Fmoc solid phase method and investigated in terms of its angiotensin converting enzyme (ACE)-inhibitory activity, antioxidant property, and anticoagulation activity, as well as its stability in a simulated gastrointestinal digestion. The peptide exhibited an ACE-inhibitory activity with an IC(50) value of 20 μM. Also, the peptide could efficiently quench the (1,1)-diphenyl-2-picrylhydrazyl free radicals and exhibit high anticoagulation activity with a complete inhibition at 100 mM. Moreover, the peptide has a good stability against protease digestion. These results suggest that the peptide RVPSL may have potential to be used in nutraceuticals and functional food. Practical Application:  The present research revealed a novel multifunctional peptide hydrolyzed from egg white protein. The peptide RVPSL was not only able to block the amplification of the coagulation cascade, but also able to inhibit ACE activity.

Regulation of Soy Isoflavones on Weight Gain and Fat Percentage: Evaluation in a Chinese Guangxi Minipig Model

Animal : an International Journal of Animal Bioscience. Dec, 2011  |  Pubmed ID: 22440466

This study was conducted to determine the effects of soy isoflavones on changes in body and tissue weight and on insulin-like factor I (IGF-I) and peroxisome proliferator-activated receptor-γ (PPARγ) gene and protein expression in muscle and adipose tissues in Chinese Guangxi minipig, as a model for studying human nutrition. A total of 72 male Chinese Guangxi minipigs were fed basal diet (control, Con), low dose of soy isoflavones and high dose of soy isoflavones (HSI). The results showed that HSI increased the body weight (BW) gain and fat percentage of minipigs (P < 0.05). In addition, the serum concentrations of IGF-I and interleukin-6 were increased by high levels of soy isoflavones (P < 0.05). Furthermore, a diet containing soy isoflavones enhanced IGF-I mRNA expression levels in longissimus muscle, but decreased these levels in perirenal fat. However, the mRNA and protein expression levels of PPARγ in longissimus muscle and subcutaneous adipose tissue were both increased when compared with the Con. The data indicated that soy isoflavones regulated the BW gain and fat percentage of Chinese Guangxi minipigs, which also showed changes in IGF-I system and PPARγ. However, further research is required to clarify the causative relationship.

Electroluminescence of Zinc Selenium (ZnSe) Nanocrystals Co-doped with Poly[2-methoxy-5-(2'-ethylhexyloxy-p-phenylenevinylene)] (MEH-PPV)

Journal of Nanoscience and Nanotechnology. Nov, 2011  |  Pubmed ID: 22413223

We have synthesized water soluble zinc selenium (ZnSe) nanocrystals by using mercaotoacetic acid (TGA) as the stabilizer. The synthesized ZnSe nanocrystals were co-doped with poly[2-methoxy-5-(2'-ethylhexyloxy-p-phenylenevinylene)] (MEH-PPV) to fabricate an organic/ inorganic hybrid multilayer light-emitting device (LED). The structure of the device was indium-tin-oxide (ITO)/poly (ethylene-dioxythiophene):poly(styrenesul-fonate) (PEDOT:PSS)/MEH-PPV:ZnSe/bathocuproine (BCP)/tris-(8-hydroxylquinoline)-aluminum (Alq3)/Al. We demonstrate that the device has a lower driving voltage and increased current densities and power efficiencies owing to the co-doped ZnSe quantum dots. We obtained good efficiency of the devices when the quality ratio of MEH-PPV and ZnSe quantum dots was 1:1.

Broadband Downconversion in Bi3+, Yb3+-Co-doped YVO4 Phosphor

Journal of Nanoscience and Nanotechnology. Nov, 2011  |  Pubmed ID: 22413233

Yttrium vanadate phosphors co-doped with Bi3+ and Yb3+ ions have been prepared via the solid-state reaction. The phosphors were characterized by various methods including X-ray diffraction, photoluminescence excitation and photoluminescence spectra. Upon ultraviolet (UV) light excitation, an intense near-infrared (NIR) emission of Yb3+ corresponding to the transition of 2F(5/2) --> 2F(7/2) peaking at 985 nm was observed as a result of energy transfer from O2(-)-V5+ or Bi3+-V5+ charge transfer state (CTS) to Yb3+. A broad excitation band ranging from 250 to 375 nm was recorded when the Yb3+ emission was monitored, which suggests an efficient energy transfer from CTS to Yb3+ ions. The dependence of Yb3+ doping concentration on the visible emission, the NIR emission and decay lifetime has been investigated. The results of visible and NIR spectral evolution with temperature indicate that the mechanism for the NIR-emission is mainly phonon-assisted energy transfer at room temperature, while the mechanism is mainly cooperative energy transfer at low temperature. The YVO4:Bi3+, Yb3+ phosphor has prospects for realizing high efficiency crystalline Si solar cells by converting broadband UV energy into NIR light.

Near Infrared Quantum Cutting in Yb3+-doped NaY(WO4)2 Phosphor with a High Quenching Concentration

Journal of Nanoscience and Nanotechnology. Nov, 2011  |  Pubmed ID: 22413234

The near infrared quantum cutting phenomenon has been demonstrated in Yb3+-doped NaY(WO4)2 phosphor. The phosphor shows intense absorptions in the range of 250-330 nm, and intense near infrared emission is obtained via cooperative energy transfer from the host to Yb3+, which involves the emission of two near infrared photons around 1000 nm from an absorbed ultraviolet photon. Decay curves of the host emission around 480 nm have been measured, and the calculated energy transfer efficiency turns out to be as high as 81.6% at 40 mol% Yb3+ doping. Besides, infrared emission intensities increase with increasing Yb3+ concentration until the doping gets larger than 40 mol%. The excellent luminescence properties of the Yb3+-doped NaY(WO4)2 phosphor demonstrate its potential application as a better quantum cutting layer to enhance the energy efficiency of solar cells.

CaMoO4:x%Yb3+: a Novel Near-infrared Quantum-cutting Phosphors Via Cooperative Energy Transfer

Journal of Nanoscience and Nanotechnology. Nov, 2011  |  Pubmed ID: 22413244

An efficient near-infrared (NIR) dowmconversion (DC) has been demonstrated in the CaMoO4:Yb3+ phosphors. Very strong NIR emission around 998 nm from the 2F(7/2) --> 2F(5/2) transition of the Yb3+ has been observed under ultraviolet excitation. A similar broad excitation band due to the absorption of the host CaMoO4 has been recorded when the NIR emission of Yb3+ and the visible molybdate (MoO4(-2)) emission are monitored, which suggests an efficient energy transfer (ET) from the host to the Yb3+. The Yb3+ concentration-dependent luminescence properties and lifetimes of both the visible and NIR emissions have also been studied. The lifetime of the molybdate emission decreases rapidly with the increasing Yb3+ concentration, further verifying the efficient ET from the host to the Yb3+. Moreover, the low temperature measurements have also been carried out to investigate the ET mechanism in the phosphors. A cooperative energy transfer (CET) mechanism has been proposed to rationalize the DC effect. The newly studied CaMoO4:Yb3+ DC phosphors, which can convert the broadband emission of the MoO4(2-) into NIR emission of Yb3+ with a twofold increase in the photon number will have potential application in greatly enhancing the response of silicon-based solar cells with a relatively higher Yb3+ quenching concentration.

Ab Initio Calculation of Electronic Structure and 4f-5d Transition Energies of Ce3+ Doped in Y3Al5O12 Nanocrystals

Journal of Nanoscience and Nanotechnology. Nov, 2011  |  Pubmed ID: 22413245

The elementary-state electronic structure and 4f-5d transitions of Y3Al5O12:Ce3+ nanocrystals simulated by several clusters were computed by the ab initio self-consistent relativistic DV-X alpha (discrete variational X alpha) method. A 35-ion cluster was chosen to simulate the local surroundings of Ce3+ doped in Y3Al5O12 bulk crystals while four additional smaller irregular clusters were also chosen to simulate the local surroundings of Ce3+ ions in nanocrystals. Besides obtaining the elementary-state 4f and 5d electronic structure, based on the transition-state calculations we also obtained the five 4f-5d transition energies for each of these clusters. We found that compared with the bulk crystals, for all the clusters simulating nanocrystals the first 4f-5d transition peak (the lowest energy peak) was blueshifted, and the second peak was redshifted a little, which are both in accordance with the observed experimental excitation spectra of 5d luminescence of Y3Al5O12:Ce3+. We fitted the observed first two transition peaks in a published experimental excitation spectrum of nanocrystals by weighted summing of the excitation spectra of the selected clusters; therefore, the weight contribution of each cluster was obtained. Moreover, the other three unobserved peaks were all expected to be redshifted. According to these calculations and our understanding, in Y3Al5O12:Ce3+ nanocrystals, the shift of the peaks can be mainly attributed to the reduction of the crystal field felt by Ce3+ ions-which results in the reduction of the splittings of 5d levels of Ce3--as well as to the increase of the difference between the 5d average level and the 4f average level of Ce3+.

Energy Transfer Mechanisms in Yb3+-doped GdVO4 Near-infrared Downconversion Nanophosphor

Journal of Nanoscience and Nanotechnology. Nov, 2011  |  Pubmed ID: 22413246

Yb3+-doped GdVO4 nanophosphor was prepared by the co-precipitation method. Under ultraviolet (UV) light excitation, strong near-infrared (NIR) emission of Yb3+ (2F(5/2) --> 2F(7/2)) around 980 nm was observed. Owing to the host absorption of GdVO4, a broad excitation band ranging from 250 to 350 nm was recorded when the Yb3+ emission was monitored, which suggests an efficient energy transfer from the host to the Yb3+ ions. The concentration dependence of the visible vanadate emission and the Yb3+ emission was investigated. The decay curve of the vanadate emission was measured under the excitation of a 266 nm pulsed laser. The decay time of the vanadate emission at 500 nm was remarkably reduced by introducing Yb3+, further verifying that the energy transfer from the vanadate host to the Yb3+ ions was very efficient. Cooperative energy transfer (CET) is discussed as the possible energy transfer process. The temperature dependence of the emission intensity and decay time were also investigated for our further discussion.

Shape Controlled Synthesis and Photoluminescence Properties of Eu3+-doped REVO4 Nanophosphors

Journal of Nanoscience and Nanotechnology. Nov, 2011  |  Pubmed ID: 22413271

Eu3+-doped REVO4 nanphosphors were controllably synthesized by an EDTA-mediated hydrothermal method at 180 degrees C using RE(NO3)3 and Na3VO4 as precursors. The obtained products were characterized by X-ray powder diffraction (XRD), scanning electron microscopy (SEM), Fourier transform infrared spectrometry (FTIR), X-ray photoelectron spectra (XPS), and photoluminescence spectroscopy (PL). The XRD results showed that the products were pure tetragonal structure and no other impurity phase appeared. The PL studies demonstrated Eu3+ ions doping effectively enhanced luminescent properties of LaxRE(1-x)VO4 and YxRE(1-x)VO4 nanoparticles, but EU3+ ions doping did not enhance luminescent properties of CexRE(1-x)VO4 (x not equal 0) nanoparticles. The prepared phosphors showed well-defined red luminescence due to radiative transitions from 5D0 to 7F(J) (J = 1,2) levels of Eu3+ ions, respectively. Furthermore, we reported Eu3+-doped CexRE(1-x)VO4 (x not equal 0) phases represented a new class of optically inactive materials.

Surface Enhanced Fluorescence of Rh6G with Gold Nanohole Arrays

Journal of Nanoscience and Nanotechnology. Nov, 2011  |  Pubmed ID: 22413298

Five gold nanohole arrays with distinct aperture size were fabricated by magnetron sputtering technique. Fluorescence enhancements of Rh6G fluorophore in the close vicinity of gold nanohole arrays were observed. Up to 40 times increase of fluorescence intensity was obtained from gold nanohole arrays as compared with a smooth gold surface control sample. A double-peak curve was presented in the excitation spectrum of enhanced fluorescence emission when the excitation wavelength was scanning from 300 nm to 550 nm. It was found that smaller aperture size and proper excitation wavelength matching with the surface plasmon resonances condition were favorable for a better fluorescence enhancement.

Photoluminescence of CaxSr(1-x) (NbO3)2:Pr3+ (0 < or = X < or = 1) Nanophosphors

Journal of Nanoscience and Nanotechnology. Nov, 2011  |  Pubmed ID: 22413322

Nanoparticles of CaxSr(1-x) (NbO3)2 doped with Pr3+ have been synthesized by sol-gel method. Particles have sizes in the range of 50-70 nm. The CaxSr(1-x) (NbO3)2:Pr3+ phosphors showed a white emission under the near-ultraviolet excitation (254 nm). There is a large photoluminescence enhancement of the CaxSr(1-x) (NbO3)2:Pr3+ phosphor samples when added with 0.5% KCl. X-ray diffraction (XRD), transmission electron microscope (TEM), photo luminescent (PL) analysis were utilized to characterize the CaxSr(1-x) (NbO3)2:Pr+ particles. The concentration quenching of the samples was discussed as well. The optical concentration and the calcination temperature were 0.8 mol% of Ca2+ and 900 degrees C for these phosphors, respectively, the possible mechanism was discussed. CaxSr(1-x) (NbO3)2:Pr3+ is a promising white phosphor under near-ultraviolet excitation for various applications.

Insufficient Maintenance DNA Methylation is Associated with Abnormal Embryonic Development

BMC Medicine. Mar, 2012  |  Pubmed ID: 22413869

ABSTRACT: BACKGROUND: Early pregnancy loss (EPL) is a frustrating clinical problem, whose mechanisms are not completely understood. DNA methylation, which includes maintenance methylation and de novo methylation directed by DNA methyltransferases (DNMTs), is important for embryo development. Abnormal function of these DNMTs may have serious consequences for embryonic development. METHODS: To evaluate the possible involvement of DNA methylation in human EPL, the expression of DNMT proteins and global methylation of DNA were assessed in villous or decidua from EPL patients. The association of maintenance methylation with embryo implantation and development was also examined. RESULTS: We found that DNMT1 and DNMT3A were both expressed in normal human villous and decidua. DNMT1 expression and DNA global methylation levels were significantly down-regulated in villous of EPL. DNMT3A expression was not significantly changed in the EPL group compared to controls in either villous or decidua. We also found that disturbance of maintenance methylation with a DNMT1 inhibitor may result in a decreased global DNA methylation level and impaired embryonic development in the mouse model, and inhibit in vitro embryo attachment to endometrial cells. CONCLUSIONS: Our results demonstrate that defects in DNA maintenance methylation in the embryo, not in the mother, are associated with abnormal embryonic implantation and development. The findings of the current study provide new insights into the etiology of EPL.

KCNQ1 Gene Polymorphisms Are Associated with Repaglinide Therapeutic Efficacy in Chinese Type 2 Diabetes Patients

Clinical and Experimental Pharmacology & Physiology. Mar, 2012  |  Pubmed ID: 22414228

This study evaluated effects of KCNQ1 rs2237892 and rs2237895 polymorphisms on repaglinide efficacy in Chinese T2DM patients. 367 T2DM patients and 214 controls were genotyped. 40 T2DM patients were randomly selected and underwent an 8-week repaglinide treatment. rs2237892 allelic frequency in T2DM patients group were lower than that in the controls (P<0.05 and P<0.01). rs2237895 C allelic frequency was higher than that in healthy control subjects (P<0.05). Patients carrying rs2237892 risk C allele had lower FINS (mU/l) (P<0.01) and HOMA-IR (P<0.01) values. Individuals with rs2237895 risk C allele had higher FPG (P<0.01), PPG levels (P<0.01) and HOMA-IR values (P<0.01). T2DM patients with rs2237892 T allele and rs2237895 C allele are more likely to have a positive response to repaglinide on PPG levels and PPG levels (P<0.05 and P<0.05, respectively) than rs2237892 CC genotype and rs2237895 AA genotype individuals. KCNQ1 rs2237892 and rs2237895 polymorphisms were associated with repaglinide therapeutic efficacy in Chinese T2DM patients.

Aberrant Activation of Liver X Receptors Impairs Pancreatic Beta Cell Function Through Upregulation of Sterol Regulatory Element-binding Protein 1c in Mouse Islets and Rodent Cell Lines

Diabetologia. Mar, 2012  |  Pubmed ID: 22415588

AIMS/HYPOTHESIS: Liver X receptors (LXR) are important transcriptional regulators of lipid and glucose metabolism. Our previous report demonstrated that LXR activation inhibited pancreatic beta cell proliferation through cell cycle arrest. Here we explore the role of LXR activation in beta cell insulin secretion and the underlying mechanism that might be involved. METHODS: Mouse pancreatic islets or insulin-secreting MIN6 cells were exposed to the LXR agonist, T0901317, and insulin secretion, glucose and fatty acid oxidation, and lipogenic gene expression were assessed. The unsaturated fatty acid eicosapentaenoic acid and the dominant negative sterol regulatory element binding protein 1c (SREBP1c) were used to inhibit endogenous SREBP1c and evaluate the involvement of SREBP1c in beta cell dysfunction induced by LXR activation. RESULTS: Treatment with the LXR agonist decreased beta cell glucose sensitivity and impaired glucose-stimulated insulin secretion in vivo and in vitro. This was accompanied by derangements of beta cell glucose oxygen consumption, glucose oxidation, ATP production and intracellular voltage-gated calcium channel flux. LXR activation also regulated the expression of lipid metabolism-related genes such as Fas, Acc (also known as Acaca) and Cpt1a, and led to intracellular lipid accumulation. Further studies revealed that inhibition of SREBP1c abolished LXR activation-induced lipid accumulation and improved beta cell glucose metabolism, ATP production and insulin secretion. CONCLUSIONS/INTERPRETATION: Our data reveal that aberrant activation of LXR reproduced the phenomenon of beta cell dysfunction in the development of type 2 diabetes in vitro and in vivo. Upregulation of SREBP1c production and the lipotoxicity mediated by it played a central role in this process.

Supported Pd-Cu Bimetallic Nanoparticles That Have High Activity for the Electrochemical Oxidation of Methanol

Chemistry (Weinheim an Der Bergstrasse, Germany). Mar, 2012  |  Pubmed ID: 22415817

Monodisperse bimetallic Pd-Cu nanoparticles with controllable size and composition were synthesized by a one-step multiphase ethylene glycol (EG) method. Adjusting the stoichiometric ratio of the Pd and Cu precursors afforded nanoparticles with different compositions, such as Pd(85) -Cu(15) , Pd(56) -Cu(44) , and Pd(39) -Cu(61) . The nanoparticles were separated from the solution mixture by extraction with non-polar solvents, such as n-hexane. Monodisperse bimetallic Pd-Cu nanoparticles with narrow size-distribution were obtained without the need for a size-selection process. Capping ligands that were bound to the surface of the particles were removed through heat treatment when the as-prepared nanoparticles were loaded onto a Vulcan XC-72 carbon support. Supported bimetallic Pd-Cu nanoparticles showed enhanced electrocatalytic activity towards methanol oxidation compared with supported Pd nanoparticles that were fabricated according to the same EG method. For a bimetallic Pd-Cu catalyst that contained 15 % Cu, the activity was even comparable to the state-of-the-art commercially available Pt/C catalysts. A STEM-HAADF study indicated that the formation of random solid-solution alloy structures in the bimetallic Pd(85) -Cu(15) /C catalysts played a key role in improving the electrochemical activity.

Structural Insights into a Unique Legionella Pneumophila Effector LidA Recognizing Both GDP and GTP Bound Rab1 in Their Active State

PLoS Pathogens. Mar, 2012  |  Pubmed ID: 22416225

The intracellular pathogen Legionella pneumophila hijacks the endoplasmic reticulum (ER)-derived vesicles to create an organelle designated Legionella-containing vacuole (LCV) required for bacterial replication. Maturation of the LCV involved acquisition of Rab1, which is mediated by the bacterial effector protein SidM/DrrA. SidM/DrrA is a bifunctional enzyme having the activity of both Rab1-specific GDP dissociation inhibitor (GDI) displacement factor (GDF) and guanine nucleotide exchange factor (GEF). LidA, another Rab1-interacting bacterial effector protein, was reported to promote SidM/DrrA-mediated recruitment of Rab1 to the LCV as well. Here we report the crystal structures of LidA complexes with GDP- and GTP-bound Rab1 respectively. Structural comparison revealed that GDP-Rab1 bound by LidA exhibits an active and nearly identical conformation with that of GTP-Rab1, suggesting that LidA can disrupt the switch function of Rab1 and render it persistently active. As with GTP, LidA maintains GDP-Rab1 in the active conformation through interaction with its two conserved switch regions. Consistent with the structural observations, biochemical assays showed that LidA binds to GDP- and GTP-Rab1 equally well with an affinity approximately 7.5 nM. We propose that the tight interaction with Rab1 allows LidA to facilitate SidM/DrrA-catalyzed release of Rab1 from GDIs. Taken together, our results support a unique mechanism by which a bacterial effector protein regulates Rab1 recycling.

[Prokaryotic Expression and Identification of HPV16 E7 Protein]

Bing Du Xue Bao = Chinese Journal of Virology / [bian Ji, Bing Du Xue Bao Bian Ji Wei Yuan Hui]. Jan, 2012  |  Pubmed ID: 22416350

HPV16 E7 fusion protein was expressed in E. coli BL21, and its applied value for HPV was evaluated. HPV16 E7 gene was amplified by PCR, and cloned into prokaryotic expression vector pGEX6p-1. The recombinant plasmid was transformed into E. coli BL21, and HPV16 E7 fusion was expressed through IPTG induction. The expressed product was analyzed by SDS-PAGE and Western blot, subsequently purified according to Glutathione Sepharose 4B purification procedure. An indirect ELISA with the purified fusion protein as the coating antigen was then established to detect E7 serum antibodies from mice immunized with recombinant Listeria monocytogenes delivering HPV16 E7. The results demonstrated that the soluble fusion protein was highly expressed at 25 degrees C after induction with 0.5 mM IPTG. Furthermore, the result of Western blot analysis showed that the fusion protein had good specific reaction with an anti-E7 monoclonal antibody. Indirect ELISA result confirmed that the fusion protein could detect the serum antibodies against E7 with a titer of 1:200. The expressed GST-E7 fusion protein was immunocompetent, which was useful in the research of E7 biological function and therapeutic vaccine.

Collective Mechanical Behavior of Multilayer Colloidal Arrays of Hollow Nanoparticles

Langmuir : the ACS Journal of Surfaces and Colloids. Mar, 2012  |  Pubmed ID: 22416999

The collective mechanical behavior of multilayer colloidal arrays of hollow silica nanoparticles (HSNP) is explored under spherical nanoindentation through a combination of experimental, numerical, and theoretical approaches. The effective indentation modulus E(ind) is found to decrease with an increasing number of layers in a nonlinear manner. The indentation force versus penetration depth behavior for multilayer hollow particle arrays is predicted by an approximate analytical model based on the spring stiffness of the individual particles and the multipoint, multiparticle interactions as well as force transmission between the layers. The model is in good agreement with experiments and with detailed finite element simulations. The ability to tune the effective indentation modulus, E(ind), of the multilayer arrays by manipulating particle geometry and layering is revealed through the model, where E(ind) = (0.725m(-3/2) + 0.275)E(mon) and E(mon) is the monolayer modulus and m is number of layers. E(ind) is seen to plateau with increasing m to E(ind_plateau) = 0.275E(mon) and E(mon) scales with (t/R)(2), t being the particle shell thickness and R being the particle radius. The scaling law governing the nonlinear decrease in indentation modulus with an increase in layer number (E(ind) scaling with m(-3/2)) is found to be similar to that governing the indentation modulus of thin solid films E(ind_solid) on a stiff substrate (where E(ind_solid) scales with h(-1.4) and also decreases until reaching a plateau value) which also decreases with an increase in film thickness h. However, the mechanisms underlying this trend for the colloidal array are clearly different, where discrete particle-to-particle interactions govern the colloidal array behavior in contrast to the substrate constraint on deformation, which governs the thickness dependence of the continuous thin film indentation modulus.

Trace Determination of 13 Haloacetamides in Drinking Water Using Liquid Chromatography Triple Quadrupole Mass Spectrometry with Atmospheric Pressure Chemical Ionization

Journal of Chromatography. A. Mar, 2012  |  Pubmed ID: 22440663

The haloacetamides (HAcAms) are disinfection by-products (DBPs) in drinking water which are currently receiving increased scientific attention due to their elevated toxicity relative to regulated disinfection by-products. A simultaneous determination method of 13 HAcAms, combining solid-phase extraction (SPE) enrichment, liquid chromatographic (LC) separation, and triple quadrupole mass spectrometry (tqMS) detection with atmospheric pressure chemical ionization (APCI) using selective reaction monitoring in positive mode, was developed to measure HAcAms, including chlorinated, brominated, and iodinated analogs. Ammonium chloride and Oasis HLB were selected as the dechlorinating reagent and polymeric SPE sorbent of HAcAm samples. The used tqMS apparatus showed higher sensitivity for the studied HAcAms in the APCI mode than electrospray ionization. 13 HAcAms were separated by LC in 9.0min, and the detection limits ranged from 7.6 to 19.7ng/L. The SPE-LC/tqMS method was successfully applied to quantify 13 HAcAms in drinking water samples for the first time, and first indentified tribromoacetamide and chloroiodoacetamide as DBPs in drinking water.

Generation of Photorealistic 3D Image Using Optical Digitizer

Applied Optics. Mar, 2012  |  Pubmed ID: 22441476

A technique to generate a photorealistic three-dimensional (3D) image and color-textured model using a dedicated optical digitizer is presented. The proposed technique is started with the range and texture image acquisition from different viewpoints, followed by the registration and integration of multiple range images to get a complete and nonredundant point cloud that represents a real-life object. The accuracy of the range image and the precision of correspondence between the range image and texture image are guaranteed by sensor system calibration. Based on the point cloud, a geometric model is established by considering the connectivity of adjacent range image points. In order to enhance the photorealistic effect, we suggest a texture blending technique that utilizes a composite-weight strategy to blend the texture images within the overlapped region. This technique allows more efficient removal of the artifacts existing in the registered texture image, leading to a 3D image with photorealistic quality and color-texture modeling. Experimental results are also presented to testify to the validity of the proposed method.

An Ultrasensitive Electrochemical DNA Sensor Based on the SsDNA-assisted Cascade of Hybridization Reaction

Chemical Communications (Cambridge, England). Mar, 2012  |  Pubmed ID: 22441694

We have developed a simple and ultrasensitive E-DNA sensor based on the ssDNA-assisted cascade of a hybridization reaction mechanism to form a long concatamers structure to improve its sensitivity, significantly. The proposed sensor was applied to sequence-specific DNA and ATP detection. Experimental results showed a quantitative measurement with the detection limit as low as 1 aM for specific DNA and 10 fM for ATP.

Dietary L-arginine Supplementation Alleviates Liver Injury Caused by Escherichia Coli LPS in Weaned Pigs

Innate Immunity. Mar, 2012  |  Pubmed ID: 22441699

This study was conducted to evaluate whether dietary supplementation with L-arginine (Arg) could attenuate Escherichia coli LPS-induced liver injury through the TLR4 signaling pathway in weaned pigs. Eighteen weaned pigs were allotted to three treatments: non-challenged control, LPS challenged control and LPS + 0.5% Arg. On d 18, pigs were injected with LPS at 100 µg/kg of body weight (BW) or sterile saline. Blood samples were obtained at 4 h post-injection. Pigs were then sacrificed for the collection of liver samples. Arg supplementation (0.5%) alleviated liver morphological impairment, including hepatocyte caryolysis, karyopycnosis and fibroblast proliferation induced by LPS challenge; it mitigated the increase of serum aspartate aminotransferase and alkaline phosphatase activities induced by LPS (P < 0.05); it prevented the increase of hepatic TNF-α, malondialdehyde contents and mast cell number induced by LPS administration (P < 0.05); and it attenuated the elevation of hepatic NF-κB and TLR4-positive cell percentages (P < 0.05). These results indicate that Arg supplementation has beneficial effects in attenuating hepatic morphological and functional injury induced by LPS challenge in piglets. Additionally, it is possible that the protective effects of Arg on the liver are associated with a decreased release of liver pro-inflammatory cytokines and free radicals through inhibiting TLR4 signaling.

MiR-128 Inhibits Tumor Growth and Angiogenesis by Targeting P70S6K1

PloS One. 2012  |  Pubmed ID: 22442669

MicroRNAs are a class of small noncoding RNAs that function as critical gene regulators through targeting mRNAs for translational repression or degradation. In this study, we showed that miR-128 expression levels were decreased in glioma, and identified p70S6K1 as a novel direct target of miR-128. Overexpression of miR-128 suppressed p70S6K1 and its downstream signaling molecules such as HIF-1 and VEGF expression, and attenuated cell proliferation, tumor growth and angiogenesis. Forced expression of p70S6K1 can partly rescue the inhibitory effect of miR-128 in the cells. Taken together, these findings will shed light to the role and mechanism of miR-128 in regulating glioma tumor angiogenesis via miR-128/p70S6K1 axis, and miR-128 may serve as a potential therapeutic target in glioma in the future.

[Relationship of Plasma Ghrelin, IGF-1 and Insulin with the Growth and Development of 2 -7 Year-old Children with Small for Gestational Age at Birth]

Wei Sheng Yan Jiu = Journal of Hygiene Research. Jan, 2012  |  Pubmed ID: 22443052

To explore the relationship of Ghrelin, insulin-like growth factor-1 (IGF-1) and insulin with the growth and development of 2 -7 year-old children with small for gestational age (SGA) at birth.

[Effects of Organic Selenium Supplement on Glutathione Peroxidase Activities: a Meta-analysis of Randomized Controlled Trials]

Wei Sheng Yan Jiu = Journal of Hygiene Research. Jan, 2012  |  Pubmed ID: 22443071

To study the effects of organic selenium supplementation on glutathione peroxidase (GPx) activities.

[Advances on Studies Related to the Requirement of Vitamin A for Infants, Young and Preschool Children]

Wei Sheng Yan Jiu = Journal of Hygiene Research. Jan, 2012  |  Pubmed ID: 22443072

There are many factors that could affect the requirement of vitamin A including infections, parasites, protein-energy malnutrition, bioconversion efficiency of provitamin A, food matrix and so on. However, the toxicity of vitamin A should also be taken into account when establishing reference values for infants, young and preschool children. Serum and breast-milk retinol concentrations, retinol binding protein concentrations, the relative-dose-response test , the modified-relative-dose-response and the deuterated retinol isotope dilution test are the common tools to assess vitamin A status.

Morphology-Controlled Synthesis of W(18)O(49) Nanostructures and Their Near-Infrared Absorption Properties

Inorganic Chemistry. Mar, 2012  |  Pubmed ID: 22443484

The morphology-controlled synthesis and near-infrared (NIR) absorption properties of W(18)O(49) were systematically investigated for the application of innovative energy-saving windows. Various morphologies of W(18)O(49), such as nanorods, nanofibers, nanograins, nanoassembles, nanoplates, and nanoparticles, with various sizes were successfully synthesized by solvothermal reactions using organic alcohols as reaction media and WCl(6), W(EtO)(6), and WO(3) solids as the tungsten source. W(18)O(49) nanorods of less than 50 nm in length showed the best optical performance as an effective solar filter, which realized high transmittance in the visible region as well as excellent shielding properties of NIR light. Meanwhile, the W(18)O(49) nanorods also exhibited strong absorption of NIR light and instantaneous conversion of the absorbed photoenergy to the local heat.

Perivascular and Perineural Extension of Formed and Soluble Blood Elements in an Intracerebral Hemorrhage Rat Model

Brain Research. Mar, 2012  |  Pubmed ID: 22444275

The perivascular and perineural extension of hematoma has recently been observed in the brain after intracerebral hemorrhage (ICH), which is formed by the leakage of hematoma via the Virchow-Robin spaces (VRS) and the spaces around the nerve fibers (perineurium). The present study investigated the perivascular and perineural extension of a hematoma by studying the distribution of the formed and soluble blood elements labeled with different fluorescein dyes at different times after ICH in a rat model. The ICH rat model was prepared using a modified double injection method. Autologous blood, which contained fluorescein isothiocyanate (FITC)-labeled RBCs or carboxytetramethylrhodamine (TAMRA)-labeled BSA, was injected into the center of the left caudate nucleus. Brain sections were prepared and observed by overlaying fluorescence and hematoxylin and eosin stained images. The formed blood elements extended mainly into the VRS and perineurium in the perihematomal tissue and ipsilateral brain regions near the hematoma. The soluble blood elements extended more extensively to almost all regions of the brain, including some remote brain areas, such as the contralateral cerebral hemisphere and brainstem. Moreover, the fluorescein dyes were observed in lymph sinuses in the bilateral deep cervical lymph nodes as early as 1 hour after ICH. Lymphostasis, which peaked three days after ICH, was observed in the brain tissues around hematoma. The current findings suggest that the perivascular and perineural extension of hematomas widespread distributes in the central nervous system, and is involved in a series of pathologic processes in ICH, such as the remote effects of a hematoma and lymphatic encephalopathy.

Development of a Fully Automated On-line Solid Phase Extraction and High-performance Liquid Chromatography with Diode Array Detection Method for the Pharmacokinetic Evaluation of Bavachinin: A Study on Absolute Bioavailability and Dose Proportionality

Journal of Chromatography. B, Analytical Technologies in the Biomedical and Life Sciences. Feb, 2012  |  Pubmed ID: 22444438

A fully automated on-line solid-phase extraction (SPE) and high-performance liquid chromatography (HPLC) with diode array detection (DAD) method was developed for determination of bavachinin in mouse plasma. Analytical process was performed on two reversed-phase columns (SPE cartridge and analytical column) connected via a Valco 6-port switching valve. Plasma samples (10μL) were injected directly onto a C18 SPE cartridge (MF Ph-1 C18, 10mm×4mm, 5μm) and the biological matrix was washed out for 2min with the loading solvent (5mM NaH(2)PO(4) buffer, pH 3.5) at a flow rate of 1mL/min. By rotation of the switching valve, bavachinin was eluted from the SPE cartridge in the back-flush mode and transferred to the analytical column (Venusil MP C18, 4.6mm×150mm, 5μm) by the chromatographic mobile phase consisted of acetonitrile-5mM NaH(2)PO(4) buffer 65/35 (v/v, pH 3.5) at a flow rate of 1mL/min. The complete cycle of the on-line SPE purification and chromatographic separation of the analyte was 13min with UV detection performed at 236nm. Calibration curve with good linearity (r=0.9997) was obtained in the range of 20-4000ng/mL in mouse plasma. The intra-day and inter-day precisions (RSD) of bavachinin were in the range of 0.20-2.32% and the accuracies were between 98.47% and 102.95%. The lower limit of quantification (LLOQ) of the assay was 20ng/mL. In conclusion, the established automated on-line SPE-HPLC-DAD method demonstrated good performance in terms of linearity, specificity, detection and quantification limits, precision and accuracy, and was successfully utilized to quantify bavachinin in mouse plasma to support the pharmacokinetic (PK) studies. The PK properties of bavachinin were characterized as rapid oral absorption, high clearance, and poor absolute bioavailability.

Chemiluminescence Enzyme Immunoassay Using Magnetic Nanoparticles for Detection of Neuron Specific Enolase in Human Serum

Analytica Chimica Acta. Apr, 2012  |  Pubmed ID: 22444542

To detect a biomarker for small cell lung carcinoma, neuron specific enolase (NSE), a sensitive and specific chemiluminescence enzyme immunoassay was developed. Fluorescein isothiocyanate (FITC) labeled NSE capture antibody connected with NSE and alkaline phosphatase (ALP) labeled NSE detection antibody in a sandwich-type detection manner. This immune complex was further reacted with anti-FITC coated magnetic beads. In a magnetic field, the complex was enriched, and the sensitivity was thus enhanced. The limit of detection (LOD) of this method was <0.2ngmL(-1). The proposed immunoassay was highly selective, and not interfered by hook effect. The recovery was >83.0% and the coefficient of variation was <10.0%. Human sera from 120 patients were tested with the presented and traditional chemiluminescence enzyme immunoassay. An excellent linear relationship was obtained between two techniques. Overall, this immunoassay offers a promising alternative for NSE detection than traditional clinical examinations.

Using Molecular Docking Between Organic Chemicals and Lipid Membrane to Revise the Well Known Octanol-water Partition Coefficient of the Mixture

Environmental Toxicology and Pharmacology. Mar, 2012  |  Pubmed ID: 22445871

The octanol-water partition coefficient of a mixture has been widely used to predict the baseline toxicity of non-polar narcotic chemical mixtures, since toxic effects are usually generated by multiple mixtures. However, it remains unclear whether the validity of logKowmix can be demonstrated, because experimental methods cannot be used to determine this parameter. The invalidity and the further revision of logKowmix were therefore studied by using molecular docking between non-polar narcotic chemicals and lipid membrane (E(binding)). The results show E(binding) is a feasible substitute parameter for logKow because their relationship is linear. Based on a molecular docking and QSAR model, a new calculated method of logKowmix was proposed as follows: log(Kowmix)=∑x(i)logKowi. Comparison of this new method with the established methods demonstrates the invalidity of the latter, and therefore the former is suggested to be used to calculate the logKowmix of organic chemical mixtures.

[Short-term Spontaneous Fluctuation of Viral Load in Patients with Chronic Hepatitis B]

Nan Fang Yi Ke Da Xue Xue Bao = Journal of Southern Medical University. Mar, 2012  |  Pubmed ID: 22445982

To investigate the short-term spontaneous fluctuation of viral load in patients with chronic hepatitis B (CHB) and explore the related factors in treatment naive CHB patients during immune clearance phase.

[Application of Fenestration and Suction Drainage for Treatment of Large Odontogenic Mandibular Cystic Lesions]

Nan Fang Yi Ke Da Xue Xue Bao = Journal of Southern Medical University. Mar, 2012  |  Pubmed ID: 22445995

To evaluate the effect of fenestration and suction drainage in the treatment of large odontogenic mandibular cystic lesions.

2 GHz Clock Quantum Key Distribution over 260 Km of Standard Telecom Fiber

Optics Letters. Mar, 2012  |  Pubmed ID: 22446206

We report a demonstration of quantum key distribution (QKD) over a standard telecom fiber exceeding 50 dB in loss and 250 km in length. The differential phase shift QKD protocol was chosen and implemented with a 2 GHz system clock rate. By careful optimization of the 1 bit delayed Faraday-Michelson interferometer and the use of the superconducting single photon detector (SSPD), we achieved a quantum bit error rate below 2% when the fiber length was no more than 205 km, and of 3.45% for a 260 km fiber with 52.9 dB loss. We also improved the quantum efficiency of SSPD to obtain a high key rate for 50 km length.

Apoptosis Induced by Pneumolysin in Human Endothelial Cells Involves Mitogen-activated Protein Kinase Phosphorylation

International Journal of Molecular Medicine. Mar, 2012  |  Pubmed ID: 22446935

Pneumolysin (Ply) is an essential virulence factor of S. pneumoniae, which can induce apoptosis in a variety of host cells to facilitate infection of pathogenic bacteria by as yet unclear mechanisms. To confirm the apoptosis-inducing properties of pneumolysin in endothelial cells, human umbilical vein endothelial cells (HUVECs) were exposed to pneumolysin. The proliferation of HUVECs was inhibited by pneumolysin in a dose- and time-dependent manner. Flow cytometry analysis and ultrastructural changes of the cells indicated the apoptotic response. Exposure to pneumolysin significantly increased the number of apoptotic cells and the activities of caspases-3 and -8. This change was associated with activation of p38 mitogen-activated protein kinase (MAPK) and suppression of extracellular signaling regulation kinase (ERK)1/2. Pre-exposure to the p38 MAPK inhibitor SB-203850 prevented human endothelial cells from apoptosis induced by pneumolysin. In conclusion, these findings demonstrate that pneumolysin induces apoptosis in endothelial cells and the involvement of p38 MAPK activation and ERK1/2 deactivation.

High Normal Plasma Triglycerides Are Associated with Preserved Cognitive Function in Chinese Oldest-old

Age and Ageing. Mar, 2012  |  Pubmed ID: 22447910

OBJECTIVE: to explore the relationship between blood lipids/lipoproteins and cognitive function in the Chinese oldest-old. DESIGN: multivariate statistical analysis using cross-sectional data. SETTING: community-based setting in longevity areas in China. SUBJECTS: eight hundred and thirty-six subjects aged 80 and older were included in the sample. METHODS: plasma total cholesterol, triglycerides, low-density lipoprotein cholesterol, high-density lipoprotein cholesterol, blood pressure and fasting plasma glucose were measured and information about demographics and lifestyle was collected. Cognitive status was assessed using the Mini-Mental State Examination (MMSE). RESULTS: cumulative logit model analysis showed that triglyceride was significantly negatively associated with cognitive impairment. By general linear modelling, there was a significant linear trend of MMSE scores with the level of triglyceride, but not with levels of cholesterol after adjustment. The odds ratio (OR) of cognitive impairment (MMSE score < 18) was significantly reduced for the highest quartile of plasma triglyceride concentration (OR: 0.52, 95% CI: 0.33-0.84), but not for the second or third quartile, compared with the lowest quartile (adjusted models). There were no significant associations between cognitive impairment and cholesterol. CONCLUSION: we concluded that high normal plasma triglyceride was associated with preservation of cognitive function while lower concentrations were not in the Chinese oldest-old.

Genetic Diversity of the ORF5 Gene of Porcine Reproductive and Respiratory Syndrome Virus Isolates in Southwest China from 2007 to 2009

PloS One. 2012  |  Pubmed ID: 22448272

To gain insight into the molecular epidemiology and possible mechanisms of genetic variation of porcine reproductive and respiratory syndrome (PRRS) in Yunnan Province of China, the ORF5 gene of 32 PRRSV isolates from clinical samples collected from 2007 to 2009 were sequenced and analyzed. Nucleotide and amino acid analyses were carried out on 32 isolates and representative strains of the North American genotype, European genotype and two representative Chinese isolates. Results revealed that these isolates share 86.9-99.0% nucleotide and 87.5-98.0% amino acid identity with VR-2332 the prototypical North American PRRSV, 61.7-62.9% and 54.3-57.8% with Lelystad virus (LV) the representative strain of European genotype, 91.2-95.4% and 90.0-94.5% with CH-1a that was isolated in mainland China in 1996, 88.1-99.3% and 85.5-99.0% with JX-A1 the representative strain of High pathogenic PRRSV in China, and 86.2-99.8% and 85.5-100.0% between isolated strains of different years, respectively. Phylogenetic analysis revealed that all 32 PRRSV isolates belonged to the North American genotype and were further divided into two different subgenotypes. Subgenotype 1 comprised twenty two Yunnan isolates which divided into two branches. Subgenotype 2 comprised ten isolates which closely related to the RespPRRS vaccine and its parent strain VR-2332. The functional domains of GP5 such as the signal peptide, ectodomain, transmembrane regions and endodomain were identified and some motifs in GP5 with known functions, such as primary neutralizing epitope (PNE) and decoy epitope were also further analyzed. Our study shown the great genetic diversity of PRRSV in southwest China, rendering the guide for control and prevention of this disease.

Development of Real-Time Polymerase Chain Reaction for Detection of Borrelia Burgdorferi Sensu Lato in China

Vector Borne and Zoonotic Diseases (Larchmont, N.Y.). Mar, 2012  |  Pubmed ID: 22448677

Abstract Universal primers and probes were selected on the basis of the 16S rRNA gene sequence of Borrelia burgdorferi in GenBank(®), and a real-time polymerase chain reaction (PCR) method for detection of B. burgdorferi was established. The results showed that this method could specifically detect the B31 strain (Borrelia burgdorferi sensu stricto), the BO23 strain (Borrelia afzelii), and the SZ strain (Borrelia garinii), without cross-reaction with genome DNA of Theileria (T. luwenshuni, T. uilenbergi, T. sinensis, T. annulata, T. sergenti, T. annulata), Babesia (B. bigemina, B. ovate, B. sp. (Xinjiang)), Anaplasma (A. marginale, A. ovis), Mycoplasma mycoides subsp. capri, and Chlamydia psittaci, which are the infective pathogens to yak and/or sheep. The sensitivity of this real-time PCR is 10(4) times greater than that of a conventional PCR. The real-time PCR was able to amplify 16S rRNA gene from as few as 22.88 fg genomic DNA of B. burgdorferi sensu lato. Tick DNAs from 369 field samples collected from Shangzhi City of Heilongjiang Province were tested, resulting in an infection rate of 42.80%, and a total of 332 genomic DNAs from the blood of 186 yaks and 146 sheep in the Gannan Tibetan Autonomous Prefecture of Gansu Province were tested, resulting in 24.19% positive rate for the yaks and 39.04% positive rate for the sheep.

Interstitial Granulomatous Drug Reaction to a Chinese Herb Extract

European Journal of Dermatology : EJD. Mar, 2012  |  Pubmed ID: 22449792

Mechanical Injured Neurons Stimulate Astrocytes to Express Apolipoprotein E Through ERK Pathway

Neuroscience Letters. Mar, 2012  |  Pubmed ID: 22450050

To explore the possible cellular source and mechanism of apolipoprotein E (apoE) expression in mechanical injured neuronal cultures. Primary cultured mouse cortical neurons were subjected into mechanical injury by needle scratching. The conditioned medium of wild type (WT) primary mouse astrocytes was collected and added into cultured injured apoE knockout (KO) neurons. Separately, the conditioned medium of injured apoE KO neurons was collected and added into cultured WT astrocytes. We used a specific inhibitor of extracellular signal-regulated kinase (ERK) to block the possible apoE-associated pathway between injured neurons and astrocytes. The apoE expression levels of the cells and secreted into medium were measured by Western blot, respectively. The apoE expression was increased in neurons after mechanically injury, and the injured neurons uptook the astrocyte-secreted apoE, as well. Furthermore, the injured neurons stimulated astrocytes to express more apoE through the ERK signaling pathway. Mechanical injury triggered the neurons to increasingly synthesized apoE and uptook exogenous apoE, while stimulators released from injured neurons elevated astrocytes in apoE expression and secretion.

Reference Gene Selection for QPCR in Ammopiptanthus Mongolicus Under Abiotic Stresses and Expression Analysis of Seven ROS-scavenging Enzyme Genes

Plant Cell Reports. Mar, 2012  |  Pubmed ID: 22451089

Ammopiptanthus mongolicus, the only evergreen broadleaf shrub endemic to the northwest desert of China, is a valuable species for plant abiotic stress research. No report has so far described the selection of reference genes to get stringent normalization for qPCR in A. mongolicus. This work identified reliable reference genes for normalization of qPCR data in A. mongolicus under abiotic stresses from 14 reference gene candidates (UBQ, Tub1, Tub2, Abc1, Ubc1, Ubc2, Ubc4, Ubc5, eIF1, eIF2, eIF3, eIF4, EF1, EF2), and used the most suitable combination of reference genes to normalize the expression profiles of seven ROS-scavenging enzyme genes (AmSOD, AmAPX, AmGPX, AmCAT, AmGLR, AmPrx, and AmTrx). We set a series of 22 experimental samples covering the control and different time points under cold, dry, salt, and heat stresses. According to geNorm and NormFinder, the combination of eIF1 and eIF3 was best for accurate normalization across all the treatments, confirmed by normalizing qPCR data with AmHsp90. In contrast, these data show that Tub1, Abc1, and EF1 are not suitable reference gene candidates. After being normalized against eIF1 and eIF3, the seven ROS-scavenging enzyme genes exhibited differentially up- or down-regulated expression patterns. AmSOD and AmGPX were up-regulated by all four treatments, indicating that they may participate in an anti-oxidative mechanism under abiotic stresses in A. mongolicus. AmCAT exhibited a much higher expression level than AmAPX, AmPrx, and AmGPX, suggesting a principle role in detoxifying excessive H(2)O(2). AmSOD, AmGPX and AmAPX showing the most abundant transcripts under heat, AmCAT and AmGLR under drought, and AmPrx under salt, were observed. Expression patterns of the seven ROS-scavenging enzyme genes suggest different antioxidant protection roles of these genes under abiotic stresses. These results are valuable for future research on gene expression and abiotic stress tolerance in A. mongolicus.

Combined Hepatocellular Carcinoma and Cholangiocarcinoma: Clinical Features, Treatment Modalities, and Prognosis

Annals of Surgical Oncology. Mar, 2012  |  Pubmed ID: 22451237

BACKGROUND: Combined hepatocellular carcinoma and cholangiocarcinoma (cHCC-CC) is an uncommon subtype of primary liver cancer that has rarely been reported in large-scale clinical studies. The aim of this study was to clarify the clinical features, treatment modalities, and prognosis of cHCC-CC. METHODS: Included in this study were 113 patients who were histologically diagnosed as having Allen type C cHCC-CC, 103 of whom received liver resection, 6 transarterial chemoembolization treatment, 3 radiofrequency ablation, and 1 palliative supportive treatment. Clinicopathologic features and prognosis of 103 cHCC-CC patients after liver resection were compared with those of 6,679 patients with hepatocellular carcinoma (HCC) and 386 patients with intrahepatic cholangiocarcinoma (ICC) who underwent liver resection during the same period. RESULTS: The proportion of cHCC-CC in primary liver cancers was 1.5 %. The 103 cases of cHCC-CC were characterized by male predominance, infection with hepatitis virus or presence of liver cirrhosis, and elevated alfa-fetoprotein-findings similar to HCC. However, serum CA19-9 elevation, incomplete capsules, and lymph node involvement were similar to ICC. The 1-, 3-, and 5-year overall survival rates after liver resection were 73.9, 41.4, and 36.4 %, respectively, for patients with cHCC-CC versus 77.5, 53.3, and 41.4 % for HCC patients, and 58.0, 29.1, and 22.3 % for ICC patients (χ(2) = 137.5, P < 0.001). Tumor, node, metastasis system stage (hazard ratio 1.27, 95 % confidence interval 1.08-1.49, P = 0.003) and radical liver resection (hazard ratio 0.31, 95 % confidence interval 0.14-0.68, P = 0.004) were independent prognostic factors for overall survival. CONCLUSIONS: cHCC-CC has biological behavior and prognosis that are intermediate between HCC and ICC. Radical liver resection can provide a better outcome for this uncommon malignancy.

Two New Species of Pselaphodes Westwood and New Record of Taiwanophodes Minor Hlaváč from South China (Coleoptera, Staphylinidae, Pselaphinae)

ZooKeys. 2012  |  Pubmed ID: 22451792

Two new species, Pselaphodes linae Yin & Li, sp. n. (Hainan, Fujian) and Pselaphodes shii Yin & Li, sp. n. (Hainan) are described from South China. Taiwanophodes minor Hlaváč is reported from outside Taiwan for the first time. Illustrations of major diagnostic features are provided for all treated taxa. The latest key to Chinese Pselaphodes is modified to include the new species.

[Control for MUCT Process Operation Using Nitrate Concentration in the Secondary Anoxic Zone]

Huan Jing Ke Xue= Huanjing Kexue / [bian Ji, Zhongguo Ke Xue Yuan Huan Jing Ke Xue Wei Yuan Hui "Huan Jing Ke Xue" Bian Ji Wei Yuan Hui.]. Jan, 2012  |  Pubmed ID: 22452207

The feasibility of the control for MUCT process operation using nitrate concentration in the secondary anoxic zone were investigated by using simulative domestic sewage, in which the influent chemical oxygen demand concentration was stabilized at (290 +/- 10) mg x L(-1), the influent total nitrogen (TN) concentration was stabilized at (55 +/- 0.5) mg x L(-1), the influent total phosphorus (TP) concentration was stabilized at (7.0 +/- 0.5) mg x L(-1). The nitrate concentration in the secondary anoxic zone was changed to compare the effluent total nitrogen and total phosphorus concentration. The results indicated that, effluent total nitrogen and total phosphorus concentration significantly were affected by S(NO3-), controlling nitrate recirculation flow keeping SNO3- in 2.5 mg x L(-1) can realize MUCT process as the optimal control for nitrogen and phosphorus removal. The TP and NO3(-) -N mass balances were performed around each zone and settling tank based on the averaged TP and TN concentrations for each nitrate concentration in the secondary anoxic zone, which was indicated that S(NO3-) is a key factor determining the mass of phosphorus which is released in anaerobic zone, mass of phosphorus uptake in the secondary anoxic zone, and mass of NO3(-) -N which is denitrified in the first and secondary anoxic zone.

Use of Plethysmographic Variability Index Derived from the Massimo(®) Pulse Oximeter to Predict Fluid or Preload Responsiveness: a Systematic Review and Meta-analysis

Anaesthesia. Mar, 2012  |  Pubmed ID: 22452345

This systematic review and meta-analysis assessed the accuracy of plethysmographic variability index derived from the Massimo(®) pulse oximeter to predict preload responsiveness in peri-operative and critically ill patients. A total of 10 studies were retrieved from the literature, involving 328 patients who met the selection criteria. Overall, the diagnostic odds ratio (16.0; 95% CI 5-48) and area under the summary receiver operating characteristic curve (0.87; 95% CI 0.78-0.95) for plethysmographic variability index to predict fluid or preload responsiveness was very good, but significant heterogeneity existed. This could be explained by a lower accuracy of plethysmographic variability index in spontaneously breathing or paediatric patients and those studies that used pre-load challenges other than colloid fluid. The results indicate specific directions for future studies.

Involvement of Oxidative Stress and Mitogen-activated Protein Kinase Signaling Pathways in Heat Stress-induced Injury in the Rat Small Intestine

Stress (Amsterdam, Netherlands). Mar, 2012  |  Pubmed ID: 22452662

Extreme heat stress-induced gastrointestinal injury and dysfunction may occur during summer. We investigated possible mechanisms of heat stress-induced damage in the small intestine using male Sprague-Dawley rats subjected to 2 hours of heat stress (40°C, 60% relative humidity) daily for 10 consecutive days. Rats were killed at specific times immediately following heat treatment to determine: morphological changes by optical and electron microscopy; intestinal permeability using fluorescein isothiocyanate-dextran; production of reactive oxygen species (ROS), malondialdehyde, and activities of superoxide-dismutase and glutathione-peroxidase by specific assays; phosphorylation of extracellular signal-regulated kinase (ERK1/2), c-Jun N-terminal kinase (JNK), and p38 mitogen-activated protein kinase (MAPK) by immunocytochemistry and western-blot analysis. The rat intestinal epithelial cell line (IEC-6) and specific MAPK inhibitors were used for in vitro investigation of effects of activation of MAPKs by heat stress. Heat stress caused marked morphological damage to the small intestine and significantly increased intestinal permeability. Heat stress increased ROS and malondialdehyde production, and significantly reduced anti-oxidase activity. MAPK activity in small intestine was increased by heat stress. In vitro, heat stress caused damage and apoptosis in IEC-6 cells; inhibition of ERK1/2 activation (by U0126) exacerbated these effects, which were attenuated by inhibition of JNK (by SP600125) and p38 (by SB203580) activation. Hence, heat stress caused severe small intestine injury, increased oxidative stress and activated MAPK signaling pathways. The in vitro studies indicated that ERK1/2 activation is anti-apoptotic, and JNK and p38 activation are pro-apoptotic in heat stressed intestinal epithelial cells.

Essential Role of the CUL4B Ubiquitin Ligase in Extra-embryonic Tissue Development During Mouse Embryogenesis

Cell Research. Mar, 2012  |  Pubmed ID: 22453236

Mutations of the CUL4B ubiquitin ligase gene are causally linked to syndromic X-linked mental retardation (XLMR). However, the pathogenic role of CUL4B mutations in neuronal and developmental defects is not understood. We have generated mice with targeted disruption of Cul4b, and observed embryonic lethality with pronounced growth inhibition and increased apoptosis in extra-embryonic tissues. Cul4b, but not its paralog Cul4a, is expressed at high levels in extra-embryonic tissues post implantation. Silencing of CUL4B expression in an extra-embryonic cell line resulted in the robust accumulation of the CUL4 substrate p21(Cip1/WAF) and G2/M cell cycle arrest, which could be partially rescued by silencing of p21(Cip1/WAF). Epiblast-specific deletion of Cul4b prevented embryonic lethality and gave rise to viable Cul4b null mice. Therefore, while dispensable in the embryo proper, Cul4b performs an essential developmental role in the extra-embryonic tissues. Our study offers a strategy to generate viable Cul4b-deficient mice to model the potential neuronal and behavioral deficiencies of human CUL4B XLMR patients.Cell Research advance online publication 27 March 2012; doi:10.1038/cr.2012.48.

Decelerating a Pulsed Subsonic Molecular Beam by a Quasi-cw Traveling Optical Lattice

Optics Express. Mar, 2012  |  Pubmed ID: 22453457

We propose a promising scheme to realize the deceleration of a pulsed subsonic molecular beam by using a multistage optical Stark decelerator (i.e., a 1D quasi-cw traveling optical lattice), which is composed of two nearly counter-propagating, time-varying, red-detuned light fields with an intensity of ~10⁷Wcm^-2 and a fixed frequency difference between them. We also study the influence of the velocity reduced amount of the traveling lattice, the lattice power, the synchronous phase angle, the deceleration-stage number and the temporal profile of laser pulses on the molecular slowing results by using 3D Monte-Carlo method. Our study shows that the proposed decelerator cannot only be used to slow a pulsed subsonic beam from 240m/s to standstill, but also to obtain a cold molecular packet with a temperature of a few µK, and the corresponding fraction of cold molecules is 10^-6-10^-7, which strongly depends on the synchronous phase angle. And we also find that a pair of appropriate rising and falling times of laser pulses will lead to a better slowing effect than that produced by the top-hat temporal ones.

Continuous-wave Mid-infrared Intra-cavity Singly Resonant PPLN-OPO Under 880 Nm In-band Pumping

Optics Express. Mar, 2012  |  Pubmed ID: 22453475

We report herein a continuous-wave mid-infrared intra-cavity singly resonant optical parametric oscillator (ICSRO) which is the first example of ICSRO that utilize in-band pumped Nd-doped vanadate laser as pump source. A 1064 nm Nd:YVO₄ laser in-band pumped by 880 nm LD and a periodically poled lithium niobate (PPLN) crystal are employed as the parent pump laser and the nonlinear medium, respectively. The idler output wavelength tuning range is 3.66-4.22 µm. A maximum output power of 1.54 W at 3.66 µm is obtained at absorbed pump power of 21.9 W, with corresponding optical efficiency being 7.0%. The control experiment of ICSRO under 808 nm traditional pumping is also carried out. The results show that in-band pumped ICSRO has better performance in terms of threshold, power scaling, efficiency and power stability than ICSRO traditionally pumped at 808 nm.

Developmental Truncations of Connexin 50 by Caspases Adaptively Regulate Gap Junctions/hemichannels and Protect Lens Cells Against UV Radiation

The Journal of Biological Chemistry. Mar, 2012  |  Pubmed ID: 22418432

The gap junction-forming connexin (Cx) 50 is gradually truncated during lens development. Premature cleavage of lens connexins is thought to be associated with cataract formation. We have previously shown that Cx50 is likely to be cleaved by caspase-3 like protease during chick lens development. Here, using HPLC-electrospray tandem mass spectrometry we mapped two cleavage sites at the C-terminus of Cx50 after Glu-368 and Asp-379, and identified caspase-3 and caspase-1 as the responsible proteases, respectively. The activity of caspase-1, like caspase-3, was detected in the outer cortex increased during lens development, which coincided with the accumulation of the truncated fragments of Cx50 in the core region of the lens. The truncated Cx50 fragments present in older lenses were reproduced in the younger lens after treatment with UV radiation; this cleavage could be partially blocked by caspase-1/3-specific inhibitors. Interestingly, as compared to full-length Cx50, caspase-truncated Cx50 showed a dramatic decrease in gap junction coupling and a loss of hemichannel function. Furthermore, expression of caspase-truncated Cx50 fragments increased cell viability against UV radiation as compared to full-length Cx50. Together, these results suggest that both caspase-1 and -3 are responsible for the cleavage at the C-terminus of Cx50 during lens development. The reduction of gap junction coupling and closure of hemichannels formed by truncated Cx50 are likely to adaptively protect cells against elevated oxidative stress associated with lens aging.

Nitrogen-Doped Carbon Monolith for Alkaline Supercapacitors and Understanding Nitrogen-Induced Redox Transitions

Chemistry (Weinheim an Der Bergstrasse, Germany). Mar, 2012  |  Pubmed ID: 22419436

A nitrogen-doped porous carbon monolith was synthesized as a pseudo-capacitive electrode for use in alkaline supercapacitors. Ammonia-assisted carbonization was used to dope the surface with nitrogen heteroatoms in a way that replaced carbon atoms but kept the oxygen content constant. Ammonia treatment expanded the micropore size-distributions and increased the specific surface area from 383 m(2)  g(-1) to 679 m(2)  g(-1) . The nitrogen-containing porous carbon material showed a higher capacitance (246 F g(-1) ) in comparison with the nitrogen-free one (186 F g(-1) ). Ex situ electrochemical spectroscopy was used to investigate the evolution of the nitrogen-containing functional groups on the surface of the N-doped carbon electrodes in a three-electrode cell. In addition, first-principles calculations were explored regarding the electronic structures of different nitrogen groups to determine their relative redox potentials. We proposed possible redox reaction pathways based on the calculated redox affinity of different groups and surface analysis, which involved the reversible attachment/detachment of hydroxy groups between pyridone and pyridine. The oxidation of nitrogen atoms in pyridine was also suggested as a possible reaction pathway.

Optimizing Tissue-specific Antisense Oligonucleotide-Peptide Conjugates

Methods in Molecular Biology (Clifton, N.J.). 2012  |  Pubmed ID: 22454077

Cell-targeting peptides which improve tissue-specific delivery of antisense oligonucleotides (AONs) are a new exciting "next-generation" potential AON therapy. New peptides are regularly developed which increase targeting and cell penetration for the AON treatment of mRNA misregulated diseases. Optimization of these peptide conjugate AONs requires systematic treatment and methods of analysis. This chapter describes methods for analyzing cell-targeting peptide conjugated AONs in primary cultured cell lines and for local and systemic delivery to the mouse for the treatment of Duchenne muscular dystrophy (DMD). Chimeric and novel cell-penetrating peptides have already been described to induce high levels of exon skipping and dystrophin protein expression in tissues body-wide at very low doses of AON. Screening of future novel peptides may be achieved by preliminary in vitro screening followed by in vivo administration of the most promising peptide-conjugated AONs. Physiological and functional correction of dystrophin protein may be confirmed by a number of techniques as described and allows for the fast-tracking of candidate peptides to drug trial for DMD.

Design and Evaluation of a Novel Evodiamine-Phospholipid Complex for Improved Oral Bioavailability

AAPS PharmSciTech. Mar, 2012  |  Pubmed ID: 22454136

A novel evodiamine (EVO)-phospholipid complex (EPLC) was designed to improve the bioavailability of EVO. A central composite design approach was employed for process optimization. EPLC were characterized by differential scanning calorimetry, ultraviolet spectroscopy, Fourier transformed infrared spectroscopy, (1)H-NMR spectroscopy, matrix-assisted laser desorption/ionization time-of-flight spectroscopy, apparent solubility, and dissolution rate. After oral administration of EPLC, the concentrations of EVO at different time points were determined by high-performance liquid chromatography. The optimal formulation for EPLC was obtained where the values of X (1), X (2), and X (3) were 2, 0.5, and 2.5 mg/mL, respectively. The average particle size and zeta potential of EPLC with the optimized formulation were 246.1 nm and -26.94 mV, respectively. The EVO and phospholipids in the EPLC were associated with non-covalent interactions. The solubility of EPLC in water and the dissolution rate of EPLC in phosphate-buffered solution (pH 6.8) were substantially enhanced. The plasma EVO concentration-time curves of EPLC and free EVO were both in accordance with the two-compartment model. The peak concentration and AUC(0-∞) of EPLC were increased, and the relative bioavailability was significantly increased to 218.82 % compared with that of EVO.

Outcomes of Liver Transplantation in Alagille Syndrome: The Split Experience

Liver Transplantation : Official Publication of the American Association for the Study of Liver Diseases and the International Liver Transplantation Society. Mar, 2012  |  Pubmed ID: 22454296

Alagille syndrome (ALGS) is multisystem disorder manifest by childhood cholestasis. Reports of liver transplantation (LT) in ALGS have come largely from single-centers reporting 57-79% survival. Our aims were to determine LT outcomes in ALGS. We performed a retrospective analysis of the SPLIT database, containing information regarding 3153 pediatric LT recipients. Data was available on 91 ALGS and 236 age-matched biliary atresia (BA) patients. The frequency of complex cardiac anomalies was lower in the ALGS-LT group, compared to published ALGS series (5% versus 13%). The pre-transplant GFR was <90mL/min/1.73m2 in 18% of ALGS-LT patients compared to 5% of BA (p=0.0006). Height deficit at listing was worse in ALGS (66% versus 22%). 1-year patient survival was 87% for ALGS and 96% for BA (p=0.0017). The deaths in ALGS mostly occurred within the first 30 days. No pre-transplant factors associated with death were identified in ALGS. Survival analysis revealed biliary (p=0.02), vascular (p<0.0001), CNS (p<0.0001) and renal (p<0.0001) complications post-LT were associated with death in ALGS. Renal insufficiency in ALGS worsened following LT and at 1 year GFR was <90mL/min/1.73m2 in 22% of ALGS-LT patients (versus 8% in BA, p=0.0014). More ALGS-LT children were either currently receiving special education (50% versus 30% in BA, p=0.02) or had done so in the past (60% versus 36%, p=0.01). © 2012 American Association for the Study of Liver Diseases.

Chinese Herb and Formulas for Promoting Blood Circulation and Removing Blood Stasis and Antiplatelet Therapies

Evidence-based Complementary and Alternative Medicine : ECAM. 2012  |  Pubmed ID: 22454656

Atherothrombosis, which directly threatens people's health and lives, is the main cause of morbidity and mortality all over the world. Platelets play a key role in the development of acute coronary syndromes (ACSs) and contribute to cardiovascular events. Oral antiplatelet drugs are a milestone in the therapy of cardiovascular atherothrombotic diseases. In recent years, many reports have shown the possibility that "resistance" to oral anti-platelet drugs and many adverse reactions, such as serious bleeding risk, which provides an impetus for developing new anti-platelet drugs possesses highly efficiency and fewer adverse effects. Study on the blood stasis syndrome and promoting blood circulation and removing blood stasis is the most active field of research of integration of traditional and western medicine in China. Blood-stasis syndrome and platelet activation have close relationship, many Chinese herb and formulas for promoting blood circulation and removing blood stasis possess definite anti-platelet effect. This paper covers the progress of anti-platelet mechanism of Chinese herb and formulas for promoting blood circulation and removing blood stasis and is to be deeply discussed in further research.

Association of Ku70 A-31G Polymorphism and Risk of Renal Cell Carcinoma in a Chinese Population

DNA and Cell Biology. Mar, 2012  |  Pubmed ID: 22455395

The DNA repair gene Ku70 plays a key role in the DNA double-strand breaks (DSBs) repair system. Defects in DSBs repair capacity can lead to genomic instability. We hypothesized that the Ku70 A-31G polymorphism (rs132770) was associated with the risk of renal cell carcinoma (RCC). In a hospital-based case-control study of 620 RCC patients and 623 cancer-free controls frequency matched by age and sex, we genotyped the functional polymorphism Ku70 A-31G (rs132770). Thirty-eight normal renal tissue samples with different genotypes were tested to estimate the Ku70 mRNA expression by real-time quantitative reverse transcription. Compared with the GG genotype, the GA and GA/AA genotypes had a significantly decreased risk of RCC [adjusted odds ratio (OR)=0.62, 95% confidence interval (CI)=0.44-0.87 for GA, and OR=0.62, 95% CI=0.45-0.86 for GA/AA]. The in vivo experiments with normal renal tissues revealed that a statistically significantly higher Ku70 mRNA expression was identified in samples with GA/AA genotypes compared with those with GG genotypes (p=0.001). These results suggested that the Ku70 A-31G polymorphism is involved in the etiology of RCC and, thus, may be a marker for genetic susceptibility to RCC in the Chinese populations.

[Large-scale Population-based Genetic Screening and Prenatal Diagnosis for Thalassemias in Zhuhai City of Guangdong Province]

Zhonghua Fu Chan Ke Za Zhi. Feb, 2012  |  Pubmed ID: 22455738

To report the results of preventive control program of severe thalassemias in Zhuhai City of Guangdong Province from 1998 to 2010.

The Effect of Vaccinium Uliginosum on Rabbit Retinal Structure and Light-induced Function Damage

Chinese Journal of Integrative Medicine. Apr, 2012  |  Pubmed ID: 22457142

To study the effect of Vaccinium uliginosum L., (VU) on the electroretinogram (ERG) and retinal pathological changes in rabbits after light-induced damage.

Characterization of Bovine Induced Pluripotent Stem Cells by Lentiviral Transduction of Reprogramming Factor Fusion Proteins

International Journal of Biological Sciences. 2012  |  Pubmed ID: 22457605

Pluripotent stem cells from domesticated animals have potential applications in transgenic breeding. Here, we describe induced pluripotent stem (iPS) cells derived from bovine fetal fibroblasts by lentiviral transduction of Oct4, Sox2, Klf4 and c-Myc defined-factor fusion proteins. Bovine iPS cells showed typical colony morphology, normal karyotypes, stained positively for alkaline phosphatase (AP) and expressed Oct4, Nanog and SSEA1. The CpG in the promoter regions of Oct4 and Nanog were highly unmethylated in bovine iPS cells compared to the fibroblasts. The cells were able to differentiate into cell types of all three germ layers in vitro and in vivo. In addition, these cells were induced into female germ cells under defined culture conditions and expressed early and late female germ cell-specific genes Vasa, Dazl, Gdf9, Nobox, Zp2, and Zp3. Our data suggest that bovine iPS cells were generated from bovine fetal fibroblasts with defined-factor fusion proteins mediated by lentivirus and have potential applications in bovine transgenic breeding and gene-modified animals.

Prevalence of Hepatitis E Virus in Swine Fed on Kitchen Residue

PloS One. 2012  |  Pubmed ID: 22457765

The aim of this study was to investigate the prevalence of swine hepatitis E virus (HEV) in pigs fed different feedstuffs (kitchen residue or mixed feeds) and genetic identification of HEV isolated in Hebei province, China. Serum and fecal samples were collected from adult swine. Anti-HEV antibody was evaluated by double sandwich antigen enzyme immunoassay. HEV RNA was extracted from fecal samples and amplified by nested RT-PCR. The reaction products were sequenced, and the sequence analyzed. Virus-like particles were distinguishable by negative staining in the electron microscope. Histopathological observation and immunohistochemical localization were used in the animal models. Overall, the anti-HEV positive percentage of serum samples from pigs fed on kitchen residue was 87.10% (27/31), and 53.06% (130/245) from pigs fed on complete feed. The HEV RNA positivity rate of fecal samples from pigs fed on kitchen residue was 61.54% (8/13), but zero for pigs fed on complete feed. Sequence analysis of these eight samples and comparison with the published sequence showed that there were eight groups that belonged to genotype 4 d and the nucleotide identity was 95.6-99.3%. swHE11 is most closely related to strain CCC220, and the other seven HEV isolates were most closely related to strains swGX40, SwCH189 and V0008ORF3, which are isolates from human and pigs. Histopathological observation showed that there was liver damage in the experimental group, and immunohistochemistry indicated that the HEV antigens were strongly positive at 7 days after infection. The results demonstrated that the prevalence of HEV in pigs fed on kitchen residue was higher than in those fed on complete feed (P<0.05).

The Cluster of MiR-143 and MiR-145 Affects the Risk for Esophageal Squamous Cell Carcinoma Through Co-Regulating Fascin Homolog 1

PloS One. 2012  |  Pubmed ID: 22457808

MicroRNAs (miRNAs), 18-24 nt non-coding RNAs, are thought to play important roles in cell proliferation, differentiation, apoptosis, and development. Recent studies suggest that some of the known microRNAs map to a single genomic locale within a single polycistronic transcript. But the roles of the cluster remain to be known. In order to understand the role and mechanism of a cluster of miR-143 and miR-145 in esophageal squamous cell carcinoma (ESCC), the association of mature miR-143 and miR-145 expression with the risk for esophageal cancer was evaluated in ESCC patients with a case-control study, and target protein regulated by mature miRNA was analyzed in ESCC cell lines with 3'UTR luciferase reporter assay. The expression levels of miR-143 and miR-145 were determined in 110 pairs of esophageal cancer tissues and adjacent normal tissues using real-time reverse transcription PCR. The relative expression of miR-143 and miR-145 were statistically different between cancer tissues and matched controls. The combined expression of miR-143 and miR-145 was significantly associated with the risk for esophageal cancer. Meanwhile, the reduced expression of two miRNAs in tumor patient was supposed to have a trend of lymph node metastases. The co-expression pattern of miR-143 and miR-145 was analyzed with Pearson correlation. It showed a significant correlation between these two miRNAs expression both in tissues and tumor cell lines. 3'UTR luciferase reporter assay indicated that Fascin Homolog 1 (FSCN1) could be co-regulated by miR-143 and miR-145. The protein level of FSCN1 showed no significant linear correlation with miR-143 and miR-145 expression in ESCC cell lines with Western blotting analysis. In conclusion, since miR-143 and miR-145 could regulate oncogenic FSCN1 and take part in the modulation of metastases, the result suggested the combination variable of miR-143 and miR-145 as a potential biomarker for earlier diagnosis and prognosis of esophageal cancer.

Prognostic Value of Survivin in Patients with Non-small Cell Lung Carcinoma: a Systematic Review with Meta-analysis

PloS One. 2012  |  Pubmed ID: 22457815

The potential prognostic value of survivin in resected non-small cell lung carcinoma (NSCLC) is variably reported. The objective of this study was to conduct a systematic review of literatures evaluating survivin expression in resected NSCLC as a prognostic indicator.

Optimizing the Conditions for In Vitro Maturation and Artificial Activation of Sika Deer (Cervus Nippon Hortulorum) Oocytes

Reproduction in Domestic Animals = Zuchthygiene. Mar, 2012  |  Pubmed ID: 22458270

With the goal of establishing experimental protocols for cloning sika deer, various conditions for in vitro maturation (IVM) and artificial activation of sika deer oocytes were examined. In vitro maturation was evaluated in seven different culture media. The highest rate of oocyte maturation was 75.4% in 10 μg/ml follicle-stimulating hormone (FSH), 1 μg/ml LH, 0.2 mm cysteamine and 50 ng/ml epidermal growth factor (EGF) after 24 h of IVM. The efficiency after 24 h of IVM did not differ significantly (p > 0.05) from that observed after 20 h. Cysteamine (0.2 mm) significantly increased the maturation rates after 20 h (from 59.1% to 67.2%, p < 0.05) and after 24 h (from 63.2% to 71.6%, p < 0.05) of IVM. The IVM rates of oocytes collected during the oestrous season (75.4%) and the anoestrous season (23.3%) were significantly different at 24 h. The 20 μg/ml FSH, 2 μg/ml LH, 0.4 mm cysteamine and 100 ng/ml EGF significantly increased the maturation rates (from 23.3% to 54.2%, p < 0.01) at 24 h during the anoestrous season. For the activation experiments, the most effective method was chemical activation [ionomycin + 6-dimethylaminopurine (6-DMAP)], which promoted the development of sika deer oocytes to the blastocyst stage (32.4%). Our results indicate that in vitro matured sika deer oocytes are good candidates for parthenogenetic activation and that chemical treatment is needed for relatively efficient activation of the oocytes. These optimized conditions for IVM and parthenogenetic activation may be useful for efforts to restore populations of the endangered sika deer using the somatic cell nuclear transfer technique.

Chiral Ni(II) Coordination Polymers: Structure-Driven Effects of Temperature and Polyvinylpyrrolidone

Inorganic Chemistry. Mar, 2012  |  Pubmed ID: 22458476

Chiral Ni(II) coordination compounds with structures of [NiL(H(2)O)(3)] (1) and {[NiL(H(2)O)]·0.5H(2)O}(n) (2) (H(2)L = thiazolidine 2,4-dicaboxlic acid) have been successfully synthesized by the reaction of Ni(CH(3)COO)(2)·4H(2)O and H(2)L in aqueous solution at 25 and 80 °C, respectively. From the same procedure with polyvinylpyrrolidone (PVP) as a surfactant, another corresponding micrometer-scale Ni(II) coordination polymer, {[NiL(H(2)O)(2)]·H(2)O}(n) (3), has been obtained at both 25 and 80 °C, which shows a different structure (one-dimensional, 1D) than both 1 (discrete molecule) and 2 (3D). The conversions of structures and conformations are directed by temperature and surfactant (PVP), as confirmed by powder and single-crystal X-ray diffraction. Circular Dichroism (CD) and Second Harmonic Generation (SHG) measurements of the products have been investigated as well, which indicate the potential applications of these products in chiral and nonlinear optical (NLO) areas.

Fc Receptor Like 3 in Chinese Patients of Han Nationality with Guillain-Barré Syndrome

Journal of Neuroimmunology. Mar, 2012  |  Pubmed ID: 22458979

Fc receptor like 3 gene (FcRL3) has been associated with some autoimmune diseases. Here, its role in Guillain-Barré syndrome (GBS) was evaluated by studying nine FcRL3 gene SNPs in a Chinese cohort of GBS patients. The frequencies of FcRL3-3-169C, FcRL3-6 intron3A, and FcRL3-8 exon15G alleles were significantly increased in GBS patients compared with healthy controls. The frequency of FcRL3-1→9 CCTGGAGAA haplotype was significantly increased, and the frequencies of FcRL3-1→9 CCTACAAAA,CCCACGAAA, and CCTGCGGAA haplotypes were significantly decreased compared with healthy controls. These results suggest that FcRL3 is associated with GBS incidence.

Increased Expression of Matrix Metalloproteinase 9 in Cortical Lesions from Patients with Focal Cortical Dysplasia Type IIb and Tuberous Sclerosis Complex

Brain Research. Mar, 2012  |  Pubmed ID: 22459050

The malformative cortical lesions in the cerebral cortex that are characteristic of focal cortical dysplasia type IIb (FCDIIb) and tuberous sclerosis complex (TSC) are well-recognized causes of chronic intractable epilepsy in children. Increasing evidence suggests that extracellular matrix molecules play important roles in epileptogenesis. Matrix metalloproteinase 9 (MMP9), a typical extracellular matrix proteolytic protease, has been shown to participate in the occurrence of seizures in experimental models. In the present study, we used immunoblotting to analyze the levels of MMP9 protein in FCDIIb lesions, TSC tubers and control samples, which included epileptic neocortices from temporal lobe epilepsy and non-epileptic normal cortices (CTX). The cellular distribution of MMP9 was further investigated by immunohistochemical methods. Our findings demonstrated the elevated levels of the inactive and active forms of MMP9 protein in FCDIIb and TSC lesions compared with CTX. Furthermore, the immunohistochemical results showed that MMP9 was characteristically expressed in the following misshapen cells: hypertrophic neurons, dysmorphic neurons, balloon cells and giant cells. Additionally, double immunofluorescent staining revealed that the reactive astrocytes, but not the microglia, expressed high levels of MMP9. Taken together, our findings suggest that the overexpression and spatial distribution patterns of MMP9 may be linked with the intractable epilepsy caused by FCDIIb and TSC.

Syphilis: Still a Major Cause of Infant Mortality

The Lancet Infectious Diseases. Apr, 2012  |  Pubmed ID: 22459084

Program Death-1 Regulates Peripheral T Cell Tolerance Via an Anergy-independent Mechanism

Clinical Immunology (Orlando, Fla.). Mar, 2012  |  Pubmed ID: 22459706

Program death-1 (PD-1) has been documented to negatively regulate immune responses. However, the cellular and molecular mechanisms for PD-1-mediated immune suppression have not been fully elucidated. In this study, we show that loss of PD-1 does not lead to defective induction of CD4(+) T cell anergy in vitro and in vivo. Rather, the absence of PD-1 inhibits the development of inducible CD4(+)Foxp3(+) regulatory T cells (iTregs) induced by TGF-β in vitro. In support of this finding, PD-1 deficiency impairs the generation of iTregs in vivo and leads to development of severe T cell-transfer-induced colitis. Mechanistically, defective iTreg generation in the absence of PD-1 was attributed to the heightened phosphorylation of Akt. Therefore, we first demonstrate that PD-1 controls peripheral T cell tolerance via an anergy-independent but iTreg-dependent mechanism.

Concurrent Highly Pathogenic Porcine Reproductive and Respiratory Syndrome Virus Infection Accelerates Haemophilus Parasuis Infection in Conventional Pigs

Veterinary Microbiology. Mar, 2012  |  Pubmed ID: 22460022

This study was aimed at determining the effect of highly pathogenic porcine reproductive and respiratory syndrome virus (HP-PRRSV) on Haemophilus parasuis (HPS) in co-infection. A quantitative real-time PCR targeting infB gene, which is conserved among different HPS serotypes, was developed to improve the accuracy and speed of the detection of HPS. A total of 32 four-week-old conventional pigs were distributed randomly into four groups: pigs in group I were intranasally infected with HP-PRRSV first, and were then intraperitoneally inoculated with HPS on 5 days after HP-PRRSV infection; pigs in group II were intranasally inoculated with HP-PRRSV alone; pigs in group III were intraperitoneally inoculated with HPS alone; pigs in group IV were intraperitoneally inoculated with physiological saline. The amount of HPS in serum on 0, 3, 6, 9 and 12 days post-inoculation (dpi) with HPS were detected using the established quantitative real-time PCR. Clinical signs, pathological changes and histopathological lesions were observed. The amount of HPS in serum reached 10(6)copies/μl at 3dpi with HPS in pigs of group I, while it arrived 10(5.7)copies/μl at 9dpi with HPS in pigs of group III. The HPS loads in hearts and lungs were much higher than in other tissues. The study showed that HP-PRRSV was able to accelerate HPS infection and loads.

A Dual PH and Temperature Responsive Polymeric Fluorescent Sensor and Its Imaging Application in Living Cells

Chemical Communications (Cambridge, England). Mar, 2012  |  Pubmed ID: 22460168

A polymeric fluorescent sensor , consisting of A4 and N-isopropylacrylamide (NIPAM) units, was synthesized. exhibited dual responses to pH and temperature, and could be used as an intracellular pH sensor for lysosomes imaging. Moreover, it also could sense different temperature change in living cells at 25 and 37 °C, respectively.

Coexpression of Stemness Factors Oct4 and Nanog Predict Liver Resection

Annals of Surgical Oncology. Mar, 2012  |  Pubmed ID: 22461131

BACKGROUND: Oct4 and Nanog are two major transcription factors related to the stem cell self-renewal and differentiation. The aim of this study was to evaluate the correlation between these two stemness markers with recurrence, metastasis, and prognosis of hepatocellular carcinoma (HCC). METHODS: Expression of Oct4 and Nanog was evaluated by immunohistochemistry in a random cohort of 228 HCC patients (cohort A), predominantly hepatitis B related, and validated in another independent cohort of 95 patients (cohort B). Survival analysis was performed by univariate and multivariate analyses. Oct4 and Nanog expression levels in 5 HCC cell lines with different metastatic potential were detected by Western blot assay and quantitative real-time PCR assay. RESULTS: In tissue microarrays, coexpression of Oct4 and Nanog was dramatically associated with big tumor size (P = .001) and vascular invasion (P = .02) and was an independent predictor of postoperative recurrence (hazard ratio [HR] = 1.57, 95 % confidence interval [95 % CI] 1.21-2.04, P = .01) and poor prognosis (HR = 2.20, 95 % CI 1.71-2.88, P < .001). This association was further validated in patients in cohort B. Importantly, this correlation remained significant in patients with early-stage HCC or alpha-fetoprotein (AFP) negative HCC. In addition, expression of Oct4 and Nanog increased in a concordant manner with the increase of metastatic potential in human HCC cell lines. CONCLUSIONS: Coexpression of stemness markers Oct4 and Nanog in HCC indicated the aggressive tumor behaviors and predicted a worse clinical outcome, which may be a useful biomarker to identify patients at high risk of postoperative recurrence.

Systems Genetic Analysis of Multivariate Response to Iron Deficiency in Mice

American Journal of Physiology. Regulatory, Integrative and Comparative Physiology. Mar, 2012  |  Pubmed ID: 22461179

The aim of this study was to identify genes that influence iron regulation under varying dietary iron availability. Male and female mice from 20+ BXD recombinant inbred strains were fed iron-poor or iron-adequate diets from weaning until 4 months of age. At sacrifice, the spleen, liver and blood were harvested for the measurement of hemoglobin, hematocrit, total iron binding capacity, liver, spleen and plasma iron concentration, and transferrin saturation. For each measure and diet, we found large, strain-related variability. A principal components analysis (PCA) was performed on the strain means for the seven parameters under each dietary condition for each sex, followed by quantitative trait loci (QTL) analysis on the factors. Compared to the iron-adequate diet, iron deficiency altered the factor structure of the principal components. QTL analysis, combined with PosMed, a candidate gene searching system, published gene expression data and literature citations, identified seven candidate genes, Ptprd, Mdm1, Picalm, lip1, Tcerg1, Skp2, and Frzb based on PCA factor, diet and sex. Expression of each of these is cis-regulated, significantly correlated with the corresponding PCA factor, and previously reported to regulate iron, directly or indirectly. We propose that polymorphisms in multiple genes underlie individual differences in iron regulation, especially in response to dietary iron challenge. This research shows that iron management is a highly complex trait, influenced by multiple genes. Systems genetics analysis of iron homeostasis holds promise for developing new methods for prevention and treatment of iron deficiency anemia and related diseases.

Expression of A20 is Reduced in Pancreatic Cancer Tissues

Journal of Molecular Histology. Mar, 2012  |  Pubmed ID: 22461193

A20 protein plays essential roles in tumorigenesis, but its value for diagnosis of pancreatic cancer remains unclear. Our aim was to determine whether A20 is a potential biomarker for the diagnosis of pancreatic cancer. The pancreatic cancer tissue microarray contained pancreatic cancer tissues (n = 40) and normal tissues (n = 10) was immunohistochemically assessed for A20 expression. The association of A20 expression with the tumor grade, lymph node metastasis, age and gender in pancreatic cancer patients were estimated by ANOVA. Stronger staining of A20 was observed in the normal tissues compared with that in the pancreatic cancer tissues (P = 0.003). ANOVA analysis showed that the A20 expression was not deeply associated with tumor grade, gender, age or TNM stages. The results implied that low A20 expression is significantly associated with the pancreatic cancer behavior, but is not the sole determinant of pancreatic cancer progression.

Energy Expenditure and Bone Formation Share a Common Sensitivity to AP-1 Transcription in the Hypothalamus

Journal of Bone and Mineral Research : the Official Journal of the American Society for Bone and Mineral Research. Mar, 2012  |  Pubmed ID: 22461201

The regulation of bone and fat homeostasis and its relationship to energy expenditure has recently been the focus of increased attention due to its potential relevance to osteoporosis, obesity and diabetes. Although central effectors within the hypothalamus have been shown to contribute to the regulation of both energy balance and bone homeostasis, little is known of the underlying mechanisms, including the possible involvement of transcriptional factors within the hypothalamus. Transgenic mice overexpressing ΔFosB, a splice variant of the AP1 transcription factor FosB with mixed agonist-antagonistic properties, have increased energy expenditure and bone mass. Since these mice express ΔFosB in bone, fat and hypothalamus, we sought to determine 1) whether overexpression of ΔFosB within the hypothalamus was sufficient to regulate energy expenditure and whether it would also regulate bone mass, and 2) whether these effects were due to antagonism to AP1. Our results show that stereotactic injection of an adeno-associated virus vector to restrict overexpression of ΔFosB to the ventral hypothalamus of wildtype mice induced a profound increase in both energy expenditure and bone formation and bone mass. This effect was phenocopied, at an even stronger level, by overexpressiong of a dominant-negative DNJunD, a pure AP1 antagonist. Taken together these results suggest that downregulation of AP1 activity in the hypothalamus profoundly increases energy expenditure and bone formation, leading to both a decrease in adipose mass and an increase in bone mass. These findings may have physiological implications since ΔFosB is expressed and regulated in the hypothalamus. © 2012 American Society for Bone and Mineral Research.

Resting-state Functional MRI: Functional Connectivity Analysis of the Visual Cortex in Primary Open-angle Glaucoma Patients

Human Brain Mapping. Mar, 2012  |  Pubmed ID: 22461380

Purpose: To analyze functional connectivity (FC) of the visual cortex using resting-state functional MRI in human primary open-angle glaucoma (POAG) patients. Materials and Methods: Twenty-two patients with known POAG and 22 age-matched controls were included in this IRB-approved study. Subjects were evaluated by 3 T MR using resting-state blood oxygenation level dependent and three-dimensional brain volume imaging (3D-BRAVO) MRI. Data processing was performed with standard software. FC maps were generated from Brodmann areas (BA) 17/18/19/7 in a voxel-wise fashion. Region of interest analysis was used to specifically examine FC among each pair of BA17/18/19/7. Results: Voxel-wise analyses demonstrated decreased FC in the POAG group between the primary visual cortex (BA17) and the right inferior temporal, left fusiform, left middle occipital, right superior occipital, left postcentral, right precentral gyri, and anterior lobe of the left cerebellum. Increased FC was found between BA17 and the left cerebellum, right middle cerebellar peduncle, right middle frontal gyrus, and extra-nuclear gyrus (P < 0.05). In terms of the higher visual cortices (BA18/19), positive FC was disappeared with the cerebellar vermis, right middle temporal, and right superior temporal gyri (P < 0.05). Negative FC was disappeared between BA18/19 and the right insular gyrus (P < 0.05). Region of interest analysis demonstrated no statistically significant differences in FC between the POAG patients relative to the controls (P > 0.05). Conclusion: Changes in FC of the visual cortex are found in patients with POAG. These include alterations in connectivity between the visual cortex and associative visual areas along with disrupted connectivity between the primary and higher visual areas. Hum Brain Mapp, 2012. © 2012 Wiley Periodicals, Inc.

Adenovirus-mediated Hepatocarcinoma-intestine-pancreas/pancreatitis-associated Protein Suppresses Dextran Sulfate Sodium-induced Acute Ulcerative Colitis in Rats

Inflammatory Bowel Diseases. Mar, 2012  |  Pubmed ID: 22419609

BACKGROUND: Although increased expression of hepatocarcinoma-intestine-pancreas/pancreatitis-associated protein (HIP/PAP) has been reported in ulcerative colitis (UC), its role in UC remains unclear. This study was designed to assess the function of HIP/PAP in experimental UC and further to explore its underlying mechanisms. METHODS: Recombinant adenovirus was prepared to mediate ectopic expression of HIP/PAP in the colon of rats. The effect of HIP/PAP on dextran sodium sulfate (DSS)-induced colitis was assessed by disease activity index (DAI), macroscopic, and histological evaluations. Superoxide dismutase (SOD) and myeloperoxidase (MPO) activities, malondialdehyde (MDA) content, and tumor necrosis factor α (TNF-α) and interleukin-6 (IL-6) production were determined in colonic mucosa. Proliferation cell nuclear antigen (PCNA) was immunostained to reflect the proliferation of colonic epithelia. The effects of HIP/PAP on proliferation and H(2) O(2) -induced apoptosis of SW480 and LoVo colonic adenocarcinoma cells were also determined. Gene expression profiles in SW480 after HIP/PAP overexpression were analyzed by microarray analysis. RESULTS: The protective effect of HIP/PAP against DSS-induced colitis in rats was confirmed. Ectopic expression of HIP/PAP resulted in attenuation of oxidative damage, reduction of TNF-α and IL-6 expression, and elevation of epithelial proliferation in colonic mucosa and led to decreased apoptosis and increased proliferation in colonic adenocarcinoma cells. Microarray analysis revealed altered expression of inflammation-related molecules, growth factors, proliferation-related molecules, and antioxidant enzymes under overexpression of HIP/PAP. CONCLUSIONS: HIP/PAP has a protective effect against DSS-induced colitis in rats via inhibiting inflammation, alleviating oxidative damage, and promoting colonic epithelium regeneration. HIP/PAP might represent a new promising therapeutic strategy in UC. (Inflamm Bowel Dis 2012;).

PPARγ Agonist Pioglitazone Improves Scopolamine-induced Memory Impairment in Mice

The Journal of Pharmacy and Pharmacology. Apr, 2012  |  Pubmed ID: 22420664

Objectives  This study was conducted to evaluate the effects of exposure to pioglitazone, a peroxisome proliferator-activated receptor agonist, on cognitive impairment induced by scopolamine, a muscarinic antagonist, in mice. Methods  Pioglitazone (9 mg/kg, 18 mg/kg) was orally administered for 9 days at 30 min before intraperitoneal injection with scopolamine (0.8 mg/kg, i.p.). Cognitive function was evaluated by the passive avoidance test and the Morris water maze test on the 10th day after treatment. Changes in cholinergic system reactivity were also examined by measuring the acetylcholine, acetylcholinesterase and choline acetyltransferase in the hippocampus and cortex. Key findings  Scopolamine injection induced impaired performance in the passive avoidance test and the water maze test and severe decrease of cholinergic system reactivity, as indicated by reduced acetylcholine levels, decreased choline acetyltransferase activity and increased acetylcholinesterase activity. Daily administration of pioglitazone significantly increased step-through latency in passive avoidance test, and significantly decreased the escape latency, and increased the time spent in the platform quadrant in the Morris water maze test. Pioglitazone also protected against scopolamine-induced cholinergic system deficit, including reduced acetylcholine levels, decreased choline acetyltransferase activity and increased acetylcholinesterase activity in the hippocampus or cortex. Conclusions  Pioglitazone demonstrates a significant neuroprotective effect against scopolamine-induced cholinergic system deficit and cognitive impairment.

Structure of TIGIT Immunoreceptor Bound to Poliovirus Receptor Reveals a Cell-cell Adhesion and Signaling Mechanism That Requires Cis-trans Receptor Clustering

Proceedings of the National Academy of Sciences of the United States of America. Mar, 2012  |  Pubmed ID: 22421438

Nectins (nectin1-4) and Necls [nectin-like (Necl1-5)] are Ig superfamily cell adhesion molecules that regulate cell differentiation and tissue morphogenesis. Adherens junction formation and subsequent cell-cell signaling is initiated by the assembly of higher-order receptor clusters of cognate molecules on juxtaposed cells. However, the structural and mechanistic details of signaling cluster formation remain unclear. Here, we report the crystal structure of poliovirus receptor (PVR)/Nectin-like-5/CD155) in complex with its cognate immunoreceptor ligand T-cell-Ig-and-ITIM-domain (TIGIT). The TIGIT/PVR interface reveals a conserved specific "lock-and-key" interaction. Notably, two TIGIT/PVR dimers assemble into a heterotetramer with a core TIGIT/TIGIT cis-homodimer, each TIGIT molecule binding one PVR molecule. Structure-guided mutations that disrupt the TIGIT/TIGIT interface limit both TIGIT/PVR-mediated cell adhesion and TIGIT-induced PVR phosphorylation in primary dendritic cells. Our data suggest a cis-trans receptor clustering mechanism for cell adhesion and signaling by the TIGIT/PVR complex and provide structural insights into how the PVR family of immunoregulators function.

Ischemic Postconditioning Through Percutaneous Transluminal Coronary Angioplasty in Pigs: Roles of PI3K Activation

Coronary Artery Disease. Mar, 2012  |  Pubmed ID: 22421549

BACKGROUND: Ischemic postconditioning (IPOC) has been suggested to reduce ischemic reperfusion injury. It remains unclear whether the activation of phosphatidylinositol 3 kinase (PI3K)/Akt is a causal mechanism in the cardioprotection afforded by IPOC, which was examined in the model of percutaneous transluminal coronary angioplasty (PTCA) minipigs. METHODS AND RESULTS: Minipigs underwent 45-min occlusion of the left anterior descending artery and 24-h reperfusion by PTCA. Postconditioning was elicited by three cycles of 30-s reperfusion followed by 30-s ischemia at the onset of reperfusion. Infarct size was determined by triphenyl tetrazolium chloride staining after 24-h reperfusion, and mRNA and protein expression levels of PI3K were ascertained by reverse transcriptase-PCR and western-blot analysis in biopsies. Infarct size was significantly reduced and myocardial PI3K (Akt and GSK-3β) phosphorylation was significantly increased with IPOC treatment compared with ischemic reperfusion. The administration of the PI3K inhibitor wortmannin (30 µg/kg) attenuated the protection of IPOC in the infarct size and decreased the expression of Akt and GSK-3β phosphorylation compared with IPOC. IPOC had no impact on mRNA expression of AKT and GSK-3β. CONCLUSION: Our findings show that IPOC is capable of protecting the myocardium against IR injury in the PTCA minipig model. The PI3K/Akt-signaling pathway is involved in the cardioprotective effect of IPOC.

Morphology-controlled Synthesis of ZnO Replicas with Photonic Structures from Butterfly (Papilio Paris) Wing Scales for Tunable Optical Properties

Nanoscale. Apr, 2012  |  Pubmed ID: 22422312

ZnO replicas with photonic structures were fabricated from Papilio paris butterfly wing scales and their tunable optical properties were studied. Through modification of the fabrication method, the reticular porous network structure was successfully replicated from dark black (DB) wing scales. The DB wing scale replicas exhibit a photonic band gap (PBG) in the visible region, which overlaps with the visible emission range of ZnO. Both DB and GB (greenish-blue) wing scale replicas can work as one-dimensional diffraction gratings in optical diffraction experiments, whose spot distances can be tuned by different periodic sizes of butterfly wing structure. Moreover, the ZnO DB wing scale replicas exhibit improved photoluminescence (PL) spectra with reduced visible emission and enhanced UV emission, which can both be attributed to the existence of a PBG produced by the reticular porous network structure in DB wing scales. These results can be very helpful in the research of applications of ZnO materials in UV lasing and optical diffraction devices.

Bacillus Subtilis Genome Editing Using SsDNA with Short Homology Regions

Nucleic Acids Research. Mar, 2012  |  Pubmed ID: 22422839

In this study, we developed a simple and efficient Bacillus subtilis genome editing method in which targeted gene(s) could be inactivated by single-stranded PCR product(s) flanked by short homology regions and in-frame deletion could be achieved by incubating the transformants at 42°C. In this process, homologous recombination (HR) was promoted by the lambda beta protein synthesized under the control of promoter P(RM) in the lambda cI857 P(RM)-P(R) promoter system on a temperature sensitive plasmid pWY121. Promoter P(R) drove the expression of the recombinase gene cre at 42°C for excising the floxed (lox sites flanked) disruption cassette that contained a bleomycin resistance marker and a heat inducible counter-selectable marker (hewl, encoding hen egg white lysozyme). Then, we amplified the single-stranded disruption cassette using the primers that carried 70 nt homology extensions corresponding to the regions flanking the target gene. By transforming the respective PCR products into the B. subtilis that harbored pWY121 and incubating the resultant mutants at 42°C, we knocked out multiple genes in the same genetic background with no marker left. This process is simple and efficient and can be widely applied to large-scale genome analysis of recalcitrant Bacillus species.

The Ability of Primary Auditory Cortical (A1) Neurons to Detect Amplitude Modulation with Rate and Temporal Codes: Neurometric Analysis

Journal of Neurophysiology. Mar, 2012  |  Pubmed ID: 22422997

Amplitude modulation (AM) is a common feature of natural sounds, and its detection is biologically important. Even though most sounds are not fully modulated, the majority of physiological studies have focused on fully modulated (100% modulation depth) sounds. We presented AM noise at a range of modulation depths to awake macaque monkeys while recording from neurons in primary auditory cortex (A1). The ability of neurons to detect partial AM with rate and temporal codes was assessed using signal detection methods. On average, single cell synchrony was as or more sensitive than spike count in modulation detection. Cells are less sensitive to modulation depth if tested away from their best modulation frequency, particularly for temporal measures. Mean neural modulation detection thresholds in A1 are not as sensitive as behavioral thresholds, but using phase-locking the most sensitive neurons are more sensitive, suggesting that for temporal measures the lower envelope principle cannot account for thresholds. Three methods of pre-analysis pooling of spike trains (multi-unit, similar to convergence from a cortical column; within-cell, similar to convergence of cells with matched response properties; across-cell, similar to indiscriminate convergence of cells) all result in an increase in neural sensitivity to modulation depth for both temporal and rate codes. For the across-cell method, pooling of a few dozen cells can result in detection thresholds that approximate those of the behaving animal. Using synchrony measures, indiscriminate pooling results in sensitive detection of modulation frequencies between 20-60 Hz, suggesting that differences in AM response phase are minor in A1.

Oxygen Bridges Between NiO Nanosheets and Graphene for Improvement of Lithium Storage

ACS Nano. Mar, 2012  |  Pubmed ID: 22424545

Graphene has been widely used to dramatically improve the capacity, rate capability, and cycling performance of nearly any electrode material for batteries. However, the binding between graphene and these electrode materials has not been clearly elucidated. Here we report oxygen bridges between graphene with oxygen functional groups and NiO from analysis by X-ray photoelectron spectroscopy, Fourier transform infrared spectroscopy, and Raman spectroscopy and confirm the conformation of oxygen bridges by the first-principles calculations. We found that NiO nanosheets (NiO NSs) are bonded strongly to graphene through oxygen bridges. The oxygen bridges mainly originate from the pinning of hydroxyl/epoxy groups from graphene on the Ni atoms of NiO NSs. The calculated adsorption energies (1.37 and 1.84 eV for graphene with hydroxyl and epoxy) of a Ni adatom on oxygenated graphene by binding with oxygen are comparable with that on graphene (1.26 eV). However, the calculated diffusion barriers of the Ni adatom on the oxygenated graphene surface (2.23 and 1.69 eV for graphene with hydroxyl and epoxy) are much larger than that on the graphene (0.19 eV). Therefore, the NiO NS is anchored strongly on the graphene through a C-O-Ni bridge, which allows a high reversible capacity and excellent rate performance. The easy binding/difficult dissociating characteristic of Ni adatoms on the oxygenated graphene facilitates fast electron hopping from graphene to NiO and thus the reversible lithiation and delithiation of NiO. We believe that the understanding of this oxygen bridge between graphene and NiO will lead to the development of other high-performance electrode materials.

Evaluation of a New Real-time PCR Assay for Detection of Mycoplasma Pneumoniae in Clinical Specimens

Biomedical and Environmental Sciences : BES. Feb, 2012  |  Pubmed ID: 22424630

To establish and evaluate a real-time PCR assay to detect Mycoplasma pneumoniae (M.pneumoniae) in clinical specimens.

The Effect of Dietary Soyabean Isoflavones on Photodynamic Therapy in K562 Leukemia Cells

Journal of Photochemistry and Photobiology. B, Biology. Feb, 2012  |  Pubmed ID: 22424954

The soyabean isoflavones genistein (GEN) and daidzein (DA) are popular presented in diet. Isoflavones have a variety of biological activities including antioxidant and anticancer properties. On account of its antioxidant activity, isoflavones might protect cancer cells from free radical damage in photodynamic (PDT) during which reactive oxygen species (ROS) production was stimulated leading to irreversible tumor cell injury. In this study, the influence of GEN and DA on K562 cells in 5-aminolevulinic acid (ALA)-based PDT was demonstrated. The results showed that GEN inhibited cell proliferation and enhance cell apoptosis, lipid peroxidation, and DNA damage in ALA-PDT on K562 cells. However, DA did not enhance cell apoptosis, lipid peroxidation, and DNA damage in ALA-PDT. In conclusion, the results suggested that soy consumption during PDT did not decrease the effectiveness of cancer therapy on malignant cells.

Harvesting of Microalgae by Flocculation with Poly (γ-glutamic Acid)

Bioresource Technology. Feb, 2012  |  Pubmed ID: 22425514

In an effort to search for an efficient and environmentally friendly harvesting method, a commercially available microbial flocculant poly (γ-glutamic acid) (γ-PGA) was used to harvest oleaginous microalgae. Conditions for flocculation of marine Chlorella vulgaris and freshwater Chlorella protothecoides were optimized by response surface methodology (RSM) and determined to be 22.03mgL(-1) γ-PGA, 0.57gL(-1) biomass, and 11.56gL(-1) salinity, and 19.82mgL(-1) γ-PGA and 0.60gL(-1) biomass, respectively. Application of the two optimized flocculation methods to Nannochloropsis oculata LICME 002, Phaeodactylum tricornutum, C. vulgaris LICME 001, and Botryococcus braunii LICME 003 gave no less than 90% flocculation efficiency and a concentration factor greater than 20. Micrographs of the harvested microalgal cells showed no damage to cell integrity, and hence no lipid loss during the process. The results show that flocculation with γ-PGA is feasible for harvesting microalgae for biodiesel production.

TREK1 Activation Mediates Spinal Cord Ischemic Tolerance Induced by Isoflurane Preconditioning in Rats

Neuroscience Letters. Mar, 2012  |  Pubmed ID: 22425721

The aim of this study is to examine the role of one of the two-pore (2P) domain K(+) channels, TREK (TWIK-related K(+) channels, TREK)-1, mediated neuroprotection on spinal cord afforded by isoflurane preconditioning. In Experiment 1, male Sprague-Dawley rats were randomly assigned to control (Con) group, an isoflurane preconditioning (Iso) group, and sham group. Twenty-four hours after the last pretreatment, spinal cord ischemia was induced in Con and Iso groups. Neurobehavioral testing and histopathologic examination were performed after reperfusion. In Experiment 2, the expression of the TREK1 in the spinal cord was assessed by immunohistochemistry, Western blot and real-time polymerase chain reaction. In Experiment 3, Amiloride, a blocker of stretch-sensitive channels, was administered intraperitoneally immediately prior to each isoflurane preconditioning. Iso group showed a significant reductions in motor deficit index as well as increases in the number of normal neurons compared with the Con group. The expression of TREK1 protein and the level of mRNA after ischemia were higher in the rats of the Iso group than those in the Con group. Amiloride pretreatment abolished the protective effects of Iso preconditioning. These finding indicate that isoflurane preconditioning had a neuroprotective effect against spinal cord ischemia reperfusion injury. These effects may be mediated through the TREK1 pathway.

Treated Individuals Who Progress to Action or Maintenance for One Behavior Are More Likely to Make Similar Progress on Another Behavior: Coaction Results of a Pooled Data Analysis of Three Trials

Preventive Medicine. Mar, 2012  |  Pubmed ID: 22425936

OBJECTIVE: This study compared, in treatment and control groups, the phenomena of coaction, which is the probability that taking effective action on one behavior is related to taking effective action on a second behavior. METHODS: Pooled data from three randomized trials of Transtheoretical Model (TTM) tailored interventions (n=9461), completed in the U.S. in 1999, were analyzed to assess coaction in three behavior pairs (diet and sun protection, diet and smoking, and sun protection and smoking). Odds ratios (ORs) compared the likelihood of taking action on a second behavior compared to taking action on only one behavior. RESULTS: Across behavior pairs, at 12 and 24months, the ORs for the treatment group were greater on an absolute basis than for the control group, with two being significant. The combined ORs at 12 and 24months, respectively, were 1.63 and 1.85 for treatment and 1.20 and 1.10 for control. CONCLUSIONS: The results of this study with addictive, energy balance and appearance-related behaviors were consistent with results found in three studies applying TTM tailoring to energy balance behaviors. Across studies, there was more coaction within the treatment group. Future research should identify predictors of coaction in more multiple behavior change interventions.

Serum Profiling Based on Fucosylated Glycoproteins for Differentiating Between Chronic Hepatitis B and Hepatocellular Carcinoma

Biochemical and Biophysical Research Communications. Mar, 2012  |  Pubmed ID: 22425980

Chronic infection with hepatitis B virus (HBV) is associated with the majority of cases of hepatocellular carcinoma (HCC) in China. Despite this, there is no effective method for the early detection of HBV-induced liver cancer. Aberrant fucosylation is known to occur during the development of HCC. We, therefore, developed a method of applying matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS) to analyze the relationship between aberrant fucosylation, tumor genesis and progression of HBV-associated HCC, and to establish proteomic profiling of serum for early diagnosis of HCC. The MALDI-TOF MS was based on Lens culinaris agglutinin (LCA) lectin magnetic beads and their affinity for separation. The method was applied initially to a 'training' cohort of 111 serum samples obtained from subjects in China with no liver disease (n=26), chronic hepatitis B without cirrhosis (n=21), HBV-infected cirrhosis (n=32), or HBV-infected HCC (n=32). In contrast to previous findings, the results of our profiling analysis demonstrated defucosylation on some of the glycoproteins involved in HCC. HCC was then diagnostically classified in a 'blind test' cohort (n=96). In this group we demonstrated that, HCC could be distinguished from all serum samples, HBV-associated chronic liver disease, and HBV-associated cirrhosis with a sensitivity/specificity of 70%/70%, 78%/74%, and 81%/82%, respectively. When combined with serum alpha-fetoprotein detection (AFP>20ng/mL), the sensitivity/specificity improved to 78%/88%, 85%/88%, and 89%/91%, respectively. In conclusion, serum glycoprotein fucosylation abnormalities have diverse forms in patients with HCC. MALDI-TOF MS profiling of aberrant serum fucosylated glycoproteins distinguished HCC from controls with high accuracy.

Functional Selectivity Induced by MGlu(4) Receptor Positive Allosteric Modulation and Concomitant Activation of G(q) Coupled Receptors

Neuropharmacology. Mar, 2012  |  Pubmed ID: 22426233

Metabotropic glutamate receptors (mGlus) are a group of Family C Seven Transmembrane Spanning Receptors (7TMRs) that play important roles in modulating signaling transduction, particularly within the central nervous system. mGlu(4) belongs to a subfamily of mGlus that is predominantly coupled to G(i/o) G proteins. We now report that the ubiquitous autacoid and neuromodulator, histamine, induces substantial glutamate-activated calcium mobilization in mGlu(4)-expressing cells, an effect which is observed in the absence of co-expressed chimeric G proteins. This strong induction of calcium signaling downstream of glutamate activation of mGlu(4) depends upon the presence of H(1) histamine receptors. Interestingly, the potentiating effect of histamine activation does not extend to other mGlu(4)-mediated signaling events downstream of G(i/o) G proteins, such as cAMP inhibition, suggesting that the presence of G(q) coupled receptors such as H(1) may bias normal mGlu(4)-mediated G(i/o) signaling events. When the activity induced by small molecule positive allosteric modulators of mGlu(4) is assessed, the potentiated signaling of mGlu(4) is further biased by histamine toward calcium-dependent pathways. These results suggest that G(i/o)-coupled mGlus may induce substantial, and potentially unexpected, calcium-mediated signaling events if stimulation occurs concomitantly with activation of G(q) receptors. Additionally, our results suggest that signaling induced by small molecule positive allosteric modulators may be substantially biased when G(q) receptors are co-activated. This article is part of a Special Issue entitled 'mGluR'

Safety and Immunogenicity of a Novel Human Enterovirus 71 (EV71) Vaccine: A Randomized, Placebo-controlled, Double-blind, Phase I Clinical Trial

Vaccine. Mar, 2012  |  Pubmed ID: 22426327

There is an urgent need for a novel vaccine that is effective against human Enterovirus 71 (EV71) outbreaks. A double-blind, randomized controlled study was to evaluate the safety and immunogenicity of a human EV71 vaccine in healthy adults, children and infants. The vaccine dosages were 200U and 400U for children and adults, and 100U, 200U and 400U for infants. Subjects were randomized to receive different dosages of the vaccine or placebo. Adults received intramuscular injection on Days 0, 14 and 28. Children and Infants received on Days 0, 28 and 56. The novel human EV71 inactivated vaccine was well tolerated and highly immunogenic in healthy volunteers, especially in infant populations. For immune response, the seropositive rates (with titers ≥≥1:8) of neutralizing antibody [NTAb] increased to 100% for all dosage groups after the second vaccination. For NTAb seronegative infants before vaccination, after one dose, the NTAb GMTs were 29.7 (95% CI, 13.1-67.2), 10.1 (95% CI, 6.6-15.3), and 27.4 (95% CI, 14.3-52.2) in the 100U, 200U, and 400U vaccine groups, respectively; after two doses, the GMTs were 114.1 (95% CI, 44.5-292.4), 159.5 (95% CI, 49.3-515.3), and 509.0 (95% CI, 181.3-1429.1), respectively. Trial registration: ClinicalTrial.gov identifier: NCT01273246 and NCT01273233.

Anti-beta2-glycoprotein I Antibody and Cerebellar Ataxia in Breast Cancer

Lupus. 2012  |  Pubmed ID: 22427365

Genome-wide DNA Methylation Indicates Silencing of Tumor Suppressor Genes in Uterine Leiomyoma

PloS One. 2012  |  Pubmed ID: 22428009

Uterine leiomyomas, or fibroids, represent the most common benign tumor of the female reproductive tract. Fibroids become symptomatic in 30% of all women and up to 70% of African American women of reproductive age. Epigenetic dysregulation of individual genes has been demonstrated in leiomyoma cells; however, the in vivo genome-wide distribution of such epigenetic abnormalities remains unknown.

Colonization and Distribution of Segmented Filamentous Bacteria (SFB) in Chicken Gastrointestinal Tract and Their Relationship with Host Immunity

FEMS Microbiology Ecology. Mar, 2012  |  Pubmed ID: 22429007

Uncultivable segmented filamentous bacteria (SFB) reside in the gastrointestinal (GI) tract of mammals and can boost the host immunity. Immunoglobulin A (IgA) from mother's milk has been previously shown to be a key factor in regulating SFB colonization. Since neonatal chicken cannot acquire IgA from maternal, they are a good model to examine the role of IgA on SFB colonization. Here we used the fluorescent in situ hybridization (FISH) and quantitative PCR (qPCR) to monitor the colonization and distribution of SFB in chickens aged from 2 days to 6 weeks. Early SFB colonization, which primarily occurred in the ileal mucosa (<13-day-old), was IgA-independent. From age of 17 to 42 days, there was an increase of IgA in the gut mucosa, which was correlated with a decrease of SFB. To examine the effect of probiotics and immunosuppression on SFB colonization, we treated the chickens by feeding them Lactobacillus delbrueckii or giving them a subcutaneous injection of cyclophosphamide (CTX). Feeding lactobacilli at birth rendered SFB colonization occurring 4 days earlier, while CTX treatment increases the SFB colonization through reducing the other non-SFB bacteria. Altogether, our data suggest that early colonization of SFB in chicken occurs independently of IgA and the population of SFB in the GI tract of chicken may be manipulated from birth via probiotic or CTX treatment. © 2012 Federation of European Microbiological Societies. Published by Blackwell Publishing Ltd. All rights reserved.

Immunogenicity Study of Plasmid DNA Encoding Mouse Cysteine-Rich Secretory Protein-1 (mCRISP1) As a Contraceptive Vaccine

American Journal of Reproductive Immunology (New York, N.Y. : 1989). Mar, 2012  |  Pubmed ID: 22429321

PROBLEM: To examine the immunocontraceptive properties of the plasmid pcDNA-mCRISP1 and compare them to the corresponding recombinant mCRISP1 (r-mCRISP1). METHOD OF STUDY: RT-PCR and indirect immunofluorescence were performed to observe the mCRISP1 protein expression in COS-7 cells. Three groups of mice received three injections of r-mCRISP1, pcDNA-mCRISP1 or pcDNA vector, respectively. ELISA and Western blot were used to examine the immune responses and immunoreactivity of antisera. Sperm-egg penetration assay was performed to examine the effect of anti-mCRISP1 antibodies in vitro fertilization of mouse oocytes. Fertility and mean litter size were analysed by natural mating. Histological analysis was carried out to look for potential immunopathologic effects of the antibodies. RESULTS: COS-7 cells transfected with pcDNA-mCRISP1 present the expression of mCRISP1. Both r-mCRISP1 and pcDNA-mCRISP1 raised an immune response against r-mCRISP1 protein and native CRISP1 in mouse sperm. The titres of anti-mCRISP1 antibodies from DNA immunized mice were significantly lower than that of r-mCRISP1 immunized mice, but it lasted relatively longer. Male and female pcDNA-mCRISP1 injected animals presented a statistically significant reduction in their fertility with no signs of immunopathologic effects. CONCLUSION: These studies demonstrated the feasibility of generating an immune response to mCRISP1 protein by DNA vaccine and pcDNA-mCRISP1 plasmid causing significant anti-fertility potential.

Diffusion Tensor Imaging for Predicting Hand Motor Outcome in Chronic Stroke Patients

The Journal of International Medical Research. 2012  |  Pubmed ID: 22429352

Previous studies have indicated that diffusion tensor imaging (DTI) values are related to clinical outcome in stroke patients. This prospective study explored whether DTI values were predictive for hand function outcome in chronic stroke patients.

Co-Expression of XIAP and Cyclin D1 Complex Correlates with a Poorer Prognosis in Patients with Hepatocellular Carcinoma

The American Journal of Pathology. Mar, 2012  |  Pubmed ID: 22429965

Hepatocellular carcinoma (HCC) is one of the most common malignant tumors in the world. Despite improved diagnosis and treatment, the prognosis for HCC patients remains poor. The goal of this study was to identify key regulatory proteins and signaling pathways important for cell apoptosis and proliferation as biomarkers for prognostication and targeted therapy. Protein Pathway Array was applied to screen 38 signaling proteins and phosphoproteins in 12 paired HCC tumors and surrounding benign tissues and found that 20 of them, including XIAP, CDK4, CDK6, and Cyclin D1, were overexpressed in HCC tissues. Immunostaining results of XIAP, CDK4, and Cyclin D1 in an additional 59 HCC tissues showed that the expression of XIAP correlated with the expression of CDK4/Cyclin D1, and that the increased expression of these proteins correlated with poorer overall survival in these patients. Further studies using the HCC Huh7 cell line transfected with XIAP siRNA or expression vector demonstrated that XIAP regulated the expression of CDK4, CDK6, and Cyclin D1 via NF-êB and PTEN pathways. Finally, inhibition of XIAP using embelin, a XIAP-specific small molecule, leads to an increased apoptosis and decreased cell proliferation via arrest at G1 phase. Taken together, XIAP is a central modulator regulating cell apoptosis and cell cycle progression. Therefore, XIAP together with cell cycle regulatory proteins can be used as prognostic markers and therapeutic targets.

Fifteen Non-CODIS Autosomal Short Tandem Repeat Loci Multiplex Data from Nine Population Groups Living in Taiwan

International Journal of Legal Medicine. Mar, 2012  |  Pubmed ID: 22430197

The analysis of autosomal short tandem repeat (STR) loci is a powerful tool in forensic genetics. We developed a multiplex system in which 15 non-Combined DNA Index System autosomal STRs (D3S1744, D4S2366, D8S1110, D10S2325, D12S1090, D13S765, D14S608, Penta E, D17S1294, D18S536, D18S1270, D20S470, D21S1437, Penta D, and D22S683) could be amplified in one single polymerase chain reaction. DNA samples from 1,098 unrelated subjects of nine population groups living in Taiwan, including Taiwanese Han, indigenous Taiwanese of Taiwan Island, Tao, mainland Chinese, Filipinos, Thais, Vietnamese, Indonesians, and Caucasians, were collected and analyzed using this system. The distributions of the allelic frequencies and the forensic parameters of each population group were presented. The combined discrimination power and the combined power of exclusion were high in all population groups tested in this study. A multidimensional scaling plot of these nine population groups based on the Reynolds' genetic distances calculated from 15 autosomal STRs was constructed, and the genetic substructure in this area was presented. In conclusion, this 15 autosomal STR multiplex system provides highly informative STR data and appears useful in forensic casework and parentage testing in different populations.

Thioester-isocyanides: Versatile Reagents for the Synthesis of Cycle-tail Peptides

Chemical Communications (Cambridge, England). Apr, 2012  |  Pubmed ID: 22430393

A novel class of reagents, thioester isocyanides, have been prepared and applied in the synthesis of peptide macrocycles. The isocyanide part of the molecule is deployed in a multicomponent macrocyclization step. This step is followed by chemoselective peptide ligation at the thioester part of the macrocycle. Our method can now be used for rapid assembly and evaluation of cycle-tail peptides.

Prevalence and Genotype Distribution of Human Papillomavirus Infection Among Female Sex Workers in Guangxi, China: Implications for Interventions

Journal of Medical Virology. May, 2012  |  Pubmed ID: 22431029

Human papillomavirus (HPV) infection is a major public health concern in women, but information on HPV among female sex workers in China is limited. The aim of the study was to estimate the prevalence and genotype distribution of HPV infection among female sex workers in two cities in Guangxi, China. A total of 811 female sex workers were recruited from venues between July and September of 2009. Data on socio-demographic and behavior characteristics were collected, and cervical swabs were collected to determine HPV infection and genotype distribution. The overall prevalence of infection with any HPV type was 38.9%. HPV type 52 was the most prevalent type with prevalence of 11%, followed by HPV types 16, 58, 53, and CP8304, with prevalences of 6.5%, 5.7%, 5.6%, and 4.8%, respectively. HPV 16 or 18 accounted for 23.2% of all HPV positive cases. Age group <20 years was significantly associated with infection of the high-risk and multiple types of HPV infection. A higher prevalence of multiple HPV infection was observed among female sex workers from the outdoor venues (14.0%; 95%CI, 10.6%-17.3%). These findings have important implications for developing HPV prevention programs including HPV vaccination in female sex workers. J. Med. Virol. 84:798-803, 2012. © 2012 Wiley Periodicals, Inc.

Crystal Structure of a Complete Ternary Complex of T-cell Receptor, Peptide-MHC, and CD4

Proceedings of the National Academy of Sciences of the United States of America. Mar, 2012  |  Pubmed ID: 22431638

Adaptive immunity depends on specific recognition by a T-cell receptor (TCR) of an antigenic peptide bound to a major histocompatibility complex (pMHC) molecule on an antigen-presenting cell (APC). In addition, T-cell activation generally requires binding of this same pMHC to a CD4 or CD8 coreceptor. Here, we report the structure of a complete TCR-pMHC-CD4 ternary complex involving a human autoimmune TCR, a myelin-derived self-peptide bound to HLA-DR4, and CD4. The complex resembles a pointed arch in which TCR and CD4 are each tilted ∼65° relative to the T-cell membrane. By precluding direct contacts between TCR and CD4, the structure explains how TCR and CD4 on the T cell can simultaneously, yet independently, engage the same pMHC on the APC. The structure, in conjunction with previous mutagenesis data, places TCR-associated CD3εγ and CD3εδ subunits, which transmit activation signals to the T cell, inside the TCR-pMHC-CD4 arch, facing CD4. By establishing anchor points for TCR and CD4 on the T-cell membrane, the complex provides a basis for understanding how the CD4 coreceptor focuses TCR on MHC to guide TCR docking on pMHC during thymic T-cell selection.

Co-inherited β-thalassemia Trait and HbH Disease: Clinical Characteristics and Interference in Diagnosis of Thalassemia by High-performance Liquid Chromatography

International Journal of Laboratory Hematology. Mar, 2012  |  Pubmed ID: 22433173

Introduction:  To identify the clinical and hematological characteristics in a large group of patients with combined HbH disease and β-thalassemia trait. Methods:  Hemoglobinopathy analysis and full genotyping identified a cohort of patients with HbH disease, β-thalassemia trait, or combined HbH disease and β-thalassemia trait. Results:  Co-inheritance of β-thalassemia trait and HbH disease significantly decreased the mean corpuscular volume (MCV) in 27 patients when compared to 287 patients with HbH disease alone. The combined condition also alleviated anemia in nondeletional HbH disease but not in the deletional cases. Beta-thalassemia trait also significantly decreased the expression of HbH, Hb Constant Spring when present, and HbA(2) , with levels as low as 3.6% on high-performance liquid chromatography (HPLC). Conclusion:  These cases, although relatively common in the South Chinese population, may be difficult do diagnose correctly when only examined on HPLC. Therefore, molecular analysis of the α and β globin genes should be done in all cases with hemolytic anemia and low MCV without clear HbH disease or β-thalassemia parameters.

Fabrication of Nanoelectrode Ensembles by Electrodepositon of Au Nanoparticles on Single-layer Graphene Oxide Sheets

Nanoscale. Apr, 2012  |  Pubmed ID: 22434054

Nanoelectrode ensembles (NEEs) have been fabricated by the electrodeposition of Au nanoparticles (AuNPs) on single-layer graphene oxide (GO) sheets coated on a glassy carbon electrode (GCE). The fabricated NEEs show a typical sigmoidal shaped voltammetric profile, arising from the low coverage density of AuNPs on GCE and large distance among them, which can be easily controlled by varying the electrodeposition time. As a proof of concept, after the probe HS-DNA is immobilized on the NEEs through the Au-S bonding, the target DNA is detected with the methylene blue intercalator. Our results show that the target DNA can be detected as low as 100 fM, i.e. 0.5 amol DNA in 5 μL solution.

Interferon Regulatory Factor 7 Regulates Glioma Stem Cells Via Interleukin-6 and Notch Signalling

Brain : a Journal of Neurology. Mar, 2012  |  Pubmed ID: 22434214

Inflammatory microenvironment signalling plays a crucial role in tumour progression (i.e. cancer cell proliferation, survival, angiogenesis and metastasis) in many types of human malignancies. However, the role of inflammation in brain tumour pathology remains poorly understood. Here, we report that interferon regulatory factor 7 is a crucial regulator of brain tumour progression and heterogeneity. Ectopic expression of interferon regulatory factor 7 in glioma cells promotes tumorigenicity, angiogenesis, microglia recruitment and cancer stemness in vivo and in vitro through induction of interleukin 6, C-X-C motif chemokine 1 and C-C motif chemokine 2. In particular, interferon regulatory factor 7-driven interleukin 6 plays a pivotal role in maintaining glioma stem cell properties via Janus kinase/signal transducer and activator of transcription-mediated activation of Jagged-Notch signalling in glioma cells and glioma stem cells derived from glioma patients. Accordingly, the short hairpin RNA-mediated depletion of interferon regulatory factor 7 in glioma stem cells markedly suppressed interleukin 6-Janus kinase/signal transducer and activator of transcription-mediated Jagged-Notch-signalling pathway, leading to decreases in glioma stem cell marker expression, tumoursphere-forming ability, and tumorigenicity. Furthermore, in a mouse model of wound healing, depletion of interferon regulatory factor 7 suppressed tumour progression and decreased cellular heterogeneity. Finally, interferon regulatory factor 7 was overexpressed in patients with high-grade gliomas, suggesting its potential as an independent prognostic marker for glioma progression. Taken together, our findings indicate that interferon regulatory factor 7-mediated inflammatory signalling acts as a major driver of brain tumour progression and cellular heterogeneity via induction of glioma stem cell genesis and angiogenesis.

BaGa(2)MQ(6) (M = Si, Ge; Q = S, Se): a New Series of Promising IR Nonlinear Optical Materials

Dalton Transactions (Cambridge, England : 2003). Mar, 2012  |  Pubmed ID: 22434416

The four compounds BaGa(2)MQ(6) (M = Si, Ge; Q = S, Se) have been identified as a new series of IR nonlinear optical (NLO) materials and are promising for practical applications. They are isostructural and crystallize in the noncentrosymmetric polar space group R3 of the trigonal system. Their three-dimensional framework is composed of corner-sharing (Ga/M)Q(4) (M = Si, Ge; Q = S, Se) tetrahedra with Ba(2+) cations in the cavities. The polar alignment of one (Ga/M)-Q2 bond for each (Ga/M)Q(4) tetrahedra along the c direction is conducive to generating a large NLO response, which was confirmed by powder second-harmonic generation (SHG) using a 2090 nm laser as fundamental wavelength. The SHG signal intensities of the two sulfides were close to that of AgGaS(2) and those for the two selenides were similar as that of AgGaSe(2). The large band gaps of 3.75(2) eV, 3.23(2) eV, 2.88(2) eV, and 2.22 (2) eV for BaGa(2)SiS(6), BaGa(2)GeS(6), BaGa(2)SiSe(6), and BaGa(2)GeSe(6), respectively, will be very helpful to increase the laser damage threshold. Moreover, all the four BaGa(2)MQ(6) (M = Si, Ge; Q = S, Se) compounds exhibit congruent-melting behavior, which indicates that bulk crystals needed for practical applications can be obtained by the Bridgman-Stockbarger method. The calculated birefringence indicates that these materials may be phase-matchable in the IR region and the calculated SHG coefficients agree with the experimental observations. According to our preliminary study, the BaGa(2)MQ(6) compounds represent a new series of promising IR nonlinear optical (NLO) materials which do not belong to the traditional chalcopyrite-type materials such as AgGaQ2 (Q = S, Se) and ZnGeP(2).

Fabrication of Graphene Nanomesh by Using an Anodic Aluminum Oxide Membrane As a Template

Advanced Materials (Deerfield Beach, Fla.). Mar, 2012  |  Pubmed ID: 22434606

Large-area graphene nanomesh (GNM) is prepared using a new and effective method, in which the O(2) plasma treatment is used with an anodic aluminum oxide (AAO) membrane as an etch mask (figure). By varying the pore size and cell wall thickness of the AAO membrane, GNM with tunable pore size and neck width can be prepared. As proof of concept, a field-effect transistor with 15 nm neck width GNM as the conductive channel is fabricated, which exhibits p-type semiconducting behavior.

An Association Study of Single Nucleotide Polymorphisms of the FOXP3 Intron-1 and the Risk of Psoriasis Vulgaris

Indian Journal of Biochemistry & Biophysics. Feb, 2012  |  Pubmed ID: 22435141

Psoriasis vulgaris (PV) is a common autoimmune disease that involves the dysfunction of CD4+CD25+ regulatory T cells. FOXP3 is a key transcription factor in the development and function of CD4+CD25+ regulatory T cells. Previous studies have demonstrated a genetic association between the FOXP3 gene and some autoimmune diseases. To elucidate the association between the FOXP3 gene and the risk of PV, 408 patients diagnosed with PV and 363 age and sex-matched healthy controls from a cohort of the Chinese majority Han population were recruited. Four single nucleotide polymorphisms (rs2232365, rs3761547, rs3761548 and rs3761549) of the FOXP3 gene were analyzed using the polymerase chain reaction and ligase detection reaction. The major allele of three single nucleotide polymorphisms (SNPs - rs2232365 A, rs3761547 A and rs3761549 C) were associated with an increased risk of PV in a clinical subgroup of female patients, who were less than 40 yrs of age, had a family history of the disease and did not have disease complications (p < 0.05 for all parameters). The haplotype was structured between rs3761547 and rs3761549. An increased risk of PV was observed in haplotype A/A-T/T (p = 0.0055; adjusted OR = 3.188; 95% CI = 0.4354-23.34) and A/G-C/C (p = 0.0082; adjusted OR = 1.288; 95% CI = 0.1529-10.85) between rs3761547 and rs3761549. A synergistic effect was found among the three SNPs. Subjects with the rs2232365AA- rs3761547 AG + GG genotype were more susceptible to PV (p = 0.0393; OR = 2.90; 95% CI = 1.05-7.97). No correlation was found between rs3761548 and the onset of PV. Therefore, the FOXP3 polymorphisms appear to contribute to the risk of psoriasis among the Chinese majority Han population. These findings may aid in our understanding of the pathogenesis of psoriasis.

Discovery and Extensive in Vitro Evaluations of NK-HDAC-1: a Chiral Histone Deacetylase Inhibitor As a Promising Lead

Journal of Medicinal Chemistry. Mar, 2012  |  Pubmed ID: 22435669

Herein, further SAR studies of lead compound NSC746457 1 were performed, including the replacement of trans-styryl moiety with a 2-substituted benzo-hetero aromatic ring, and the introduction of a substituent onto the central methylene carbon. A promising chiral lead, S-(E)-3-(1-(1-(Benzo[d]oxazol-2-yl)-2-methylpropyl)-1H-1,2,3-triazol-4-yl)-N-hydroxyacrylamide (12, NK-HDAC-1), was discovered, and showed about one order of magnitude more potent than SAHA in in both enzymatic and cellular assays. For the in vitro safety tests, NK-HDAC-1 was far less toxic to non-transformed cell than tumor cells, and showed no significant inhibition activity against CYP-3A4. The pharmaceutical properties (LogD, solubility, liver micrsomal stability (t1/2), plasma stability (t1/2) and apparent permeability) strongly suggested that NK-HDAC-1 might be superior to SAHA in bioavailability and in vivo half-life.

Developing Red-Emissive Ruthenium(II) Complex-Based Luminescent Probes for Cellular Imaging

Bioconjugate Chemistry. Mar, 2012  |  Pubmed ID: 22435834

Ruthenium(II) complexes own rich photophysical attributes, which enables novel design of responsive luminescence probes to selectively quantify biochemical analytes. In this work we developed a systematic series of Ru(II)-bipyrindine complex derivatives, [Ru(bpy)3-n(DNP-bpy)n](PF6)2 (n = 1, 2, 3; bpy: 2,2'-bipyridine; DNP-bpy: 4-(4-(2,4-dinitrophenoxy)phenyl)-2,2'-bipyridine), as luminescent probes for highly selective and sensitive detection of thiophenol in aqueous solutions. The specific reaction between the probes and thiophenol triggers the cleavage of the electron acceptor group, 2,4-dinitrophenyl, eliminating the photo-induced electron transfer (PET) process, so that the luminescence of on-state complexes, [Ru(bpy)3-n(HP-bpy)n]2+ (n = 1, 2, 3; HP-bpy: 4-(4-hydroxyphenyl)-2,2'-bipyridine), is turned on. We found that the complex [Ru(bpy)(DNP-bpy)2]2+ remarkably enhanced the on-to-off contrast ratio compared to the other two (37.8 comparing to 21 and 18.7). This reveals a new strategy to obtain the best Ru(II) complex luminescence probe via the most asymmetric structure. Moreover, we demonstrated the practical utility of the complex as a cell-membrane permeable probe for quantitative luminescence imaging of the dynamic intracellular process of thiophenol in living cells. The results suggest that the new probe could be a very useful tool for luminescence imaging analysis of the toxic thiophenol in intact cells.

Synthesis of 2, 5-Disubstituted Oxazoles and Oxazolines Catalyzed by Ruthenium (II) Porphyrin and Simple Copper Salts

The Journal of Organic Chemistry. Mar, 2012  |  Pubmed ID: 22436032

A novel and efficient synthesis of 2, 5-disubstituted oxazoles and oxazolines involving ruthenium (II) porphyrin-copper chloride catalyzed cyclization was developed. These reactions use readily available benzene carboxylic acids and phenylethenes or phenylacetylenes and are performed under mild conditions. The reactions proceed in series, giving rise to the formation of an intermolecular C-N bond and an intramolecular C-O bond, which yield oxazole and oxazoline derivatives simultaneously.

Validated Reversed Phase-high Performance Liquid Chromatography-diode Array Detector Method for the Quantitation of Rutin, a Natural Immunostimulant for Improving Survival in Aquaculture Practice, in Toonea Sinensis Folium

Pharmacognosy Magazine. Jan, 2012  |  Pubmed ID: 22438663

Rutin is a bioflavonoid of strong immunostimulating activity from the Toonea Sinensis Folium, which has shown a significant ability to increase the survival rate of white shrimp with bacterial infection. However, no method for the quantitation of this active ingredient in the herb has been reported to date.

Fluoroscopically Guided Three-tube Insertion for the Treatment of Postoperative Gastroesophageal Anastomotic Leakage

Korean Journal of Radiology : Official Journal of the Korean Radiological Society. Mar, 2012  |  Pubmed ID: 22438685

To retrospectively evaluate the feasibility and effectiveness of three-tube insertion for the treatment of postoperative gastroesophageal anastomotic leakage (GEAL).

Finger Vein Recognition Based on a Personalized Best Bit Map

Sensors (Basel, Switzerland). 2012  |  Pubmed ID: 22438735

Finger vein patterns have recently been recognized as an effective biometric identifier. In this paper, we propose a finger vein recognition method based on a personalized best bit map (PBBM). Our method is rooted in a local binary pattern based method and then inclined to use the best bits only for matching. We first present the concept of PBBM and the generating algorithm. Then we propose the finger vein recognition framework, which consists of preprocessing, feature extraction, and matching. Finally, we design extensive experiments to evaluate the effectiveness of our proposal. Experimental results show that PBBM achieves not only better performance, but also high robustness and reliability. In addition, PBBM can be used as a general framework for binary pattern based recognition.

IL-35 Is a Novel Responsive Anti-inflammatory Cytokine - A New System of Categorizing Anti-inflammatory Cytokines

PloS One. 2012  |  Pubmed ID: 22438968

It remains unknown whether newly identified anti-inflammatory/immunosuppressive cytokine interleukin-35 (IL-35) is different from other anti-inflammatory cytokines such as IL-10 and transforming growth factor (TGF)-β in terms of inhibition of inflammation initiation and suppression of full-blown inflammation. Using experimental database mining and statistical analysis methods we developed, we examined the tissue expression profiles and regulatory mechanisms of IL-35 in comparison to other anti-inflammatory cytokines. Our results suggest that in contrast to TGF-β, IL-35 is not constitutively expressed in human tissues but it is inducible in response to inflammatory stimuli. We also provide structural evidence that AU-rich element (ARE) binding proteins and microRNAs target IL-35 subunit transcripts, by which IL-35 may achieve non-constitutive expression status. Furthermore, we propose a new system to categorize anti-inflammatory cytokines into two groups: (1) the house-keeping cytokines, such as TGF-β, inhibit the initiation of inflammation whereas (2) the responsive cytokines including IL-35 suppress inflammation in full-blown stage. Our in-depth analyses of molecular events that regulate the production of IL-35 as well as the new categorization system of anti-inflammatory cytokines are important for the design of new strategies of immune therapies.

Clinical Characteristics of Acinetobacter Baumannii Complex Bacteremia in Patients Receiving Total Parenteral Nutrition

Journal of the Chinese Medical Association : JCMA. Mar, 2012  |  Pubmed ID: 22440267

Acinetobacter baumannii complex (Abc) comprises at least three phenotypically undifferentiated species, including A baumannii, Acinetobacter genomic species 3 (AGS 3) and Acinetobacter genomic species 13TU (AGS 13TU). Abc bacteremia had rarely been described in patients receiving total parenteral nutrition (TPN). In this study, we aimed to determine any differences in the clinical features of patients having TPN and bacteremia due to A baumannii and those due to nonbaumannii Abc (including AGS 3 and AGS 13TU).

The Association of Mean Glucose Level and Glucose Variability with Intensive Care Unit Mortality in Patients with Severe Acute Pancreatitis

Journal of Critical Care. Apr, 2012  |  Pubmed ID: 22440387

The objective of this study was to retrospectively analyze the association of mean glucose level (MGL) and glycemic lability index (GLI; as a measure of glucose variability) with intensive care unit (ICU) mortality in patients with severe acute pancreatitis (SAP).

Ligands Located Within a Cholesterol Domain Enhance Gene Delivery to the Target Tissue

Journal of Controlled Release : Official Journal of the Controlled Release Society. Mar, 2012  |  Pubmed ID: 22440429

Targeted gene delivery provides enormous potential for clinical treatment of many incurable diseases. Liposomes formulated with targeting ligands have been tested extensively both in vitro and in vivo, and many studies have strived to identify more efficacious ligands. However, the environment of the ligand within the delivery vehicle is generally not considered, and this study assesses the effect of ligand microenvironment by utilizing a lipoplex possessing a cholesterol domain. Our recent work has shown that the presence of the targeting ligand within the cholesterol domain promotes more productive transfection in cultured cells. In the present study, lipoplexes having the identical lipid composition were formulated with different conjugates of the folate ligand such that the ligand was included in, or excluded from, the cholesterol domain. The effect of locating the ligand within the cholesterol domain was then tested in a xenograft tumor model in mice. Lipoplexes that included the ligand within the cholesterol domain showed significantly higher luciferase expression and plasmid accumulation in tumors as compared to lipoplexes in which the ligand was excluded from the domain. These results demonstrate that the microenvironment of the ligand can affect gene delivery to tumors, and show that ligand-mediated delivery can be enhanced by locating targeting ligands within a cholesterol domain.

Meta-analysis on the Comparison Between Two Topical Calcineurin Inhibitors in Atopic Dermatitis

The Journal of Dermatology. Mar, 2012  |  Pubmed ID: 22409418

Topical calcineurin inhibitors have proved to be suitable for the treatment of AD. We conducted a meta-analysis comparing efficacy and tolerance of tacrolimus with pimecrolimus in treatment of AD. According to our meta-analysis, tacrolimus 0.1% was more effective than pimecrolimus 1% in adult patients (week 3: risk ratio [RR] 0.55, 95% confidence interval [CI] 0.42-0.73), and tacrolimus (a combination of 0.03% and 0.1%) was also more effective than pimecrolimus 1% in pediatric patients (week 6/end of study: RR 0.76, 95% CI 0.63-0.92). Regardless of age or illness severity, tacrolimus 0.1% had higher efficacy than pimecrolimus 1% in the treatment of AD (week 3: RR 0.55, 95% CI 0.42-0.72). In adult patients, tacrolimus 0.1% had more adverse events than pimecrolimus 1% (RR 1.30, 95% CI 1.02-1.66), but the incidence of adverse events between tacrolimus 0.1% (or 0.03%) and pimecrolimus 1% was not significantly different in pediatric patients. No matter whether the patients were adult or pediatric, more pimecrolimus-treated patients withdrew from the trials because of a lack of efficacy. Regardless of age and illness severity, more pimecrolimus 1%-treated patients withdrew from the trials because of a lack of efficacy, compared with tacrolimus 0.1% (or 0.03%)-treated patients. More pimecrolimus-treated pediatric patients withdrew from the trials because of adverse events (RR 0.26, 95% CI 0.1-0.68). More pimecrolimus 1%-treated patients withdrew from the trials because of adverse events, compared with tacrolimus 0.03%-treated patients, regardless of age (RR 0.1, 95% CI 0.02-0.53). In conclusion, tacrolimus ointment has higher efficacy and better tolerance than pimecrolimus cream in treatment of AD.

Recent Progress Using High-throughput Sequencing Technologies in Plant Molecular Breeding

Journal of Integrative Plant Biology. Mar, 2012  |  Pubmed ID: 22409591

High-throughput sequencing is a revolutionary technological innovation in DNA sequencing. This technology has an ultra-low cost per base of sequencing and an overwhelmingly high data output. High-throughput sequencing has brought novel research methods and solutions to the research fields of genomics and post-genomics. Furthermore, this technology is leading to a new molecular breeding revolution that has landmark significance for scientific research and enables us to launch multi-level, multi-faceted, and multi-extent studies in the fields of crop genetics, genomics, and crop breeding. In this paper, we review progress in the application of high-throughput sequencing technologies to plant molecular breeding studies.

The Neural Mechanisms of Percept-memory Comparison in Visual Working Memory

Biological Psychology. Mar, 2012  |  Pubmed ID: 22410263

Researchers have revealed that comparing the perceptual input with the representations stored in visual working memory initiates a rapid attention-shift, which is predominantly triggered by the relevant-feature change. The comprehension of the change contents further necessitates a follow-up comparison that contrasts all the object features regardless of the task relevancy. However, whether such a distinct stage exists and how the process is carried on need further verification. We explored this issue by investigating the underlying neural mechanisms of the percept-memory comparison. By recording EEG, we found that both the task-relevant and -irrelevant feature changes elicited significantly more negative anterior N2 waves (230-340ms) rooting in the anterior cingulate cortex (ACC), and meanwhile activated the frontal theta (5-8Hz, 250-550ms). These results suggest that a distinct comparison stage does exist, which is supported by the anterior N2, ACC and frontal theta.

Intestinal Permeability of Forskolin by In Situ Single Pass Perfusion in Rats

Planta Medica. Mar, 2012  |  Pubmed ID: 22411728

The intestinal permeability of forskolin was investigated using a single pass intestinal perfusion (SPIP) technique in rats. SPIP was performed in different intestinal segments (duodenum, jejunum, ileum, and colon) with three concentrations of forskolin (11.90, 29.75, and 59.90 µg/mL). The investigations of adsorption and stability were performed to ensure that the disappearance of forskolin from the perfusate was due to intestinal absorption. The results of the SPIP study indicated that forskolin could be absorbed in all segments of the intestine. The effective permeability (P (eff)) of forskolin was in the range of drugs with high intestinal permeability. The P (eff) was highest in the duodenum as compared to other intestinal segments. The decreases of P (eff) in the duodenum and ileum at the highest forskolin concentration suggested a saturable transport process. The addition of verapamil, a P-glycoprotein inhibitor, significantly enhanced the permeability of forskolin across the rat jejunum. The absorbed fraction of dissolved forskolin after oral administration in humans was estimated to be 100 % calculated from rat P (eff). In conclusion, dissolved forskolin can be absorbed readily in the intestine. The low aqueous solubility of forskolin might be a crucial factor for its poor oral bioavailability.

Detail-Preserving Controllable Deformation from Sparse Examples

IEEE Transactions on Visualization and Computer Graphics. Mar, 2012  |  Pubmed ID: 22411887

Recent advances in laser scanning technology have made it possible to faithfully scan a real object with tiny geometric details, such as pores and wrinkles. However, a faithful digital model should not only capture static details of the real counterpart but also be able to reproduce the deformed versions of such details. In this paper, we develop a data-driven model that has two components; the first accommodates smooth large-scale deformations and the second captures high-resolution details. Large-scale deformations are based on a nonlinear mapping between sparse control points and bone transformations. A global mapping, however, would fail to synthesize realistic geometries from sparse examples, for highly-deformable models with a large range of motion. The key is to train a collection of mappings defined over regions locally in both the geometry and the pose space. Deformable fine-scale details are generated from a second nonlinear mapping between the control points and per-vertex displacements. We apply our modeling scheme to scanned human hand models, scanned face models, face models reconstructed from multiview video sequences, and manually constructed dinosaur models. Experiments show that our deformation models, learned from extremely sparse training data, are effective and robust in synthesizing highly-deformable models with rich fine features, for keyframe animation as well as performance-driven animation.

Sensitivity to Silthiofam, Tebuconazole and Difenoconazole of Gaeumannomyces Graminis Var. Tritici Isolates from China

Pest Management Science. Jan, 2012  |  Pubmed ID: 22411909

BACKGROUND: Wheat take-all caused by Gaeumannomyces graminis var. tritici (Ggt) has become an emerging threat to wheat production in the last few years. Silthiofam is very effective against Ggt, and recently it has been widely used for the control of take-all in China. However, farmers have noted a decline in control efficacy with this compound in some wheat fields, suggesting that the pathogen may have developed resistance to silthiofam. RESULTS: Of the 66 Ggt isolates collected from different locations in China, 27 were resistant to silthiofam. There was no cross-resistance between silthiofam and tecuconazole or difenoconazole. The effectiveness of silthiofam in controlling take-all was compromised on wheat inoculated with silthiofam-resistant isolates. Based on the DNA fingerprinting generated by microsatellite PCR, two predominant genetic clusters were found among these isolates and were clearly associated with the sensitivity to silthiofam. CONCLUSION: Silthiofam has a high risk in the development of resistance in Ggt. Tebuconazole and difenoconazole show great potential for control of take-all on wheat. Results from this study provide useful information for take-all control and the management of fungicide resistance. Copyright © 2012 Society of Chemical Industry.

Liposomes Prolong the Therapeutic Effect of Anti-asthmatic Medication Via Pulmonary Delivery

International Journal of Nanomedicine. 2012  |  Pubmed ID: 22412300

The main objective of this study was to develop a novel aerosolized liposome formulation for pulmonary delivery of anti-asthmatic medication and to explore the relationship between the bioavailability and anti-asthmatic efficacy of such a formulation. Asthma treatment usually requires frequent administration of medication for sustained bronchodilating response. Liposomes are known for their capability for sustained drug release and thus would be a suitable delivery system for anti-asthmatic medication for prolonged therapeutic effect. Salbutamol sulfate (SBS) was chosen as the model drug in this study because of its high water solubility and fast absorption after administration.

Dichloridobis(4-pyridylmethyl 1H-pyrrole-2-carboxyl-ate-κN)zinc

Acta Crystallographica. Section E, Structure Reports Online. Mar, 2012  |  Pubmed ID: 22412460

In the title mol-ecule, [ZnCl(2)(C(11)H(10)N(2)O(2))(2)], the Zn(II) ion, situated on a twofold axis, is in a distorted tetra-hedral coordination environment formed by two chloride anions and two pyridine N atoms of the two organic ligands. In the pyrrole-2-carboxyl-ate unit, the pyrrole N-H group and the carbonyl group point approximately in the same direction. The dihedral angle between the two pyridine rings is 54.8 (3)°. The complex mol-ecules are connected into chains extending along [101] by N-H⋯Cl hydrogen bonds. The chains are further assembled into (-101) layers by C-H⋯O and C-H⋯Cl inter-actions.

Bis(1H-benzimidazole-κN)bis-[2-(naphthalen-1-yl)acetato-κO,O']manganese(II) Monohydrate

Acta Crystallographica. Section E, Structure Reports Online. Mar, 2012  |  Pubmed ID: 22412463

In the title compound, [Mn(C(12)H(9)O(2))(2)(C(7)H(6)N(2))(2)]·H(2)O, the Mn(II) ion is located on a twofold rotation axis and six-coordinated, displaying a distorted MnN(2)O(4) octa-hedral geometry. The crystal packing is stabilized by N-H⋯O hydrogen bonds, which give rise to a one-dimensional structure along [001], and π-π inter-actions between the imidazole rings and between the benzene rings of the 2-(naphthalen-1-yl)acetate ligands [centroid-centroid distances = 3.761 (3) and 3.728 (4) Å]. The contribution of the electron density associated with the disordered water molecules was not considerd in the final structure model.

Tetra-kis(μ-naphthalene-1-acetato-κO:O')bis-[(N,N-dimethyl-formamide-κO)copper(II)]

Acta Crystallographica. Section E, Structure Reports Online. Mar, 2012  |  Pubmed ID: 22412477

The asymmetric unit of the title compound, [Cu(2)(C(12)H(9)O(2))(4)(C(3)H(7)NO)(2)], contains two independent centrosymmetric dinuclear copper(II) complexes. The central paddle-wheel units are formed by four bridging bidentate naphthalene-1-acetate ligands with two dimethyl-formamide ligands in the axial positions. The unique Cu(II) ions have slightly distorted square-pyramidal coordination geometries. One of the naphthalene rings is disordered over two sets of sites, with refined occpancies of 0.535 (4) and 0.465 (4).

5-({[(E)-Benzyl-idene-amino]-oxy}meth-yl)-1,3,4-thia-diazol-2-amine

Acta Crystallographica. Section E, Structure Reports Online. Mar, 2012  |  Pubmed ID: 22412643

In the mol-ecule of the title compound, C(10)H(10)N(4)OS, the configuration about the C=N double bond is E. The dihedral angle between the thia-diazole and benzene rings is 81.1 (1)°. In the crystal, mol-ecules are linked by N-H⋯N and C-H⋯O hydrogen bonds to form a two-dimensional network parallel with the bc plane.

(E)-(2-Chloro-benzyl-idene)amino 2-amino-4-chloro-benzoate

Acta Crystallographica. Section E, Structure Reports Online. Mar, 2012  |  Pubmed ID: 22412644

In the title compound, C(14)H(10)Cl(2)N(2)O(2), the configuration about the C=N double bond is E and the dihedral angle between the benzene rings is 1.75 (5)°. An intra-molecular N-H⋯O inter-action generates an S(6) ring. In the crystal, mol-ecules are linked by N-H⋯O hydrogen bonds, resulting in [101] chains.

Nuclear Factor κB-Dependent Anti-inflammatory Effects of S-Allyl Cysteine and S-Propyl Cysteine in Kidney of Diabetic Mice

Journal of Agricultural and Food Chemistry. Mar, 2012  |  Pubmed ID: 22394022

Renal protection of s-allyl cysteine (SAC) and s-propyl cysteine (SPC) in diabetic mice against inflammatory injury was examined. Each agent at 0.5 and 1 g/L was added to the drinking water for 10 weeks. SAC or SPC intake significantly reduced the plasma blood urea nitrogen level and increased creatinine clearance (P < 0.05). These treatments significantly lowered the renal level of reactive oxygen species, nitric oxide, interleukin-6, tumor necrosis factor-α, and prostaglandin E(2) in diabetic mice (P < 0.05). Renal mRNA expression of inducible nitric oxide synthase, cyclooxygenase-2, protein kinase C (PKC)-α, PKC-β, and PKC-γ was enhanced in diabetic mice (P < 0.05); however, SAC or SPC treatments dose dependently declined mRNA expression of these factors (P < 0.05). Nuclear factor κB (NF-κB) activity, mRNA expression, and protein production in kidney of diabetic mice were significantly increased (P < 0.05). SAC or SPC intake dose dependently suppressed NF-κB activity, NF-κB p65 mRNA expression, and protein level (P < 0.05). Diabetes also enhanced renal protein expression of mitogen-activated protein kinase (P < 0.05). SAC and SPC, only at a high dose, significantly suppressed protein production of p-p38 and p-ERK1/2 (P < 0.05). Renal mRNA expression and protein generation of peroxisome proliferator-activated receptor (PPAR)-α and PPAR-γ were significantly down-regulated in diabetic mice (P < 0.05), but the intake of SAC or SPC at high dose up-regulated PPAR-α and PPAR-γ (P < 0.05). These findings support that SAC and SPC are potent anti-inflammatory agents against diabetic kidney diseases.

Uniform Carbon Layer Coated Mn(3)o(4) Nanorod Anodes with Improved Reversible Capacity and Cyclic Stability for Lithium Ion Batteries

ACS Applied Materials & Interfaces. Mar, 2012  |  Pubmed ID: 22394097

A facile one-step solvothermal reaction route to large-scale synthesis of carbon homogeneously wrapped manganese oxide (Mn(3)O(4)@C) nanocomposites for anode materials of lithium ion batteries was developed using manganese acetate monohydrate and polyvinylpyrrolidone as precursors and reactants. The synthesized Mn(3)O(4)@C nanocomposites were characterized by X-ray diffraction, field-emission scanning electron microscopy, high resolution transmission electron microscopy, X-ray photoelectron spectroscopy, and Raman spectroscopy. The synthesized tetragonal structured Mn(3)O(4) (space group I41/amd) samples display nanorodlike morphology, with a width of about 200-300 nm and a thickness of about 15-20 nm. It is shown that the carbon layers with a thickness of 5 nm are homogeneously coated on the Mn(3)O(4) nanorods. It is indicated from lithium storage capacity estimation that the Mn(3)O(4)@C samples display enhanced capacity retention on charge/discharge cycling. Even after 50 cycles, the products remains stable capacity of 473 mA h g(-1), which is as much 3.05 times as that of pure Mn(3)O(4) samples. Because of the low-cost, nonpollution, and stable capacity, the carbon homogeneously coated Mn(3)O(4)@C nanocomposites are promising anode material for lithium ion batteries.

Determination and Depletion of Dehydroacetic Acid Residue in Chicken Tissues

Food Additives & Contaminants. Part A, Chemistry, Analysis, Control, Exposure & Risk Assessment. Feb, 2012  |  Pubmed ID: 22394145

A high-performance liquid chromatography (HPLC) method was developed to determine dehydroacetic acid (DHA) residues in chicken muscle, liver and kidney. DHA was extracted using acetonitrile, and clean-up performed using a strong anion exchange (PAX) SPE column. The cleaned-up samples were separated by HPLC with a C18 column and determined at 290 nm. Extraction recoveries of DHA from samples fortified at 0.5-5 mg/kg levels ranged from 88.2% to 93.9% in muscle, 83.8% to 86.6% in liver and 83.8% to 89.8% in kidney, with coefficients of variation <6.44%. The limit of detection was 0.05 mg/kg and limit of quantification was 0.2 mg/kg. DHA was not detectable in muscle at 13-15 days after final administration of DHA, at 11 days in kidney and 17 days in liver. The method described herein is suitable for routine quantitative analyses of DHA in animal tissues and can be easily applied to the analysis of other matrices such as milk, serum and tissue samples from other animals.

Clinical Significance of Carcinoembryonic Antigen-, Cytokeratin 19-, or Survivin-positive Circulating Tumor Cells in the Peripheral Blood of Esophageal Squamous Cell Carcinoma Patients Treated with Radiotherapy

Diseases of the Esophagus : Official Journal of the International Society for Diseases of the Esophagus / I.S.D.E. Mar, 2012  |  Pubmed ID: 22394149

Circulating tumor cells (CTCs) have been associated with clinical outcome in various malignancies. The aim of this study was to examine CTC status in the peripheral blood of patients with esophageal squamous cell carcinoma (ESCC) before and after radiotherapy, and to evaluate its clinical significance. A total of 72 ESCC patients treated with radical radiotherapy were enrolled in this study. The nested reverse-transcriptase polymerase chain reaction was used to detect the three representative markers of CTCs, namely carcinoembryonic antigen, cytokeratin 19, and survivin. The results showed that CTC(+), a status with positive expression of at least one of these three markers, in patients with ESCC pre- and post-radiotherapy were 54.2% (39/72) and 38.9% (28/72), respectively (P= 0.059). Furthermore, CTC (+) in patients pre- or post-radiotherapy was both correlated with lymph metastasis and adverse 2-year progression-free survival. It was also found that changes in CTC status after radiotherapy could reflect patients' response to radiotherapy. The response rates in cases with CTC status pre-radiotherapy(+)/post-radiotherapy(+), pre-radiotherapy(-)/post-radiotherapy(+), pre-radiotherapy(-)/post-radiotherapy(-), pre-radiotherapy(+)/post-radiotherapy(-) were 58.3% (21/36), 0% (0/3), 73.7% (14/19), and 85.7% (12/14), respectively. In a multivariate analysis of Cox proportional hazard model, only CTC (+) post-radiotherapy was an independent unfavorable prognostic factor for ESCC apart from subsequent chemotherapy and patients' Karnofsky performance status scores. In conclusion, positive detection of CTCs in patients with ESCC after radiotherapy may be a promising biomarker for radiation efficiency and prognosis assessment in ESCC.

Pediatric ALK-positive Large B-cell Lymphoma: a Case Report and Review of the Literature

Pediatric and Developmental Pathology : the Official Journal of the Society for Pediatric Pathology and the Paediatric Pathology Society. Mar, 2012  |  Pubmed ID: 22394191

Abstract We present a case of pediatric anaplastic lymphoma kinase positive large B-cell lymphoma (ALK-positive LBCL) with cervical, mesentery and pelvis cavity mass. Histological examination of cervical mass revealed the lesion was composed of diffuse large immunoblastic-like or plasmablastic-like tumor cells with a sinusoidal growth pattern. The tumor cells showed strongly immunoreactive for ALK in a granular cytoplasmic distribution and diffusely positive for CD45, CD4, CD138, epithelial membrane antigen (EMA) and MUM-1, but negative for CD20 and CD79a. The patient underwent five courses of chemotherapy with E-CHOP regimen and obtained remarkable clinical response with regression of mesentery and pelvis cavity mass. We suggest this distinct subtype of large B-cell lymphoma should belong to the spectrum of pediatric lymphomas, and radiologic examination should be performed to inspect the progression of disease even if the patients had complete remission at initial chemotherapy.

One-Step, Multiplexed Fluorescence Detection of MicroRNAs Based on Duplex-Specific Nuclease Signal Amplification

Journal of the American Chemical Society. Mar, 2012  |  Pubmed ID: 22394262

Traditional molecular beacons, widely applied for detection of nucleic acids, have an intrinsic limitation on sensitivity, as one target molecule converts only one beacon molecule to its fluorescent form. Herein, we take advantage of the duplex-specific nuclease (DSN) to create a new signal-amplifying mechanism, duplex-specific nuclease signal amplification (DSNSA), to increase the detection sensitivity of molecular beacons (Taqman probes). DSN nuclease is employed to recycle the process of target-assisted digestion of Taqman probes, thus, resulting in a significant fluorescence signal amplification through which one target molecule cleaves thousands of probe molecules. We further demonstrate the efficiency of this DSNSA strategy for rapid direct quantification of multiple miRNAs in biological samples. Our experimental results showed a quantitative measurement of sequence-specific miRNAs with the detection limit in the femtomolar range, nearly 5 orders of magnitude lower than that of conventional molecular beacons. This amplification strategy also demonstrated a high selectivity for discriminating differences between miRNA family members. Considering the superior sensitivity and specificity, as well as the multiplex and simple-to-implement features, this method promises a great potential of becoming a routine tool for simultaneously quantitative analysis of multiple miRNAs in tissues or cells, and supplies valuable information for biomedical research and clinical early diagnosis.

Heme Activates TLR4-mediated Inflammatory Injury Via MyD88/TRIF Signaling Pathway in Intracerebral Hemorrhage

Journal of Neuroinflammation. Mar, 2012  |  Pubmed ID: 22394415

ABSTRACT: BACKGROUND: Inflammatory injury plays a critical role in intracerebral hemorrhage (ICH)-induced neurological deficits; however, the signaling pathways are not apparent by which the upstream cellular events trigger innate immune and inflammatory responses that contribute to neurological impairments. Toll-like receptor 4 (TLR4) plays a role in inflammatory damage caused by brain disorders. METHODS: In this study, we investigate the role of TLR4 signaling in ICH-induced inflammation. In the ICH model, a significant upregulation of TLR4 expression in reactive microglia has been demonstrated using real-time RT-PCR. Activation of microglia was detected by immunohistochemistry, cytokines were measured by ELISA, MyD88, TRIF and NF-kappaB were measured by Western blot and EMSA, animal behavior was evaluated by animal behavioristics. RESULTS: Compared to WT mice, TLR4/ mice had restrained ICH-induced brain damage showing in reduced cerebral edema and lower neurological deficit scores. Quantification of cytokines including IL-6, TNF-alpha and IL-1beta and assessment of macrophage infiltration in perihematoma tissues from TLR4/, MyD88/ and TRIF/ mice showed attenuated inflammatory damage after ICH. TLR4/ mice also exhibited reduced MyD88 and TRIF expression which was accompanied by decreased NF-kappaB activity. This suggests that after ICH both MyD88 and TRIF pathways might be involved in TLR4-mediated inflammatory injury possibly via NF-kappaB activation. Exogenous hemin administration significantly increased TLR4 expression and microglial activation in cultures and also exacerbated brain injury in WT mice but not in TLR4/ mice. Anti-TLR4 antibody administration suppressed hemin-induced microglial activation in cultures and in the mice model of ICH. CONCLUSIONS: Our findings suggest that heme potentiates microglial activation via TLR4, in turn inducing NF-kappaB activation via the MyD88/TRIF signaling pathway, and ultimately increasing cytokine expression and inflammatory injury in ICH. Targeting TLR4 signaling may be a promising therapeutic strategy for ICH.

Single-cell Exome Sequencing Reveals Single-nucleotide Mutation Characteristics of a Kidney Tumor

Cell. Mar, 2012  |  Pubmed ID: 22385958

Clear cell renal cell carcinoma (ccRCC) is the most common kidney cancer and has very few mutations that are shared between different patients. To better understand the intratumoral genetics underlying mutations of ccRCC, we carried out single-cell exome sequencing on a ccRCC tumor and its adjacent kidney tissue. Our data indicate that this tumor was unlikely to have resulted from mutations in VHL and PBRM1. Quantitative population genetic analysis indicates that the tumor did not contain any significant clonal subpopulations and also showed that mutations that had different allele frequencies within the population also had different mutation spectrums. Analyses of these data allowed us to delineate a detailed intratumoral genetic landscape at a single-cell level. Our pilot study demonstrates that ccRCC may be more genetically complex than previously thought and provides information that can lead to new ways to investigate individual tumors, with the aim of developing more effective cellular targeted therapies.

Understanding the Phase Contrast Optics to Restore Artifact-free Microscopy Images for Segmentation

Medical Image Analysis. Feb, 2012  |  Pubmed ID: 22386070

Phase contrast, a noninvasive microscopy imaging technique, is widely used to capture time-lapse images to monitor the behavior of transparent cells without staining or altering them. Due to the optical principle, phase contrast microscopy images contain artifacts such as the halo and shade-off that hinder image segmentation, a critical step in automated microscopy image analysis. Rather than treating phase contrast microscopy images as general natural images and applying generic image processing techniques on them, we propose to study the optical properties of the phase contrast microscope to model its image formation process. The phase contrast imaging system can be approximated by a linear imaging model. Based on this model and input image properties, we formulate a regularized quadratic cost function to restore artifact-free phase contrast images that directly correspond to the specimen's optical path length. With artifacts removed, high quality segmentation can be achieved by simply thresholding the restored images. The imaging model and restoration method are quantitatively evaluated on microscopy image sequences with thousands of cells captured over several days. We also demonstrate that accurate restoration lays the foundation for high performance in cell detection and tracking.

Fabrication of One-dimensional Fe(3)O(4)/P(GMA-DVB) Nanochains by Magnetic-field-induced Precipitation Polymerization

Journal of Colloid and Interface Science. May, 2012  |  Pubmed ID: 22386309

One-dimensional (1D) magnetic Fe(3)O(4)/P(GMA-DVB) peapod-like nanochains have been successfully synthesized by magnetic-field-induced precipitation polymerization using Fe(3)O(4) as building blocks and P(GMA-DVB) as linker. The Fe(3)O(4) microspheres without surface modification can be arranged with the direction of the external magnetic field in a line via the dipolar interaction between Fe(3)O(4) microspheres and linked permanently via P(GMA-DVB) coating during precipitation polymerization. The length of peapod-like nanochains can be controlled by magnetic field intensity, and the thickness of polymer shell can be tuned by the amount of monomers. Magnetic measurement revealed that these 1D peapod-like nanochains showed highly magnetic sensitivity. In the presence of magnetic field, 1D magnetic Fe(3)O(4)/P(GMA-DVB) peapod-like nanochains can be oriented and aligned along the direction of external magnetic field.

Regulation of CD44 Expression by Tumor Necrosis Factor-α and Its Potential Role in Breast Cancer Cell Migration

Biomedicine & Pharmacotherapy = Biomédecine & Pharmacothérapie. Mar, 2012  |  Pubmed ID: 22386367

CD44 molecule plays critical role in distant malignant metastasis. It is expressed in standard form (CD44s) or variant form (CD44v). Tumor necrosis factor-α (TNF-α) is highly expressed in the cancer microenvironment. TNF-α was reported to modulate CD44 expression in several kinds of cancer. However, little is known about pathological role of TNF-α in breast cancer (BC) cells. In the current investigation, we investigated the effect of TNF-α on BC cells (MCF-7 and MDA-MB-231) viability, CD44 expression, and in vitro migration. We found that TNF-α down-regulated CD44s expression, up-regulated CD44v3 and CD44v6 expression through JNK pathway in MCF-7 cells. In MDA-MB-231 cells, TNF-α up-regulated CD44s, CD44v3 and CD44v6 expression via p38 pathway. These data indicate important role of CD44 molecule in BC pathology.

A "signal-on" Electrochemical Aptasensor for Simultaneous Detection of Two Tumor Markers

Biosensors & Bioelectronics. Apr, 2012  |  Pubmed ID: 22386488

In this paper, we report a "signal-on" electrochemical aptasensor for simultaneous determination of two tumor markers MUC1 and VEGF(165), by using a ferrocene-labeled aptamer-complementary DNA (cDNA) as probe. Since the cDNA immobilized on an electrode surface can hybridize with both MUC1 aptamer and VEGF(165) aptamer to form a long double strand with ferrocene far away from the electrode surface, the probe cannot give electrochemical signal. Nevertheless, the presence of the two tumor markers will inhibit the hybridization of cDNA with the aptamers, thus the distance between ferrocene and the electrode is changed, and a "signal-on" electrochemical method to detect two tumor markers is developed. Experimental results show that the electrochemical signal increases with the addition of either tumor markers, but the biggest electrochemical signal can only be obtained when both tumor markers are present. Therefore, the proposed electrochemical aptasensor can not only detect the two markers but also distinguish their co-existence. It may also display high selectivity and sensitivity towards the detection of the tumor markers, so it might have potential clinical application in the future.

Generation and Characterization of HD(5) and C-terminal Mutant HD(5m) Transgenic Rats

Brain Research. Feb, 2012  |  Pubmed ID: 22386496

Dopamine D(1)-like receptors play important roles in many brain activities such as cognition and emotion. We have generated human hD(5) and mutant human hD(5) (hD(5m)) transgenic rats. The C-terminal juxtamembrane domain of mutant hD(5) was identical to that of hD5 pseudogenes. The transgenes were driven by the CAMKII promoter that led the expression mainly in the cerebral cortex and hippocampus. We have used different dopamine receptor agonists to compare the pharmacological profiles of the human hD(5) and hD(5m) receptors. The results showed that they exhibited distinct pharmacological properties. Our results of pharmacological studies indicated that the C-terminal of D(5) receptor could play important roles in agonist binding affinity. Hippocampal long-term potentiation (LTP) evoked by tetanic stimulation was significantly reduced in both transgenic rats. In addition, we found that the overexpression of dopamine hD(5) and hD(5m) receptors in the rat brain resulted in memory impairments. Interestingly, an atypical D(1)-like receptor agonist, SKF83959, could induce anxiety in hD(5m) receptor transgenic rats but had no effect on the anxiety-like behavior in D(5) receptor transgenic and wild-type rats.

Comparison of the Effects of Five Pretreatment Methods on Enhancing the Enzymatic Digestibility and Ethanol Production from Sweet Sorghum Bagasse

Bioresource Technology. Feb, 2012  |  Pubmed ID: 22386628

To improve the enzymatic digestibility of sweet sorghum bagasse and bioethanol production, five pretreatment methods have been investigated and compared, including (1) dilute NaOH solution autoclaving pretreatment, (2) high concentration NaOH solution immersing pretreatment, (3) dilute NaOH solution autoclaving and H(2)O(2) immersing pretreatment, (4) alkaline peroxide pretreatment and (5) autoclaving pretreatment. Among them, the best result was obtained when sweet sorghum bagasse was dilute NaOH solution autoclaving and H(2)O(2) immersing pretreatment. The highest cellulose hydrolysis yield, total sugar yield and ethanol concentration were 74.29%, 90.94g sugar/100g dry matter and 6.12g/L, respectively, which were 5.88, 9.54 and 19.13 times higher than the control. Moreover, the FTIR and SEM analysis illustrated significant molecule and surface structure changes of the sweet sorghum bagasse after pretreatments.

A 90-day Subchronic Toxicological Assessment of Dioscin, a Natural Steroid Saponin, in Sprague-Dawley Rats

Food and Chemical Toxicology : an International Journal Published for the British Industrial Biological Research Association. Feb, 2012  |  Pubmed ID: 22386816

Dioscin is the major active compound in many traditional Chinese medicines (TCMs), while safety evaluation of this natural product has not yet been investigated. Therefore, the aim of this study was to evaluate the 90-day subchronic toxicity of dioscin in rats. The rats were divided into four groups and dioscin was administered orally at doses of 0, 75, 150 and 300mg/kg/day, respectively. The toxicity of dioscin was evaluated based on clinical observations, ophthalmic examination, body weight, food and water consumption, urinalysis, hematology, clinical biochemistry and pathology. The results showed that dioscin had no subchronic toxicity in female rats and had slight subchronic toxicity in male rats. However, male rats in the 300mg/kg/day group showed slight gastro-intestinal tract distension during the treatment period and hemolytic anemia in the hematology assessment. Compared with the control group, body weight gain was significantly decreased in male rats. Other significant changes were not associated with dioscin in the male and female groups. In conclusion, the no-observed-adverse-effect level (NOAEL) and the lowest-observed-adverse-effect level (LOAEL) of dioscin are estimated to be 300mg/kg/day for female and male rats, respectively. Our work provides useful data for further research and new drug exploration of dioscin.

Toxic and Recovery Effects of Copper on Caenorhabditiselegans by Various Food-borne and Water-borne Pathways

Chemosphere. Mar, 2012  |  Pubmed ID: 22386928

Copper pollutions are typical heavy metal contaminations, and their ability to move up food chains urges comprehensive studies on their effects through various pathways. Currently, four exposure pathways were prescribed as food-borne (FB), water-borne plus clean food (WCB), water-food-borne (WFB) and water-borne (WB). Caenorhabditiselegans was chosen as the model organism, and growth statuses, feeding abilities, the amounts of four antioxidant enzymes, and corresponding recovery effects under non-toxic conditions with food and without food were investigated. Based on analysis results, copper concentrations in exposure were significantly influenced by the presence of food and its uptake by C.elegans. Both exposure and recovery effects depended on exposure concentrations and food conditions. For exposure pathways with food, feeding abilities and growth statuses were generally WFBFB>WCB>WFB (p<0.05), while the antioxidant activities were all inhibited in a concentration-dependent fashion. In conclusion, contaminated food was the primary exposure pathway, and various pathways caused different responses of C.elegans.

Continuous in Vitro Cultivation of a Recently Identified Babesia That Infects Small Ruminants in China

Veterinary Parasitology. Feb, 2012  |  Pubmed ID: 22386948

Babesia sp. Xinjiang was isolated from a splenectomised sheep infested by Rhipicephalus sanguineus and Hylomma anatolicum anatolicum, collected from sheep and cattle in Xinjiang province. It was considered to be a novel ovine Babesia species on the basis of its morphology, pathogenicity, vector tick species and alignments of 18S ribosomal RNA (18S rRNA) and internal transcribed spacers (ITS) gene sequences. Continuous in vitro cultures of the ovine parasite were established using infected sheep blood. In RPMI 1640 medium with 7.5% sheep red blood cells (RBCs) maintained in an incubator at 37°C and 5% CO(2), the percentage of parasitized erythrocytes (PPE) peaked at 10% in 24- and 6-well plates. It increased to 20-50% with the same culture medium but with 2.5% RBC in 75cm(2) flasks. Two clonal lines of Babesia sp. Xinjiang were screened using the limiting dilution method. Growth characteristics of these lines in vitro were measured by a microtiter-based spectrophotometric method and from the PPE. The generation time in sheep erythrocytes was between 15.20h and 16.27h. Furthermore, the host range of parasite was identified with in vitro culture and in vivo infection. Erythrocytes of sheep, cattle, sika deer and humans could be invaded into by lines in vitro, but the parasites could not propagate in human erythrocytes. The parasites could not enter erythrocytes from goats in vitro. However, in vivo, only sheep could be infected by lines. Finally, a Babesia sp. Xinjiang-like parasite (which shared 99.5% identity with the original strain of Babesia sp. Xinjiang) was isolated using this in vitro culture system from 1 of 19 sheep blood samples collected from western Gansu province, China.

In Vitro Activity of Cepharanthine Hydrochloride Against Clinical Wild-type and Lamivudine-resistant Hepatitis B Virus Isolates

European Journal of Pharmacology. Feb, 2012  |  Pubmed ID: 22387093

Hepatitis B virus (HBV) infection causes major public health problems worldwide. The clinical limitation of current antiviral drugs for HBV, such as lamivudine, is the emergence of drug-resistant viral strains during prolonged antiviral therapy. Cepharanthine hydrochloride (CH), a natural alkaloid-derived compound, has been reported to possess potent activity against various viruses. The present study was performed to evaluate the in vitro activity of CH against clinical wild-type and lamivudine-resistant HBV isolates in transiently transfected cells. HBV DNA was extracted from serum samples collected both before lamivudine therapy and at the time of viral breakthrough and was amplified by polymerase chain reaction (PCR). The amplicons were cloned into a novel expression vector, pHY106, which can initiate the intracellular HBV replication cycle after cell transfection. Following transfection of the cloned amplicon into HepG2 cells, a drug susceptibility assay was performed. The level of viral antigen, HBeAg, was determined by enzyme-linked immunosorbent assay (ELISA). Quantitative real-time PCR (Q-PCR) was used for determining the amount of intracellular HBV DNA. Heat stress cognate 70 (Hsc70), a host protein required for HBV replication, was also analyzed by reverse transcription PCR (RT-PCR) to explore the possible antiviral mechanism of CH. The results showed that CH inhibited replication and HBeAg production by either wild-type or lamivudine-resistant HBV clinical isolates in a dose-dependent manner. The Hsc70 mRNA was also downregulated significantly. In conclusion, CH is active against both wild-type and lamivudine-resistant HBV clinical isolates, and its activity may be associated with its inhibition of host Hsc70.

Impacts on Influenza A(H1N1)pdm09 Infection from Cross-protection of Seasonal Trivalent Influenza Vaccines and A(H1N1)pdm09 Vaccines: Systematic Review and Meta-analyses

Vaccine. Mar, 2012  |  Pubmed ID: 22387221

Cross-protection by seasonal trivalent influenza vaccines (TIVs) against pandemic influenza A H1N1 2009 (now known as A[H1N1]pdm09) infection is controversial; and the vaccine effectiveness (VE) of A(H1N1)pdm09 vaccines has important health-policy implications. Systematic reviews and meta-analyses are needed to assess the impacts of both seasonal TIVs and A(H1N1)pdm09 vaccines against A(H1N1)pdm09.We did a systematic literature search to identify observational and/or interventional studies reporting cross-protection of TIV and A(H1N1)pdm09 VE from when the pandemic started (2009) until July 2011. The studies fulfilling inclusion criteria were meta-analysed. For cross-protection and VE, respectively, we stratified by vaccine type, study design and endpoint. Seventeen studies (104,781 subjects) and 10 studies (2,906,860 subjects), respectively, reported cross-protection of seasonal TIV and VE of A(H1N1)pdm09 vaccines; six studies (17,229 subjects) reported on both. Thirteen studies (95,903 subjects) of cross-protection, eight studies (859,461 subjects) of VE, and five studies (9,643 subjects) of both were meta-analysed and revealed: (1) cross-protection for confirmed illness was 19% (95% confident interval=13-42%) based on 13 case-control studies with notable heterogeneity. A higher cross-protection of 34% (9-52%) was found in sensitivity analysis (excluding five studies with moderate/high risk of bias). Further exclusion of studies that recruited early in the pandemic (when non-recipients of TIV were more likely to have had non-pandemic influenza infection that may have been cross-protective) dramatically reduced heterogeneity. One RCT reported cross-protection of 38% (19-53%) for confirmed illness. One case-control study reported cross-protection of 50% (40-59%) against hospitalisation. (2) VE of A(H1N1)pdm09 for confirmed illness was 86% (73-93%) based on 11 case-control studies and 79% (22-94%) based on two cohort studies; VE against medically-attended ILI was 32% (8-50%) in one cohort study. TIVs provided moderate cross-protection against both laboratory-confirmed A(H1N1)pdm09 illness (based on eight case-control studies with low risk of bias and one RCT) and also hospitalisation. A finding of increased risk from seasonal vaccine was limited to cases recruited early in the pandemic. A(H1N1)pdm09 vaccines were highly effective against confirmed A(H1N1)pdm09 illness. Although cross-protection was less than the direct effect of strain-specific vaccination against A(H1N1)pdm09, TIV was generally beneficial before A(H1N1)pdm09 vaccine was available.

Ryanodine Receptor Inhibition Potentiates the Activity of Na Channel Blockers Against Spontaneous Calcium Elevations and Delayed Afterdepolarizations in Langendorff-Perfused Rabbit Ventricles

Heart Rhythm : the Official Journal of the Heart Rhythm Society. Feb, 2012  |  Pubmed ID: 22387372

BACKGROUND: Na channel blockers are effective in suppressing delayed afterdepolarizations (DADs) in isolated Purkinje fibers. However, in isolated mouse ventricular myocytes lacking calsequestrin, only Na channel blockers which also inhibit ryanodine receptor (RyR2) channels were effective against spontaneous Ca elevation (SCaE) and DADs. OBJECTIVE: To test the hypothesis that combined Na channel and RyR2 channel blocker (R-propafenone) is more effective than a Na channel blocker (lidocaine) in suppressing SCaE and DADs in the intact rabbit ventricles. METHODS: We compared R-propafenone (3 μmol/L) with lidocaine (50 μmol/L) on SCaE and DAD using epicardial optical mapping of intracellular calcium (Ca(i)) and membrane voltage in Langendorff-perfused rabbit hearts. SCaE and DADs were induced by rapid pacing trains and isoproterenol (0.3 μmol/L) infusion. One arbitrary unit (AU) is equivalent to the Ca transient amplitude of paced beats. RESULTS: SCaEs were observed at cessation of rapid pacing in all hearts at baseline. R-propafenone nearly completely inhibited DADs and SCaE (0.04 [95% confidence interval, CI, 0.02 to 0.06] AU versus 0.23 [Cl 0.18 to 0.28] AU at baseline, n=6 hearts, P<0.001). Lidocaine also significantly reduced the SCaE, but was significantly (P<0.05) less effective than R-propafenone. Both drugs increased rise-time of action potential upstroke and reduced conduction velocity to similar extent, suggesting significant inhibition of I(Na). CONCLUSIONS: Both Na blockers significantly reduced tachycardia-induced SCaEs in the rabbit ventricles, but R-propafenone was significantly more effective than lidocaine. These data suggest that RyR2 inhibition potentiates the activity of Na channel blockers against SCaE and DADs in the intact hearts.

Identification of a Diacylglycerol Acyltransferase 2 Gene Involved in Pheromone Biosynthesis Activating Neuropeptide Stimulated Pheromone Production in Bombyx Mori

Journal of Insect Physiology. Mar, 2012  |  Pubmed ID: 22387497

Diacylglycerol acyltransferase (DGAT) catalyzes the final step in triacylglycerol biosynthesis. In the present study, a DGAT2 gene from Bombyx mori was characterized. Temporal expression profiles indicated that BmDGAT2 steadily increased from 96h before eclosion (-96h) to an expression peak in the pheromone glands (PGs) of new-emerged female (0h), a key stage for sex pheromone production. Spatial expression analysis revealed that the BmDGAT2 transcript was most richly expressed in PGs. Decapitation and subsequent methoprene, a juvenile hormone (JH) analog, treatment experiments revealed that JH had no influence on the expression of BmDGAT2 transcript before emergence, but inhibited the expression of BmDGAT2 transcript when administered to newly emerged adults. Further RNAi analysis confirmed that the decrease in BmDGAT2 mRNA level caused a significant reduction in sex pheromone production. Thus, DGAT2 is a key enzyme regulating B. mori sex pheromone synthesis and release.

Characterization of Cancer Stem-like Cells Derived from a Side Population of a Human Gallbladder Carcinoma Cell Line, SGC-996

Biochemical and Biophysical Research Communications. Mar, 2012  |  Pubmed ID: 22387537

The cancer stem cell (CSC) hypothesis proposes that CSCs, which can renew themselves proliferate infinitely, and escape chemotherapy, become the root of recurrence and metastasis. Previous studies have verified that side population (SP) cells, characterized by their ability to efflux lipophilic substrate Hoechst 33342, to share many characteristics of CSCs in multiplying solid tumors. The purpose of this study was to sort SP cells from a human gallbladder carcinoma cell line, SGC-996 and to preliminarily identify the biological characteristics of SP cells from the cell line. Using flow cytometry we effectively sorted SP cells from the cell line SGC-996. SP cells not only displayed higher proliferative, stronger clonal-generating, more migratory and more invasive capacities, but showed stronger resistance. Furthermore, our experiments demonstrated that SP cells were more tumorigenic than non-SP counterparts in vivo. Real-time PCR analysis and immunocytochemistry showed that the expression of ATP-binding cassette subfamily G member 2 (ABCG2) was significantly higher in SP cells. Hence, these results collectively suggest that SP cells are progenitor/stem-like cells and ABCG2 might be a candidate marker for SP cells in human gallbladder cancer.

Clickable Inverse Opal: a Useful Platform for Fabrication of Stimuli-responsive Photonic Materials

Chemical Communications (Cambridge, England). Mar, 2012  |  Pubmed ID: 22388636

Based on azide-containing clickable inverse opal, a strategy for efficiently fabricating functional photonic materials was developed. By using three types of ethynylated compounds as model molecules, it is found that different functional groups can be facilely introduced into the prepared inverse opal via click reaction to access various inverse opaline materials.

A Sensor-adaptor Mechanism for Enterovirus Uncoating from Structures of EV71

Nature Structural & Molecular Biology. Mar, 2012  |  Pubmed ID: 22388738

Enterovirus 71 (EV71) is a major agent of hand, foot and mouth disease in children that can cause severe central nervous system disease and death. No vaccine or antiviral therapy is available. High-resolution structural analysis of the mature virus and natural empty particles shows that the mature virus is structurally similar to other enteroviruses. In contrast, the empty particles are markedly expanded and resemble elusive enterovirus-uncoating intermediates not previously characterized in atomic detail. Hydrophobic pockets in the EV71 capsid are collapsed in this expanded particle, providing a detailed explanation of the mechanism for receptor-binding triggered virus uncoating. These structures provide a model for enterovirus uncoating in which the VP1 GH loop acts as an adaptor-sensor for cellular receptor attachment, converting heterologous inputs to a generic uncoating mechanism, highlighting new opportunities for therapeutic intervention.

Synthesis of Fe(3)O(4) and Pt Nanoparticles on Reduced Graphene Oxide and Their Use As a Recyclable Catalyst

Nanoscale. Apr, 2012  |  Pubmed ID: 22388949

A bifunctional Fe(3)O(4)-Pt/reduced graphene oxide (rGO) composite, i.e. Fe(3)O(4) nanoparticles (∼4.8 nm in size) and Pt nanoparticles (∼5 nm in size) loaded on a rGO surface, has been synthesized. It shows great catalytic performance for the reduction of methylene blue. Recycling of the composite can be achieved by simply applying an external magnetic field. In addition, the Fe(3)O(4)-Pt/rGO composite exhibits a higher catalytic activity and selectivity for aqueous-phase aerobic oxidation of benzyl alcohol than does the FeO(x)-Pt on carbon nanotubes (i.e. FeO(x)-Pt/CNT composite). Moreover, the approach for the synthesis of Fe(3)O(4)-Pt/rGO composite is simple, and can be widely employed to produce other rGO-based composites with special properties. Our work indicates that the rGO-based bifunctional composite has great potential for practical applications in various fields, such as catalytic reaction, electrochemical sensing, clean energy, etc.

Chronic Expression of RCAN1-1L Induces Mitochondrial Autophagy and a Metabolic Shift from Oxidative Phosphorylation to Glycolysis in Neuronal Cells

The Journal of Biological Chemistry. Mar, 2012  |  Pubmed ID: 22389495

Expression of the RCAN1 gene can be induced by multiple stresses. RCAN1 proteins have both protective and harmful effects, and are implicated in common human pathologies. The mechanisms by which RCAN1s function, however, remain poorly understood. We identify RCAN1s as regulators of mitochondrial autophagy (mitophagy), and demonstrate that induction of RCAN1-1L can cause dramatic degradation of mitochondria. The mechanisms of such degradation involve the adenine nucleotide translocator (ANT) and mitochondrial permeability transition pore (mtPTP) opening. We also demonstrate that RCAN1-1L induction can shift cellular bioenergetics from aerobic respiration to glycolysis, yet RCAN1-1L has very little effect on cell division while it has a cumulative negative effect on cell survival. These results shed the light on mechanisms by which RCAN1s can protect or harm cells, and by which they may operate in human pathologies. They also suggest that RCAN1s are important players in autophagy and such elusive phenomena as mtPTP.

On the Reaction Mechanism of Tirapazamine Reduction Chemistry: Unimolecular N-OH Homolysis, Stepwise Dehydration, or Triazene Ring-Opening

Chemical Research in Toxicology. Mar, 2012  |  Pubmed ID: 22390168

The initial steps of the activation of tirapazamine (TPZ, 1, 3-amino-1,2,4-benzotriazine 1,4-N,N-dioxide) under hypoxic conditions consist of the one-electron reduction of 1 to radical anion 2 and the protonation of 2 at O(N4) or O(N1) to form neutral radicals 3 and 4, respectively. There are some questions, however, as to whether radicals 3 and/or 4 will then undergo N-OH homolyses 3 → 5 + ·OH and 4 → 6 + ·OH or, alternatively, whether 3 and/or 4 may react by dehydration and form aminyl radicals via 3 → 11 + H(2)O and 4 → 12 + H(2)O or phenyl radicals via 3 → 17 + H(2)O. These outcomes might depend on the chemistry after the homolysis of 3 and/or 4, that is, dehydration may be the result of a two-step sequence that involves N-OH homolysis and formation of ·OH aggregates of 5 and 6 followed by H-abstraction within the ·OH aggregates to form hydrates of aminyls 11 and 12 or of phenyl 17. We studied these processes with configuration interaction theory, perturbation theory, and density functional theory. All stationary structures of OH aggregates of 5 and 6, of H(2)O aggregates of 11, 12, and 17, and of the transition state structures for H-abstraction were located and characterized by vibrational analysis and with methods of electron and spin-density analysis. The doublet radical 17 is a normal spin-polarized radical, whereas the doublet radicals 11 and 12 feature quartet instabilities. The computed reaction energies and activation barriers allow for dehydration in principle, but the productivity of all of these channels should be low for kinetic and dynamic reasons. With a view to plausible scenarios for the generation of latent aryl radical species without dehydration, we scanned the potential energy surfaces of 2-4 as a function of the (O)N1-Y (Y = C5a, N2) and (O)N4-Z (Z = C4a, C3) bond lengths. The elongation of any one of these bonds by 0.5 Å requires less than 25 kcal/mol, and this finding strongly suggests the possibility of bimolecular reactions of the spin-trap molecules with 2-4 concomitant with triazene ring-opening.

Electron and Spin-density Analysis of Tirapazamine Reduction Chemistry

Chemical Research in Toxicology. Mar, 2012  |  Pubmed ID: 22390194

Tirapazamine (TPZ, 1, 3-amino-1,2,4-benzotriazine 1,4-N,N-dioxide), the radical anion 2 formed by one-electron reduction of 1, and neutral radicals 3 and 4 formed by protonation of 2 at O(N4) or O(N1), respectively, and their N-OH homolyses 3 → 5 + ·OH and 4 → 6 + ·OH have been studied with configuration interaction theory, perturbation theory, and density functional theory. A comprehensive comparative analysis is presented of structures and electronic structures and with focus on the development of an understanding of the spin-density distributions of the radical species. The skeletons of radicals 3 and 4 are distinctly nonplanar, several stereoisomeric structures are discussed, and there exists an intrinsic preference for 3 over 4. The N-oxides 1, 5, and 6 have closed-shell singlet ground states and low-lying, singlet biradical (SP-1, SP-6) or biradicaloid (SP-5) excited states. The doublet radicals 2, 3, and 4 are heavily spin-polarized. Most of the spin density of the doublet radicals 2, 3, and 4 is located in one (N,O)-region, and in particular, 3 and 4 are not C3-centered radicals. Significant amounts of spin density occur in both rings in the singlet biradical(oid) excited states of 1, 5, and 6. The dipole moment of the N2-C3(X) bond is large, and the nature of X provides a powerful handle to modulate the N2-C3 bond polarity with opposite effects on the two NO regions. Our studies show very low proton affinities of radical anion 2 and suggest that the pK(a) of radical [2+H] might be lower than 6. Implications are discussed regarding the formation of hydroxyl from 3 and/or 4, regarding the ability of 5 and 6 to react with carbon-centered radicals in a manner that ultimately leads to oxygen transfer, and regarding the interpretation of the EPR spectra of reduced TPZ species and of their spin-trap adducts.

Expression and Prognostic Relevance of PRAME in Primary Osteosarcoma

Biochemical and Biophysical Research Communications. Mar, 2012  |  Pubmed ID: 22390931

The preferentially expressed antigen of melanoma (PRAME), a cancer-testis antigen with unknown function, is expressed in many human malignancies and is considered an attractive potential target for tumor immunotherapy. However, studies of its expression and function in osteosarcoma have rarely been reported. In this study, we found that PRAME is expressed in five osteosarcoma cell lines and in more than 70% of osteosarcoma patient specimens. In addition, an immunohistochemical analysis showed that high PRAME expression was associated with poor prognosis and lung metastasis. Furthermore, PRAME siRNA knockdown significantly suppressed the proliferation, colony formation, and G1 cell cycle arrest in U-2OS cells. Our results suggest that PRAME plays an important role in cell proliferation and disease progression in osteosarcoma. However, the detail mechanisms of PRAME function in osteosarcoma require further investigation.

[Influence of Mesenchymal Stem Cells on Proliferation of HL-60]

Zhongguo Shi Yan Xue Ye Xue Za Zhi / Zhongguo Bing Li Sheng Li Xue Hui = Journal of Experimental Hematology / Chinese Association of Pathophysiology. Jan, 2012  |  Pubmed ID: 22391166

The objective of this study was to explore the effect of mesenchymal stem cells (MSC) on HL-60 proliferation and its molecular mechanism. HL-60 cells co-cultivated with MSC were used as experiment group, and the cells cultivated solely were taken as control group. HL-60 cells in the two groups were counted at different time. The time-quantity curve was drawn. The cell cycle and apoptosis ratio of HL-60 cells were compared between the two groups and expressions of Survivin and Bcl-2 protein were detected by flow cytometry. The results showed that HL-60 cells cultivated with MSC were obviously inhibited, especially on day 5 and 7 (P < 0.01). HL-60 cells were distributed on the phase of G(0)/G(1) [control group (47.0 ± 9.0)% vs experiment group (70.0 ± 16.0)%, P = 0.003], and apoptotic peak appeared. Both of Survivin and Bcl-2 protein expressions in HL-60 cells decreased [Bcl-2 protein in control group (63.0 ± 9.1)% vs experiment group (50.0 ± 14.1)%, P = 0.045; Survivin in control group (94.0 ± 9.3)% vs experiment group (77.0 ± 11.8)%, P = 0.006]. It is concluded that the MSC can inhibite HL-60 cell proliferation, and promote HL-60 cell apoptosis.

[Clinical Significance of Monitoring BK Polyomavirus in Patients After Hematopoietic Stem Cell Transplantation]

Zhongguo Shi Yan Xue Ye Xue Za Zhi / Zhongguo Bing Li Sheng Li Xue Hui = Journal of Experimental Hematology / Chinese Association of Pathophysiology. Jan, 2012  |  Pubmed ID: 22391185

This study was aimed to establish a method for rapid detecting BK polyomavirus (BKV) and to investigate the feasibility and value used in leukemia patients undergoing hematopoietic stem cell transplantation. Primers were designed according to BKV gene sequence; the quantitative standards for BKV and a real-time fluorescent quantitative PCR for BKV were established. The BKV level in urine samples from 36 patients after hematopoietic stem cell transplantation were detected by established method. The results showed that the standard of reconstructed plasmid and real time fluorescent quantitative PCR method were successfully established, its good specificity, sensitivity and stability were confirmed by experiments. BKV was found in 55.56% of urine samples, and the BKV load in urine was 2.46 × 10(4) - 7.8 × 10(9) copy/ml. It is concluded that the establishment of real-time fluorescent quantitative PCR for BKV detection provides a method for early diagnosis of the patients with hemorrhagic cystitis after hematopoietic stem cell transplantation.

Prevalence of Qnr, Aac(6' )-Ib-cr, QepA, and OqxAB in Escherichia Coli Isolates from Humans, Animals, and Environment

Antimicrobial Agents and Chemotherapy. Mar, 2012  |  Pubmed ID: 22391545

Of 1,022 Escherichia coli isolates from humans, animals and environment collected between 1993 and 2010 in China, qnr, aac(6' )-Ib-cr, qepA, and oqxAB genes were detected in 5.7%, 4.9%, 2.6%, and 20.2% isolates, respectively. The prevalence of oqxAB in porcine isolates (51.0%) was significantly higher than that in other original isolates. This is the first report of oqxAB-positive isolates from ducks and geese, and as early as 1994 from chicken.

The Effects of Cytokine-induced Killer Cells for the Treatment of Patients with Solid Tumors: a Clinical Retrospective Study

Journal of Cancer Research and Clinical Oncology. Mar, 2012  |  Pubmed ID: 22392076

BACKGROUND: Cytokine-induced killer (CIK) cells exert high impact on adoptive immunotherapeutic approaches for malignant tumors. This study aimed to evaluate the effect of adjuvant immunotherapy with CIK cells on the prognosis of solid tumor. METHODS: Peripheral blood mononuclear cells were collected by a blood cell separator from 40 patients, then expanded by priming them with interferon-gamma followed by monoclonal antibody against CD3 and interleukin-2 the next day. The phenotypic patterns of CIK cells were characterized by flow cytometry on days 0, 7, 10, 14 and 21 of incubation, respectively. Then, 5 ml of venous blood was obtained from 40 patients before and after CIK cells were transfused into patients to assess the influence of CIK cells on the percentages of effector cells. RESULTS: After 14 days of incubation in vitro, the percentages of CD3(+), CD8(+), CD3(+) and CD56(+) increased significantly (P < 0.05). The clinical symptoms of 40 patients were improved apparently. The 6-month, 1-year and 3-year overall survival rates were 70.0, 60.0 and 57.5%, respectively. CONCLUSIONS: Our results indicated that CIKs immunotherapy can be an effective adjuvant instrument of the routine therapy of malignancy.

The Effects of the Magnetopolaron on the Energy Gap Opening in Graphene

Journal of Physics. Condensed Matter : an Institute of Physics Journal. Apr, 2012  |  Pubmed ID: 22392819

The magnetopolaron is formed via electron-acoustic deformation phonon coupling in the presence of a magnetic field in monolayer graphene. We find that an energy gap (EG) is opened due to the electron-phonon coupling. Both linear and square-root forms for the dependence of the EG on the magnetic field are obtained, which are in agreement with experimental measurements. Furthermore, we suggest that the EG can be estimated through observing the variation of Fermi velocity in cyclotron resonance experiments. The relation of the EG with the Debye cut-off wavenumber is also discussed.

Nanobubbles for Enhanced Ultrasound Imaging of Tumors

International Journal of Nanomedicine. 2012  |  Pubmed ID: 22393289

The fabrication and initial applications of nanobubbles (NBs) have shown promising results in recent years. A small particle size is a basic requirement for ultrasound contrast-enhanced agents that penetrate tumor blood vessel pores to allow for targeted imaging and therapy. However, the nanoscale size of the particles used has the disadvantage of weakening the imaging ability of clinical diagnostic ultrasound. In this work, we fabricated a lipid NBs contrast-enhanced ultrasound agent and evaluated its passive targeting ability in vivo. The results showed that the NBs were small (436.8 ± 5.7 nm), and in vitro ultrasound imaging suggested that the ultrasonic imaging ability is comparable to that of microbubbles (MBs). In vivo experiments confirmed the ability of NBs to passively target tumor tissues. The NBs remained in the tumor area for a longer period because they exhibited enhanced permeability and retention. Direct evidence was obtained by direct observation of red fluorescence-dyed NBs in tumor tissue using confocal laser scanning microscopy. We have demonstrated the ability to fabricate NBs that can be used for the in vivo contrast-enhanced imaging of tumor tissue and that have potential for drug/gene delivery.

A New Synthetic Route for Axially Chiral Secondary Amines with Binaphthyl Backbone and Their Applications in Asymmetric Michael Reaction of Aldehydes to Nitroalkenes

Organic & Biomolecular Chemistry. Apr, 2012  |  Pubmed ID: 22395306

A new synthetic route for binaphthyl-based secondary amines has been developed. The key features of this route include the selective direct esterification of the binaphthyl structure at the 3- or 3,3'-position and the methylation by a Negishi cross-coupling reaction. Based on the new approach, a series of 3-monosubstituted and 3,3'-disubstituted chiral secondary amines with a binaphthyl backbone were synthesized and screened in the Michael reaction of aldehydes to various nitroalkenes. 3-Monosubstituted secondary amine 7c was proved to be the best catalyst, affording high yields (up to 95%), good to excellent enantioselectivities (up to 99%) and diastereoselectivities (syn/anti up to 99 : 1) under the optimized conditions.

Pretransplant Prediction of Posttransplant Survival for Liver Recipients with Benign End-stage Liver Diseases: a Nonlinear Model

PloS One. 2012  |  Pubmed ID: 22396731

The scarcity of grafts available necessitates a system that considers expected posttransplant survival, in addition to pretransplant mortality as estimated by the MELD. So far, however, conventional linear techniques have failed to achieve sufficient accuracy in posttransplant outcome prediction. In this study, we aim to develop a pretransplant predictive model for liver recipients' survival with benign end-stage liver diseases (BESLD) by a nonlinear method based on pretransplant characteristics, and compare its performance with a BESLD-specific prognostic model (MELD) and a general-illness severity model (the sequential organ failure assessment score, or SOFA score).

First Efficacy Results of Capecitabine with Anthracycline- and Taxane-based Adjuvant Therapy in High-risk Early Breast Cancer: a Meta-analysis

PloS One. 2012  |  Pubmed ID: 22396769

Capecitabine is effective and indicated for the salvage treatment of metastatic breast cancer. Therefore, it is essential to evaluate the efficacy of capecitabine in the adjuvant setting. There have been two large randomized studies to determine whether patients with high-risk early breast cancer benefit from the addition of capecitabine to standard chemotherapy, but they have yielded inconsistent results. We first undertook a meta-analysis to evaluate the efficacy of the addition of capecitabine over standard treatment.

Synthesis of Fused Dihydropyrano(furano)pyridines Via [4 + 2]-Cycloaddition of 5-Alkenoxy Substituted Oxazoles

Organic Letters. Mar, 2012  |  Pubmed ID: 22397735

A three-step procedure to access fused pyridines has been developed utilizing inexpensive amino acids and alkenols to form the key oxazole precursors. Yields are good to excellent and provide a rapid and inexpensive route to a range of pharmacologically and biologically valuable fused pyridines with difficult to access substitution patterns.

The Effect of Monosialotetrahexosylganglioside (GM1) in Prevention of Oxaliplatin Induced Neurotoxicity: A Retrospective Study

Biomedicine & Pharmacotherapy = Biomedecine & Pharmacotherapie. Feb, 2012  |  Pubmed ID: 22397758

Oxaliplatin is a key agent in the treatment of colorectal cancer. However, peripheral neuropathy markedly limits the use of oxaliplatin. This retrospective study was performed to assess the efficacy of monosialotetrahexosylganglioside (GM1) for preventing oxaliplatin induced neurotoxicity. Patients with colorectal cancer treated with oxaliplatin based chemotherapy (FOLFOX or XELOX) were retrospectively divided into two groups according to the use of GM1. The severity of neurotoxicity and efficacy of oxaliplatin were evaluated. A total of 278 cases were included, 114 in GM1 group and 164 in control group. A significantly lower incidence of grade 1-3 acute neurotoxicity (81% vs 92%, p=0.006), grade 2 acute neurotoxicity (26% vs 45%, p=0.002) was observed in GM1 group. Similarly, incidence of grade 1-3 (30% vs 48%, p=0.003) and grade 3 chronic neurotoxicity (4% vs 13%, p=0.021) was also lower in GM1 group. No difference was detected in objective response rate, progress free survival, and median overall survival between GM1 group and control group. The retrospective study demonstrated that GM1 significantly reduced the incidence of oxaliplatin induced neuropathy, especially severe neuropathy, without impairment of efficacy. Prospective trials of GM1 as neuroprotective of oxaliplatin treatment in colorectal cancer are warranted.

Salt-and-pepper Eye Pain and Brainstem Stroke

Clinical Neurology and Neurosurgery. Mar, 2012  |  Pubmed ID: 22397972

BACKGROUND AND PURPOSE: The salt-and-pepper pain is a characteristic sensory disturbance confined to the eyes and regional facial structures. Although a poor prognosis has been mentioned in previously reported patients, the precise pathomechanism and clinical significance are still unknown. PATIENTS AND METHODS: We report four patients with ocular salt-and-pepper pain, and review the clinical course, neuroimaging and prognosis in another eight patients reported in the literature. RESULTS: In our series, they were three men and one woman, and their underlying cause was pontine hemorrhage; hypertensive hemorrhage in three and cavernous hemangioma in one patient, respectively. In these 12 salt-and-pepper patients, the identifiable etiology was exclusively brainstem stroke. Life-threatening or disable neurological deterioration ensued within 24h after pain onset in all patients. Their ocular pain subsided rapidly after neurological deterioration occurred. A dual excitation of nociceptive quinothalamic pain fiber and disinhibition of trigeminosensory system from pontine reticular formation and cerulotrigeminospinal circuit may be responsible for this pain. CONCLUSION: In clinical practice, ocular salt-and-pepper pain in quiet eyes should be alerted for intracranial pathology and neurological deterioration until underlying cause is identified.

Lithographic Compartmentalization of Emulsion Droplet Templates for Microparticles with Multiple Nanostructured Compartments

Chemical Communications (Cambridge, England). Mar, 2012  |  Pubmed ID: 22398781

Complicated functional microparticles with complex nanostructured compartments have been synthesized from emulsion templates by lithographic compartment allocations. Our 'top-down-bottom-up' hybrid method will provide additional material engineering capability for the synthesis of advanced functional microparticles.

Functional Diversity of Bitter Taste Receptor TAS2R16 in Primates

Biology Letters. Mar, 2012  |  Pubmed ID: 22399783

In mammals, bitter taste is mediated by TAS2R genes, which belong to the large family of seven transmembrane G protein-coupled receptors. Because TAS2Rs are directly involved in the interaction between mammals and their dietary sources, it is likely that these genes evolved to reflect species-specific diets during mammalian evolution. Here, we investigated the sensitivities of TAS2R16s of various primates by using a cultured cell expression system, and found that the sensitivity of each primate species varied according to the ligand. Especially, the sensitivity of TAS2R16 of Japanese macaques to salicin was much lower than that of human TAS2R16, which was supported by behavioural tests. These results suggest the possibility that bitter-taste sensitivities evolved independently by replacing specific amino acid residues of TAS2Rs in different primate species to adapt to food items they use.

Correction: CD36 Participates in PrP(106-126)-Induced Activation of Microglia

PloS One. 2012  |  Pubmed ID: 22400067

[This corrects the article on p. e30756 in vol. 7.].

Evidence for Spin Correlation in Tt[over ¯] Production

Physical Review Letters. Jan, 2012  |  Pubmed ID: 22400731

We present a measurement of the ratio of events with correlated t and t[over ¯] spins to the total number of tt[over ¯] events. This ratio f is evaluated using a matrix-element-based approach in 729 tt[over ¯] candidate events with a single lepton ℓ (electron or muon) and at least four jets. The analyzed pp[over ¯] collisions data correspond to an integrated luminosity of 5.3  fb^{-1} and were collected with the D0 detector at the Fermilab Tevatron collider operating at a center-of-mass energy sqrt[s]=1.96  TeV. Combining this result with a recent measurement of f in dileptonic final states, we find f in agreement with the standard model. In addition, the combination provides evidence for the presence of spin correlation in tt[over ¯] events with a significance of more than 3 standard deviations.

[A New Strategy of Fighting Against the Bacterial Infection Disease]

Zhongguo Wei Zhong Bing Ji Jiu Yi Xue = Chinese Critical Care Medicine = Zhongguo Weizhongbing Jijiuyixue. Mar, 2012  |  Pubmed ID: 22401155

Puerarin Exerts Antipyretic Effect on Lipopolysaccharide-induced Fever in Rats Involving Inhibition of Pyrogen Production from Macrophages

Journal of Ethnopharmacology. Feb, 2012  |  Pubmed ID: 22401764

ETHNOPHARMACOLOGICAL RELEVANCE: Puerarin is the most abundant isoflavonoid in Radix Puerariae (Gegen), which has been prescribed as a medicinal herb for treating fever in China for a long history. AIM OF THE STUDY: The present study aimed at evaluating the antipyretic effect of puerarin and revealing the related mechanisms. MATERIALS AND METHODS: Lipopolysaccharide (LPS)-induced fever in rats was used to assess the antipyretic effect of puerarin. After an intraperitoneal injection of LPS (100μg/kg), body temperature was tested every 30min up to 8h. Different doses of puerarin (25, 50, 100mg/kg) were intraperitoneally administered 30min before LPS injection. In vitro, LPS-stimulated RAW 264.7 cells were treated with various concentrations of puerarin (25-200μM). The pyrogenic mediators, including interleukin-1β (IL-1β), tumor necrosis factor-α (TNF-α), interleukin-6 (IL-6), prostaglandin E(2) (PGE(2)) and nitric oxide (NO), were examined on both transcription and expression levels. Furthermore, the influences of the activation of nuclear factor-kappa B (NF-κB) and the phosphorylation of mitogen-activated protein kinases (MAPKs) by puerarin were assayed by western blot. RESULTS: The intraperitoneal administration of puerarin at test doses clearly demonstrated apparent antipyretic effect through the declines in body temperature elevated by LPS in rats. The in vitro data showed that puerarin inhibited the production of IL-1β, TNF-α, IL-6, PGE(2) and NO; moreover, the RT-PCR analysis and the western blot analysis indicated that puerarin regulated the transcriptional level via suppression of NF-κB activation and blockade of MAPK signal pathway. CONCLUSIONS: In summary, the antipyretic property of puerarin might result, at least in part, from an inhibition of endogenous pyrogen production and expression. Taken in this sense, our findings provide an explanation for puerarin acting as an important constituent in Gegen, thus, provide scientific basis for the wide use of Radix Puerariae in China as a traditional antipyretic.

Intimal Thickening of Meningeal Arteries After Serial Corticectomies for Rasmussen Encephalitis

Human Pathology. Mar, 2012  |  Pubmed ID: 22401768

Rasmussen encephalitis is a rare cause of intractable epilepsy in children. Between 2008 and 2010, 4 patients had second cortical resections performed after a primary corticectomy for Rasmussen encephalitis. In each case, we observed some degree of vessel wall change in leptomeningeal arteries, consisting of moderate to moderately severe intimal hyperplasia. The intervals between original resection and second operation ranged from 8 months to 10 years. Ages of the patients ranged from 9 to 12 years at their first resection and from 10 to 19 years at the time of revision. Four other Rasmussen encephalitis cases operated upon in the years 2006 to 2010 and 2 surgical revisions for severe cortical dysplasia, 1 for mild cortical dysplasia and 1 for recurrent dysembryoplastic neuroepithelial tumor, did not show significant vascular abnormalities (with surgical intervals of 10 months to 16 years). Leptomeningeal intimal hyperplasia appears to develop in the interval between repeated cortical resections for Rasmussen encephalitis, an inflammatory disorder. The pathogenesis of this vascular change may be related to meningeal inflammation in Rasmussen encephalitis. This finding in children undergoing surgical resection for Rasmussen encephalitis may itself lead to "secondary" ischemic change that contributes to worsening of epilepsy.

Voxel-based Analysis of Regional Gray and White Matter Concentration in High Myopia

Vision Research. Feb, 2012  |  Pubmed ID: 22402232

Structural changes of the brain have been detected in many early-onset eye diseases, whereas little is known about whether changes could occur if the onset age is after the sensitive development period. High Myopia is a prime example of neural plasticity after development, whose case history is usually long. To investigate potential morphological changes in the brain of high myopic patients, we compared a group of 30 adults with high myopia and 30 control subjects using high-resolution anatomic MRI in combination with vision tests. No difference in gray matter (GM) concentration was detected. However, increased concentration of white matter (WM) was observed in patients with high myopia, primarily in the calcarine area. Another three comparatively smaller regions were in the prefrontal and parietal lobe. It can be inferred that cortices developed normally and refractive error in high myopic patients may be compensated by strengthening the correlation between visual cortex and visual related areas. Our study suggests that besides early-onset diseases, the late-onset eye diseases can also affect the structure of brain.

C-Jun-dependent Sulfiredoxin Induction Mediates BDNF Protection Against Mitochondrial Inhibition in Rat Cortical Neurons

Neurobiology of Disease. Mar, 2012  |  Pubmed ID: 22402332

In current study, we tested the hypothesis that c-Jun-dependent sulfiredoxin expression mediates protective effects of brain-derived neurotrophic factor (BDNF) against neurotoxicity induced by 3-nitropropionic acid (3-NP), a mitochondrial complex II inhibitor, in primary rat cortical cultures. We found that BDNF-dependent c-Jun expression and nuclear translocation required prior phosphorylation of extracellular signal-regulated kinase (ERK)1/2, but not Akt. BDNF also transiently activated the expression of sulfiredoxin, an ATP-dependent antioxidant enzyme, at both mRNA and protein levels. Furthermore, both c-Jun siRNA and ERK1/2 inhibitor PD98059 suppressed BDNF-induced sulfiredoxin expression. Finally, PD98059, c-Jun siRNA, and sulfiredoxin siRNA all abrogated BDNF-mediated 3-NP resistance. Together, these results established a signaling cascade of "BDNF → ERK1/2-Pi → c-Jun → sulfiredoxin → 3-NP resistance". We therefore conclude that c-Jun-induced sulfiredoxin mediates the BDNF-dependent neuroprotective effects against 3-NP toxicity in primary rat cortical neurons, at least in part.

Surgical Treatment of Hemangioma on the Dorsum of the Penis

Journal of Andrology. Mar, 2012  |  Pubmed ID: 22403282

Objective: Therapies for hemangiomas of the penis include surgical excision, electrofulguration, cryotherapy, sclerotherapy and neodymium: yttrium aluminum garnet (ND-YAG) laser treatment. Urologists often face difficulties in deciding whether to use surgery in case of penile hemangioma. In this study, we investigated the safety and feasibility of surgical treatment of hemangioma in the penis. Methods: The study included 6 patients, 19 to 42 years of age (median age 23 years), with hemangiomas on the dorsal aspect of the penis. All patients were treated with surgery. ALL operations were successful and no complications were observed. Patients were followed up for 2 to 5 years (median 2.5years) after discharge from the hospital. Five patients were assessed for sexual function. Results: Lesions healed completely, and all patients were satisfied with the aesthetic results. All patients had returned to normal sexual activity within 3 months of the operation.Sexual function and sexual satisfaction were well maintained after operation. Conclusion: A therapeutic reference standard for the treatment of penile hemangioma is still lacking because of the rarity of the disease. The results of our experience confirm that surgical treatment for penile hemangioma represents a safe radical curative prcoedure. Surgical treatment offers an alternative to the more conservative therapy previously advocated.

Gene Therapy with an Erythropoietin Enhancer-Mediated Hypoxia-Inducible Gene Expression System in the Corpus Cavernosum of Mice with High-Cholesterol Diet-Induced Erectile Dysfunction

Journal of Andrology. Mar, 2012  |  Pubmed ID: 22403284

Cavernous hypoxia is an important factor in the pathogenesis of vasculogenic erectile dysfunction (ED). Therefore, the hypoxia-inducible gene expression system can be exploited to the gene therapy for vasculogenic ED. This study was undertaken to examine the effectiveness of a hypoxia-inducible gene expression system, namely, the RTP801 promoter or the erythropoietin (Epo) enhancer, in a mouse model of hypercholesterolemic ED in vivo and in primary cultured mouse cavernous endothelial cells in vitro. Two-month-old male C57BL/6 mice were fed a diet containing 4% cholesterol and 1% cholic acid, and age-matched control animals were fed a normal diet, for 3 months. Mouse cavernous endothelial cells were isolated and cultured under normoxic or hypoxic conditions. After treatment of animals or endothelial cells with pSV-Luc, pRTP801-Luc, or pEpo-SV-Luc vector, gene expression was evaluated by luciferase assay, and the gene expression area was evaluated by immunohistochemistry. pRTP801-Luc and pEpo-SV-Luc significantly induced gene expression in the hypercholesterolemic mice and in cavernous endothelial cells under hypoxia, and the highest gene expression was noted in the group treated with pEpo-SV-Luc. Gene expression was higher for more than 7 days in the hypercholesterolemic mice injected with pEpo-SV-Luc than in mice injected with pSV-Luc. As shown by immunohistochemistry, the gene expression area was also greater in the pEpo-SV-Luc group than in the pSV-Luc group, but the difference was not as great as that in luciferase activity. The hypoxia-specific gene expression system may be a valuable tool for facilitating gene delivery into ischemic corpus cavernosum tissue resulting from vascular causes.

Degradable Gene Delivery Systems Based on Pluronics-modified Low-molecular-weight Polyethylenimine: Preparation, Characterization, Intracellular Trafficking, and Cellular Distribution

International Journal of Nanomedicine. 2012  |  Pubmed ID: 22403492

Cationic copolymers consisting of polycations linked to nonionic amphiphilic block polymers have been evaluated as nonviral gene delivery systems, and a large number of different polymers and copolymers of linear, branched, and dendrimeric architectures have been tested in terms of their suitability and efficacy for in vitro and in vivo transfection. However, the discovery of new potent materials still largely relies on empiric approaches rather than a rational design. The authors investigated the relationship between the polymers' structures and their biological performance, including DNA compaction, toxicity, transfection efficiency, and the effect of cellular uptake.

[Treatment of Adult Congenital Muscular Torticollis by Multiple Sternocleidomastoid Head Amputation]

Zhongguo Xiu Fu Chong Jian Wai Ke Za Zhi = Zhongguo Xiufu Chongjian Waike Zazhi = Chinese Journal of Reparative and Reconstructive Surgery. Feb, 2012  |  Pubmed ID: 22403892

To investigate the therapeutic method and effectiveness of multiple sternocleidomastoid head amputation for adult congenital muscular torticollis.

[Enhancement of Image Used in Optical Imaging of Intrinsic Signal]

Sheng Wu Yi Xue Gong Cheng Xue Za Zhi = Journal of Biomedical Engineering = Shengwu Yixue Gongchengxue Zazhi. Feb, 2012  |  Pubmed ID: 22404025

Optical imaging of intrinsic signals is a secondary image of the cerebral cortex. The weak optical signal is decided by anatomical structure of brain. The spatial filter is a powerful technology for de-noising and image enhancement. We used different linear and nonlinear filters to deal with optical imaging. Furthermore, we compared the degree of noise suppression and discussed the image details. Our result showed that nonlinear median filter can keep more image details with effective noise reduction. It is useful for image enhancement of optical imaging.

Folding Studies on Muscle Type of Creatine Kinase from Pelodiscus Sinensis

International Journal of Biological Macromolecules. Mar, 2012  |  Pubmed ID: 22405779

A folding study of creatine kinase from Pelodiscus sinensis has not yet been reported. To gain more insight into structural and folding mechanisms of P. sinensis CK (PSCK), denaturants such as SDS, guanidine HCl, and urea were applied in this study. We purified PSCK from the muscle of P. sinensis and conducted inhibition kinetics with structural unfolding studies under various conditions. The results revealed that PSCK was completely inactivated at 1.8mM SDS, 1.05M guanidine HCl, and 7.5M urea. The kinetics via time-interval measurements showed that the inactivation by SDS, guanidine HCl, and urea were all first-order reactions with kinetic processes shifting from monophase to biphase at increasing concentrations. With respect to tertiary structural changes, PSCK was unfolded in different ways; SDS increased the hydrophobicity but retained the most tertiary structural conformation, while guanidine HCl and urea induced conspicuous changes in tertiary structures and initiated kinetic unfolding mechanisms. Our study provides information regarding PSCK and enhances our knowledge of the reptile-derived enzyme folding.

Role of Lbx2 in the Noncanonical Wnt Signaling Pathway for Convergence and Extension Movements and Hypaxial Myogenesis in Zebrafish

Biochimica Et Biophysica Acta. Mar, 2012  |  Pubmed ID: 22406073

It has been suggested that mouse lbx1 is essential for directing hypaxial myogenic precursor cell migration. In zebrafish, the expression of lbx1a, lbx1b, and lbx2 has been observed in pectoral fin buds. It has also been shown that knocking down endogenous lbx2 in zebrafish embryos diminishes myoD expression in the pectoral fin bud. However, downstream lbxs signals remain largely unexplored. Here, we describe a previously unknown function of zebrafish lbx2 (lbx2) during convergent extension (CE) movements. The abrogation of the lbx2 function by two non-overlapping morpholino oligonucleotides (MOs) resulted in the defective convergence and extension movements in morphants during gastrulation. Our transplantation studies further demonstrated that the overexpression of lbx2 autonomously promotes CE movements. Expression of wnt5b is significantly reduced in lbx2 morphants. We have demonstrated that application of the wnt5b MO, a dominant-negative form of disheveled (Dvl) and a chemical inhibitor of Rho-associated kinase Y27632 in zebrafish embryos have effects reminiscent that are of the CE and hypaxial myogenesis defects observed in lbx2 morphants. Moreover, the CE and hypaxial mesoderm defects seen in lbx2 morphants can be rescued by co-injection with wnt5b or RhoA mRNA. However, this reduced level of active RhoA and hypaxial myogenesis defects in the embryos injected with the dominant-negative form of Dvl mRNA cannot be effectively restored by co-injection with lbx2 mRNA. Our results suggest that the key noncanonical Wnt signaling components Wnt5, Dvl, and RhoA are downstream effectors involved in the regulative roles of lbx2 in CE movement and hypaxial myogenesis during zebrafish embryogenesis.

CD5-positive Mucosa-associated Lymphoid Tissue (MALT) Lymphoma: a Clinicopathologic Study of 14 Cases

Human Pathology. Mar, 2012  |  Pubmed ID: 22406370

Extranodal marginal zone lymphoma of mucosa-associated lymphoid tissue (MALT lymphoma) is a B-cell neoplasm that is typically CD5 negative. We describe the clinicopathologic, immunophenotypic, and cytogenetic features of 14 cases of CD5+ MALT lymphoma. There were 9 men and 5 women (median age, 68 years; range, 34-87 years). MALT lymphoma was initially diagnosed in salivary glands (n = 4), nasopharynx (n = 2), and 1 case each in conjunctiva, thyroid, stomach, colon, skin, lung, kidney, and retroperitoneum. Two patients had localized disease; 9 had disseminated disease with generalized lymphadenopathy (n = 8), multifocal lymphoma (n = 6), or bone marrow involvement (n = 5). No staging information was available for the remaining patients. None presented with B symptoms, splenomegaly, cytopenias, lymphocytosis, monoclonal gammopathy, or elevated serum lactate dehyrogenase. Serum β2-microglobulin was elevated in 6. Morphologically, the neoplasms had features typical of MALT lymphoma being composed of small- to medium-sized cells with round to slightly irregular nuclear contours and moderate amount of cytoplasm. Lymphoepithelial lesions were noted in 4 cases. CD5 was positive in all cases by immunohistochemistry (n = 12) and/or flow cytometry (n = 11). All cases assessed were negative for cyclin D1 (13/13) and CD10 (11/11). Conventional cytogenetics in 7 cases showed trisomy 3 in 3 and diploid in 4. With a median follow-up of 71 months (range, 2-131 months), overall survival at 5 years was 100%, although 5 patients required chemotherapy. Our results show that CD5 expression is rare in MALT lymphoma, and is often associated with nongastric disease and an increased tendency to present with disseminated disease. Overall survival is excellent with appropriate therapy.

MicroRNA-133 Inhibits Cell Proliferation, Migration and Invasion in Prostate Cancer Cells by Targeting the Epidermal Growth Factor Receptor

Oncology Reports. Mar, 2012  |  Pubmed ID: 22407299

It has been shown that regulation of EGFR expression in prostate cancer cells is mostly at the transcriptional level. microRNA-133 (miR-133) has long been recognized as a muscle-specific miRNA which may regulate myoblast differentiation and participate in many myogenic diseases. Recently, it has been reported that miR-133 is also involved in other tumors, such as bladder cancer, esophageal cancer and may regulate cell motility in these cancer cells. In the present study, we examined the expression and effects of miR-133 in two hormone-insensitive prostate cancer cell lines. The expression of miR-133a and miR-133b were analyzed by quantitative RT-PCR. After transfection of miR-133a and miR-133b, cell viability assay, luciferase assay, western blot analysis, cell migration and invasion assay were conducted in Du145 and PC3 cells. In this study, we showed that miR‑133a and miR-133b are expressed at the detection limit in two hormone-insensitive prostate cancer cell lines, PC3 and DU145. Ectopic expression of miR-133 inhibited cell proliferation, migration and invasion in these cells. We also provide the first evidence that miR-133 may target EGFR. Our study provided the first glimpse of the functional role of miR-133 in two hormone-independent prostate cancer cell lines. These results may add to our knowledge on the molecular basis of prostate cancer progression.

Structure and Mechanism of a Glutamate-GABA Antiporter

Nature. Mar, 2012  |  Pubmed ID: 22407317

Food-borne hemorrhagic Escherichia coli, exemplified by the strains O157:H7 and O104:H4 (refs 1, 2), require elaborate acid-resistance systems (ARs) to survive the extremely acidic environment such as the stomach (pH ≈ 2). AR2 expels intracellular protons through the decarboxylation of L-glutamate (Glu) in the cytoplasm and exchange of the reaction product γ-aminobutyric acid (GABA) with extracellular Glu. The latter process is mediated by the Glu-GABA antiporter GadC, a representative member of the amino-acid-polyamine-organocation superfamily of membrane transporters. The functional mechanism of GadC remains largely unknown. Here we show, with the use of an in vitro proteoliposome-based assay, that GadC transports GABA/Glu only under acidic conditions, with no detectable activity at pH  values higher than 6.5. We determined the crystal structure of E. coli GadC at 3.1 Å resolution under basic conditions. GadC, comprising 12 transmembrane segments (TMs), exists in a closed state, with its carboxy-terminal domain serving as a plug to block an otherwise inward-open conformation. Structural and biochemical analyses reveal the essential transport residues, identify the transport path and suggest a conserved transport mechanism involving the rigid-body rotation of a helical bundle for GadC and other amino acid antiporters.

Real-time Bioluminescence and Tomographic Imaging of Gastric Cancer in a Novel Orthotopic Mouse Model

Oncology Reports. Mar, 2012  |  Pubmed ID: 22407359

Gastric cancer is the second leading cause of cancer mortality worldwide. Understanding the multistep process of carcinogenesis of gastric cancer is pivotal to develop novel therapeutic strategies. Molecular imaging in preclinical cancer models bridges the gap of laboratory-based experiment and clinical translation. To this end, the human gastric cancer cell line SGC-7901 was established to stably express luciferase and GFP by lentiviral transduction (SGC7901-Luc-GFP). Preclinical models were developed by orthotopic transplantation of SGC-7901-Luc-GFP into the sub-serosal layer of the stomach of immunocompromised mice. Tumor progression and therapeutic responses were dynamically tracked by bioluminescence imaging (BLI). Bioluminescence tomography (BLT) was used to monitor stereoscopic morphological and signal changes during tumor progression. Good correlation between cell number and bio-luminescence/fluorescence intensity was observed (R2=0.9983/r2=0.9974) in vitro. Tumor progression and therapeutic response could be successfully followed directly by BLI. Importantly, BLT provided a more accurate spatial location and tomographic quantification of the internal lesion. In conclusion, our novel bioluminescence-based preclinical gastric cancer models enable superior, noninvasive monitoring gastric cancer progression and their drug responses. The BLT technique in particular, may have great potential for future oncological studies.

A Large-Area Light-Weight Dye-Sensitized Solar Cell Based on All Titanium Substrates with an Efficiency of 6.69% Outdoors

Advanced Materials (Deerfield Beach, Fla.). Mar, 2012  |  Pubmed ID: 22407518

Light-weight PEDOT-Pt/Ti mesh and Ti/TiO(2) foil electrodes are prepared. Owing to the PEDOT-Pt/Ti photocathode's high transparency, good electrocatalytic activity, and low resistance; the Ti/TiO(2) anode's large specific area and high conductivity, a light-weight backside illuminated large-area (100 cm(2) ) dye-sensitized solar cell achieves an energy conversion efficiency of 6.69% under an outdoors sunlight irradiation of 55 mW cm(-2) .

Characterization of the Cytokine Expression Profiles of the Aorta and Liver of Young Tumor Necrosis Factor Alpha Mutant Mice

Molecular and Cellular Biochemistry. Mar, 2012  |  Pubmed ID: 22407569

Both the aorta and the liver are major organs that play important roles in lipid metabolism, and they are subject to systemic as well as local inflammatory responses in metabolic syndrome. Our previous study indicated that TNFα deficiency influences atherogenesis by reducing inflammation of the aorta. To better understand this phenomenon, the mRNA and protein expression profiles of a panel of cytokines in the aorta and liver of young TNFα-null (TNFα(-/-)) mice were analyzed and compared with age- and gender-matched wild-type (WT) control mice. In the aorta, IL-2 and GM-CSF were up-regulated versus WT mice, while IL-1β, IL-4, IL-6, IL-10, MCP-1, IFN-γ, and the adhesion molecules ICAM-1 and VCAM-1 were down-regulated. In the liver, however, the expressions of NF-κB, IL-1, IL-2, IL-6, IL-10, ICAM-1, and VCAM-1 were significantly up-regulated in TNFα(-/-) mice, while IFN-γ and IL-4 were down-regulated. Out of the 62 cytokines analyzed, 22 in the aorta and 27 in the liver were altered by 2-fivefolds at the protein level in TNFα(-/-) mice. Our data demonstrated that the loss of TNFα function led to various changes in the levels of cytokine expression in these organs at both the transcriptional and translational levels. These results indicated that the changes in cytokine expression patterns in the aorta and the liver may further influence the progression of systemic or local lipid metabolism dysregulation and pathogenesis in animals with TNFα dysfunction representing inflammation-related diseases, such as atherosclerosis and metabolic syndrome.

Real-Time Observation on Dynamic Growth/Dissolution of Conductive Filaments in Oxide-Electrolyte-Based ReRAM

Advanced Materials (Deerfield Beach, Fla.). Mar, 2012  |  Pubmed ID: 22407902

Evolution of growth/dissolution conductive filaments (CFs) in oxide-electrolyte-based resistive switching memories are studied by in situ transmission electron microscopy. Contrary to what is commonly believed, CFs are found to start growing from the anode (Ag or Cu) rather than having to reach the cathode (Pt) and grow backwards. A new mechanism based on local redox reactions inside the oxide-electrolyte is proposed.

The MADS29 Transcription Factor Regulates the Degradation of the Nucellus and the Nucellar Projection During Rice Seed Development

The Plant Cell. Mar, 2012  |  Pubmed ID: 22408076

The MADS box transcription factors are critical regulators of rice (Oryza sativa) reproductive development. Here, we here report the functional characterization of a rice MADS box family member, MADS29, which is preferentially expressed in the nucellus and the nucellar projection. Suppressed expression of MADS29 resulted in abnormal seed development; the seeds were shrunken, displayed a low grain-filling rate and suppressed starch biosynthesis, and contained abnormal starch granules. Detailed analysis indicated that the abnormal seed development is due to defective programmed cell death (PCD) of the nucellus and nucellar projection, which was confirmed by a TUNEL assay and transcriptome analysis. Further studies showed that expression of MADS29 is induced by auxin and MADS29 protein binds directly to the putative promoter regions of genes that encode a Cys protease and nucleotide binding site-Leu-rich repeat proteins, thereby stimulating the PCD. This study identifies MADS29 as a key regulator of early rice seed development by regulating the PCD of maternal tissues. It provides informative clues to elucidate the regulatory mechanism of maternal tissue degradation after fertilization and to facilitate the studies of endosperm development and seed filling.

Using Support Vector Machine and Evolutionary Profiles to Predict Antifreeze Protein Sequences

International Journal of Molecular Sciences. 2012  |  Pubmed ID: 22408447

Antifreeze proteins (AFPs) are ice-binding proteins. Accurate identification of new AFPs is important in understanding ice-protein interactions and creating novel ice-binding domains in other proteins. In this paper, an accurate method, called AFP_PSSM, has been developed for predicting antifreeze proteins using a support vector machine (SVM) and position specific scoring matrix (PSSM) profiles. This is the first study in which evolutionary information in the form of PSSM profiles has been successfully used for predicting antifreeze proteins. Tested by 10-fold cross validation and independent test, the accuracy of the proposed method reaches 82.67% for the training dataset and 93.01% for the testing dataset, respectively. These results indicate that our predictor is a useful tool for predicting antifreeze proteins. A web server (AFP_PSSM) that implements the proposed predictor is freely available.