Submit
Browse  

The Journal of Visualized Experiments (JoVE) is a peer reviewed, PubMed-indexed video journal. Our mission is to increase the productivity of scientific research.

Recommend to Librarian

Automatic Translation

This translation into Arabic was automatically generated through Google Translate.
English Version | Other Languages

 JoVE General

Microinjection من مرنا والعقاقير [أليغنوكليوتيد] Morpholino اسماك الزرد في الأجنة.

,

Department of Genetics, Yale University School of Medicine

You must be subscribed to JoVE to access this content.

This article is a part of   JoVE General. If you think this article would be useful for your research, please recommend JoVE to your institution's librarian.

Recommend JoVE to Your Librarian

Current Access Through Your IP Address

You do not have access to any JoVE content through your current IP address.

IP: 50.16.36.153, User IP: 50.16.36.153, User IP Hex: 839918745

Current Access Through Your Registered Email Address

You aren't signed into JoVE. If your institution subscribes to JoVE, please or create an account with your institutional email address to access this content.

 

Video Article Chapters

Cite this Article: Microinjection من مرنا والعقاقير [أليغنوكليوتيد] Morpholino اسماك الزرد في الأجنة.

Yuan, S., Sun, Z. Microinjection of mRNA and Morpholino Antisense Oligonucleotides in Zebrafish Embryos.. J. Vis. Exp. (27), e1113, doi:10.3791/1113 (2009).

Abstract: Microinjection من مرنا والعقاقير [أليغنوكليوتيد] Morpholino اسماك الزرد في الأجنة.

أداة أساسية للتحقيق في دور الجينات خلال التنمية هو القدرة على تنفيذ ضربة قاضية الجينات ، overexpression والدراسات misexpression. في الزرد (

Protocol: Microinjection من مرنا والعقاقير [أليغنوكليوتيد] Morpholino اسماك الزرد في الأجنة.

الجزء 1 : إعداد micropipettes وألواح غرفة microinjection

  1. افتعال micropipettes عن طريق التسخين وسحب الأنابيب الزجاجية البورسليكات الشعرية (البنك الآلات الدقيقة ، وشركة ، 1B100 - 4) في جهاز مجتذب micropipette (سوتر الآلات ، وشركة يلهب / براون P - 97). مخزن في طبق بتري على أعلى كمية صغيرة من الطين أو شريط لاصق.
  2. صب agarose 1.5 ٪ (الاميركي Bioanlytical ، شركة ، AB00972 - 00500) في لوحات 1X المتوسطة E3 مصبوب مع اسفين على شكل أحواض من شأنها أن تكون بمثابة طريقة سهلة لعقد أجنة خلال حقن (كما هو موضح في كتاب 'اسماك الزرد") 1. دعونا لوحات أجار الغرفة ترسيخ قبل استخدام وتخزين عند 4 درجة مئوية.

الجزء 2 : إعداد RNA

نهج واحد قوي للدراسات وظائف الجينات والحمض النووي الريبي لmicroinject في المختبر توج كتب في الأجنة الزرد. توج الجيش الملكي النيبالي سلوك مشابه إلى mRNAs حقيقية النواة الموجودة في الجسم الحي بسبب وجود تمثيلي CAP. الزرد الباحثين الاستفادة بشكل روتيني لهذا الأسلوب أو overexpress misexpress الجين اهتمامهم. في هذه التظاهرة ، فإننا سوف microinject مستخرج EGFP الموسومة واستخدام كامل يعيش الجنين GFP - التعبير بوصفها قراءات مرئية عن طريق الحقن ناجحة.

  1. إجراء في المختبر CAP رد فعل على النص نسخ الحمض النووي الريبي اهتمامك. في المختبر ، ونحن ادخال بشكل روتيني [كدنا] من الاهتمام الى ناقلات + pCS2 وإجراء كرد فعل التوليف المختبر كميات كبيرة من الحمض النووي الريبي توج باستخدام mMachine mMessage SP6 مجموعة (Ambion ، شركة ، AM1340).
  2. تنقية عينة الحمض النووي الريبي التي تعمل من خلال مجموعة صغيرة RNeasy (Qiagen ، شركة ، 74104) أو الفينول : استخراج الكلوروفورم والأيزوبروبانول هطول الأمطار.
  3. تحديد دقيق للتركيز على إعداد الجيش الملكي النيبالي وتخزينها في -80 درجة مئوية لتصبح جاهزة للاستخدام.
  4. في يوم من الحقن ، وأذاب عينة الحمض النووي الريبي ، وتدور الدوامة طفيفة أسفل لفترة وجيزة.
  5. يعد حل تعمل مع الماء المعقم وتركيز النهائي من 0.025 -- 0.050 ٪ أحمر الفينول (سيغما الدريخ شركة P0290). أحمر الفينول بمثابة علامة مرئية لحقن المحلول في جنين. في هذه المقالة ، سوف نستعد حلا مرنا من 100 عامل EGFP نانوغرام / UL مع أحمر الفينول 0.050 ٪.
  6. إبقاء عينة تعمل على الجليد وعودة السهم إلى رنا -80 درجة مئوية.
  7. انتقل إلى الجزء 4 عندما تصبح جاهزة لحقن هذه العينة.

الجزء 3 : إعداد morpholino

وتستخدم على نطاق واسع Morpholino [أليغنوكليوتيد] العقاقير لتعديل التعبير الجيني عن طريق منع ترجمة البروتين المستهدف أو عن طريق تعديل قبل مرنا الربط 2،3. Morpholinos في الزرد بمثابة أداة الوراثة العكسية القوية التي هدمت وظيفة الجين. في هذه المقالة ، فإننا سوف microinject a morpholino جزئية تستهدف موقع من بدء متعدية pkd2 (5' - AGGACGAACGCGACTGGAGCTCATC - 3 '). على أساس العمل المحددة مسبقا ، ونحن نتوقع من حقن الأجنة لتقليد phenotypically pkd2 4 الأسماك متحولة.

  1. نأذن بشكل روتيني من 300 nmol بنسبة ضئيلة morpholino مصممة خصيصا لجينة من الاهتمام من أدوات الجينات ، LLC (Philomath ، OR).
  2. إضافة الماء المعقم UL 100 لجعل مخزون 3 ملم الحل. قسامة الحل وتخزينها في -20 درجة مئوية لتصبح جاهزة للاستخدام.
  3. في يوم من الحقن ، والحرارة الحل morpholino عند 65 درجة مئوية لمدة 5 دقائق. المفاجئة باردة على الجليد على الفور وتدور لفترة وجيزة. يبدل طبيعة هذه الخطوة أي الهياكل الثانوية في جزئية ويضمن solubilized تماما الحل.
  4. يعد حل العامل تمييع الحل morpholino في الماء المعقم وتركيز النهائي من 0.025 -- 0.050 ٪ أحمر الفينول. في هذه المظاهرة ، سنكون إعداد حل عمل 0.50 ملي pkd2 morpholino مع أحمر الفينول 0.050 ٪.
  5. مواصلة العمل على حل درجة حرارة الغرفة.
  6. انتقل إلى الجزء 4 عندما تصبح جاهزة لحقن هذه العينة.----

الجزء 4 : تعبئة micropipette مع الحل الخاص العاملة

  1. قطع رأس القاصية من micropipette بالملقط أو razorblade الجراحية لإنشاء الافتتاح ان يكون مرئيا فقط تحت المجهر تشريح (نيكون الآلات ، وشركة ، SM2645) في التكبير 50X.
  2. 2 UL مكان من الحل الخاص بك يعمل انخفاض في الصعود إلى ساترة.
  3. نعلق الجزء الخلفي من micropipette إلى حقنة 5 مل مزودة أنابيب على إبرة تحت الجلد ويغرق قليلا الطرف البعيد من micropipette إلى إسقاط الخاص من محلول العمل. الحرص على عدم كسر غيض من micropipette.
  4. سيفون الحل من خلال العمل في نهاية البعيدة للmicropipette عن طريق سحب المكبس من المحاقن.

الجزء 5 : معايرة حجم الحقن micropipette

  1. وضع قطرة من الزيت المعدني (الاميركي Bioanalytical ، شركة ، AB00921 - 00025) على شريحة ميكرون (فايشير ، 12 SM1 - 561).
  2. بدوره على السلطة والعرض الجوي للضغط نابض الدقيقة حاقن جهاز (وورلد شركة آلات دقيقة ، PV830).
  3. إرفاق micropipette لصاحب micropipette جهاز حاقن الجزئي. حاقن هو الضغط الجزئي للتنظيم وتنشيط الإفرازات عن طريق الضغط على دواسة القدم.
  4. تشريح تحت المجهر ، واختبار حجم الحقن باستخدام محقنة الدقيقة لوضع قطرة من حل العمل الخاص بك على النفط ميكرون. قياس قطرها من الانخفاض حيث يعوم كمجال على أعلى من النفط.
  5. ضبط مدة وضغط الحقن لمعايرة الصوت الخاص بعناية من الحقن. هذه الخطوة يساعد في استنساخ التجربة microinjection. في هذه المظاهرة ، وسيتم ذلك عن microinjections مع قطره قطرة 0.15 ملم (حوالي 1.76 NL في الحجم).
  6. مرة واحدة وقد تم معايرة حجم الحقن الخاص ، واستخدام "عقد" مفتاح على حاقن الدقيقة لمنع الردم وتسريب micropipette.

الجزء 6 : إعداد الأجنة المخصبة الزرد لmicroinjection

  1. والزرد لم عشوائيا في الساعات القليلة الأولى من صباح كل يوم. جمع الأجنة في مرحلة 1 - الخلية ووضعها في 1X المتوسطة E3.
  2. باستخدام الماصة نقل 3 مل (بيكتون ديكنسون لابوار ، 357524) ، وترتيب الأجنة على طول أحواض اسفين على شكل لوحات في غرفة microinjection.
  3. إزالة المتوسطة بحيث تكون مغمورة ضحلة الأجنة وغمرت لا. هذه الخطوة يساعد في تسوية الأجنة إلى أسفل هبوطا ، وكذلك في الاختراق من قبل المشيماء micropipette.

الجزء 7 : Microinjection خلال المشيماء

  1. التلاعب في الأجنة مع micropipette بحيث السيتوبلازم الجنين مرحلة 1 - الخلية مرئية تحت المجهر تشريح. الحرص على عدم كسر غيض من micropipette.
  2. اختراق المشيماء ثم صفار ومع micropipette من أجل حقن في الجنين. في هذه التظاهرة ، فإننا سوف تكون الأولى في microinjecting صفار مباشرة تحت الخلية ، والسماح لتدفق حشوية ونشرها لتحقيق الحل العاملين في الخلية. هذا التدفق غير مرئية بسبب أحمر الفينول وأضاف أن الحل العمل.
  3. وسوف نظهر أيضا الحقن المباشر في السيتوبلازم الخلية. microinjection مباشرة في الخلية هو أكثر قوة ولكن وقتا طويلا في اتجاه الجنين السليم وتقنية microinjection هو مطلوب. كما غشاء الخلية هو أكثر صرامة من الغشاء المحي ، غالبا ما يكون أسرع لدخول micropipette صفار من خلال التوصل إلى السيتوبلازم الخلية. قد توجيه القطب الحيواني نحو قاع الحوض ، والعمل مع المعونة أيدي ثابتة في هذا الأسلوب من الحقن.
  4. بعد microinjection ، وضع الأجنة في طبق بيتري مع E3 المتوسطة واحتضان لهم في التطور الطبيعي ل28.5 درجة مئوية.
  5. خلال الساعات القليلة المقبلة والأيام من تطور الجنين ، مراقبة الجنين عن الظواهر اهتمامك.

الجزء 8 : نتائج الممثل

EGFP مرنا overexpression : التحقق من نجاح microinjection ، وسوف نقوم بمراقبة التعبير عن GFP في الأجنة النامية في مرحلة بداية درع (~ 6 HPF) في الجسم الحي بواسطة المجهر مضان كامل الجنين (لايكا مايكروسيستمز GMBH ، MZFLIII). التعبير عن بناء أكثر قوية خلال الأحداث المبكرة من التطور الجنيني ، وسوف يقلل كثيرا خلال التنمية كما توج حقن الحمض النووي الريبي هو المتدهورة بشكل تدريجي ويعتمد على استقرار البروتين المعبر عنها.

pkd2 متعدية حجب morpholino : بناء على النتائج المنشورة سابقا ، فإننا نتوقع أن morphants pkd2 لتقليد محور الجسم الظهري انحناء كما وجدت في pkd2 الزرد متحولة والخراجات الكلى حاضرا في حوالي 2 -- 3 4 DPF.

الشكل 1
الشكل 1 : نتائج من الممثل microinjection من EGFP مرنا وpkd2 morpholino أغسطس (أ) كانت microinjected TAB الأجنة في مرحلة 1 - زنزانة مع 0.17 نانوغرام من EGFP مرنا وتصور في 1 DPF في التعبير عن GFP الجسم الحي. (ب ، ج) وmicroinjected TAB الأجنة في مرحلة 1 - NL زنزانة مع 1،7 ~ من morpholino متعدية pkd2 حظر عند 0.50 ملم وسجل للانحناء الجسم الظهري في 4 DPF.

Subscription Required. Please recommend JoVE to your librarian.

Discussion: Microinjection من مرنا والعقاقير [أليغنوكليوتيد] Morpholino اسماك الزرد في الأجنة.

Microinjection في الأجنة الزرد هي تقنية راسخة وقوية لاستكشاف دور جين خاص في مجال التنمية. وتشمل التطبيقات overexpression ، misexpression ، وضربة قاضية لفحوصات الجينات اهتمامك ، فضلا عن تحليل روكبي بين جينات متعددة. وقد Microinjection في الزرد المستخدمة على نطاق واسع لتوليد حيوانات معدلة وراثيا ، ورسم الخرائط مصير الخلايا في الأجنة المبكرة الأريمة 5،6،7،8،9. بالإضافة إلى ذلك ، تطبيق هذه التقنية هي بمثابة خطوة رئيسية في توليد الجرثومية خط الوهم بالطرق زرع الخلية 10.

واحد طريقة بديلة لاستكشاف الجينات في النمط الظاهري "كسب من بين الدالة' هو microinject الأشكال النشطة constitutively من هذا الجين. بالإضافة ، يمكن استكشاف الجينات الزائفة في "الخسارة من وظيفة" النمط الظاهري بواسطة microinjection أشكال السلبية السائدة في ذلك الجين. قد Microinjection في الأجنة الزرد تشمل أيضا الحمض النووي والجزيئات الصغيرة 11،12.

والخطوة الحاسمة في هذه التقنية هو microinjection نوعية الإبرة micropipette. نحن لدينا micropipette جعل من الأنابيب الشعرية التي شكلتها جهاز مجتذب ماصة. فمن الضروري أن يتم معايرة بشكل صحيح مجتذب ماصة لانتاج الشكل الأمثل وحجم الإبرة. Micropipettes التي تكون طويلة جدا وضيقة في كثير من الأحيان عدم صلابة ، وكسر بسهولة ، والنضال من أجل اختراق المشيماء وصفار البيض. micropipettes قصيرة غالبا ما تكون أكثر عرضة للتلف خلال microinjection الجنين.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures: Microinjection من مرنا والعقاقير [أليغنوكليوتيد] Morpholino اسماك الزرد في الأجنة.

Acknowledgements: Microinjection من مرنا والعقاقير [أليغنوكليوتيد] Morpholino اسماك الزرد في الأجنة.

وأيد هذا العمل من قبل المعاهد الوطنية للصحة ومؤسسة PKD لZS. وأجريت التجارب على الحيوانات فقط وفقا لمركز يال الثروة الحيوانية (YARC) والمؤسسية رعاية الحيوان واستخدام المبادئ التوجيهية للجنة (IACUC).

Materials: Microinjection من مرنا والعقاقير [أليغنوكليوتيد] Morpholino اسماك الزرد في الأجنة.

Name Type Company Catalog Number Comments
1x E3 Medium Reagent 5 mM NaCl
0.17 mM KCl
0.33 mM CaCl2
0.33 mM MgSO2
0.1% Methylene blue
All other materials are listed in the protocol.

References: Microinjection من مرنا والعقاقير [أليغنوكليوتيد] Morpholino اسماك الزرد في الأجنة.

  1. Westerfield, M. The zebrafish book. A guide for the laboratory use of zebrafish (Danio rerio). 4th edn, 5.2 (University of Oregon, 2000).
  2. Nasevicius, A. & Ekker, S. Effective targeted gene 'knockdown' in zebrafish. Nat Genet 26, 216-220 (2000).
  3. Draper, B., Morcos, P. & Kimmel, C. Inhibition of zebrafish fgf8 pre-mRNA splicing with morpholino oligos: a quantifiable method for gene knockdown. Genesis 30, 154-156 (2001).
  4. Sun, Z. et al. A genetic screen in zebrafish identifies cilia genes as a principal cause of cystic kidney. Development 131, 4085-4093 (2004).
  5. Stuart, G., McMurray, J. & Westerfield, M. Replication, integration and stable germ-line transmission of foreign sequences injected into early zebrafish embryos. Development 103, 403-412 (1988).
  6. Stuart, G., Vielkind, J., McMurray, J. & Westerfield, M. Stable lines of transgenic zebrafish exhibit reproducible patterns of transgene expression. Development 109, 577-584 (1990).
  7. Culp, P., Nüsslein-Volhard, C. & Hopkins, N. High-frequency germ-line transmission of plasmid DNA sequences injected into fertilized zebrafish eggs. Proc Natl Acad Sci U S A 88, 7953-7957 (1991).
  8. Strehlow, D., Heinrich, G. & Gilbert, W. The fates of the blastomeres of the 16-cell zebrafish embryo. Development 120, 1791-1798 (1994).
  9. Helde, K., Wilson, E., Cretekos, C. & Grunwald, D. Contribution of early cells to the fate map of the zebrafish gastrula. Science 265, 517-520 (1994).
  10. Lin, S., Long, W., Chen, J. & Hopkins, N. Production of germ-line chimeras in zebrafish by cell transplants from genetically pigmented to albino embryos. Proc Natl Acad Sci U S A 89, 4519-4523 (1992).
  11. Long, Q. et al. GATA-1 expression pattern can be recapitulated in living transgenic zebrafish using GFP reporter gene. Development 124, 4105-4111 (1997).
  12. Murphey, R. & Zon, L. Small molecule screening in the zebrafish. Methods 39, 255-261 (2006).

Ask the Author: Microinjection من مرنا والعقاقير [أليغنوكليوتيد] Morpholino اسماك الزرد في الأجنة.

6 Comments

Dear
Shiaulou Yuan & Zhaoxia Sun
First of all thanks for such a nice presentation for the publication entitled "Microinjection of mRNA and Morpholino Antisense Oligonucleotides in Zebrafish Embryos". I am highly impressed by your work and the ease of understanding. I will be highly obliged if you could send me the full procedure of micro injection or alternatively full text of your publication. I am a PhD student working at Centre for Clinical Research in Neuropsychiatry,Graylands Hospital & Centre of Excellence for Alzhiemer's Disease Research & Care, Perth, Australia. I found this journal very useful for me. Do your university provide a short term training for some techniques related to Zebrafish Research. I shall be thankful to you for your kind help
Cheers
Avdesh

1

Reply

Posted by: AvdeshSeptember 22, 2009, 7:45 PM

Hi Avdesh,
Thank you for watching the video and for your comments. I can email you the PDF version of this protocol if you send me a email. Unfortunately, Yale doesn't seem to have any short-term zebrafish training courses. However, MBL Woods Hole usually offers a 2-week summer course titled "Zebrafish Development & Genetics." It seems like a nice opportunity to learn about zebrafish research with some great investigators & lecturers. Here's a link to their website if you're interested:
www.mbl.edu/education/courses/special_topics/zebra.html
Let me know if you have any other questions!
Best,
Shiaulou
shiaulou.yuan@yale.edu

1.1

Reply

Posted by: ShiaulouSeptember 23, 2009, 3:37 PM

Dear Shiaulou,
Thanks for sharing the video, it helps lots for beginner like me. I encountered problem for my microinjection. I found accumulation of red liquid (which i suspect is phenol red) in the intestine of zebrafish embryos after 3 days of injection. I repeated the injection with different batch of embryos, i got the same result. So, i tried injecting morpholino without phenol red, i did not get any red liquid accumulation, this quite convince me that it was the phenol red in the intestine. So, do you come across this problem before? What usually happen to the phenol red after injection?
Thanks.

Regards,
Sze Huey

2

Reply

Posted by: Tan S.May 11, 2010, 11:40 PM

Hi Sze,
Thanks for watching! We have not encountered this problem before. Could it be due to a high injection amount of phenol red? Are your embryos visibly red at all several hours post injection? May I ask what dilution you're using and how much you're injecting? Also, we always obtain phenol red as a stock solution from Sigma - maybe a different source could the issue?

From my understanding, phenol red has been widely used for years by numerous zebrafish labs (including ours) for aiding microinjections; it should be fairly innocuous. I always believed that the dye becomes diluted or pumped out of the cells gradually over time but I have not read any literature that examines that.

One easy solution would be to inject without using phenol red since it's not necessary and only serves as a marker. Another idea is to use another dye, maybe bromophenol blue? I've never personally tried that but it could be an option!

Best,
Shiaulou

2.1

Reply

Posted by: ShiaulouMay 12, 2010, 3:52 PM

Thanks, Shiaulou.
The phenol red I used was 0.2%, from stock solution of 0.5%, Sigma. I injected 2.3nl (moprholino plus phenol red) into each embryo. Normally, the embryos are visibly red after 2-3 hours post injection.
At which stage you think the elimination of the dye could happen? Because the accumulation of phenol red in the intestine can only be seen around 60-72 hours post fertilization.
Thanks.

Regards,
Sze Huey

2.1.1

Reply

Posted by: Tan S.May 12, 2010, 11:41 PM

Hi Sze,
The Sigma phenol red stock we obtain is also 0.5% but we use a final working concentration of 0.025% to 0.050% for injections. We take the the 0.5% Sigma stock and dilute it 1/10 or 1/20 in our morpholino or RNA solution that we wish to inject. Is 0.2% phenol red your working concentration that you're injecting at? If so, that's could be the problem.

I would guess that the phenol red injected at the 1-cell stage is gradually diluted as the cells divide and multiply but again, I have no evidence for this. Typically, I never notice the being visibly red ~7-8 hours post injection unless a huge amount or concentration of phenol red solution is injected. Is the dye gone from the intestine after day 3?

Best,
Shiaulou

2.1.1.1

Reply

Posted by: shiaulouMay 15, 2010, 3:22 PM

Hi Shiaulou,
Thanks for the reply. Yes, i injected 0.2% of the phenol red of the working concentration. The dye stayed in the intestine until day 7.

Regards,
Sze Huey

2.1.1.1.1

Reply

Posted by: AnonymousMay 19, 2010, 1:57 AM

Hi,
First of all thanks for the video. In terms of results, what is the difference between injection on the yolk or directly into cell? Thanks in advance

3

Reply

Posted by: RosaneJuly 2, 2010, 10:34 AM

Hi,
It's preferable to inject straight into the cell if you want to ensure maximum expression and phenotype penetrance. However, it's a little bit more convenient to inject into the yolk since you don't have to position the embryo as much. This can be advantageous if your experiment requires a lot of injected embryos (one example is for collecting lysate to do protein-work).
Best,
Shiaulou

3.1

Reply

Posted by: ShiaulouJuly 2, 2010, 4:17 PM

Excellent. We also do routiinely in teh lab. Have you ever tried kupffer vesicle mounting and staining..... can you explain. I have tried several times (40-50 times) I succeeded only once!!

4

Reply

Posted by: Suresh P.September 23, 2010, 4:50 PM

Hi,
Yes, we do routine KV work. For staining and fixing KV for immunofluorescence, staging is quite is important; we recommend counting somites to ensure exact staging at 6-8 somite. Here's a protocol that has worked well for me:
1. Dechorionate manually or by pronase treatment
2. Stage the embryos for the age you desire (we recommend 6-8 somite)
3. Fix O/N at 4 degrees using diluted formalin (1 part formalin to 2.7 parts PBT)
4. Wash off formalin with PBT x 3
5. Manually deyolk using sharp watchmaker's forceps (#5) or tungsten needles. Be prepared to take your time! You want to remove all yolk from the embryo, this will improve your images greatly and makes the KV much easier to find.
6. (Optional) Dehydrate into 100% MeOH (use 50/50 MeOH/PBT for 5' then 100% MeOH for 5') and incubate O/N at -20 degrees. (Can skip this entire step if you desire, just depends on whether if your antibody requires MeOH fixation).
7. Rehydrate your sample (50/50 MeOH/PBT for 5' then 100% PBT for 5').
8. Wash 3x in PBT 5'
9. (Optional) If you skipped MeOH step, treat the samples in pre-chilled acetone for 7' at -20 degrees. Wash in 3x PBT again.
9. Block for 30' to 1hr using blocking solution (10% FBS in PBT).
10. Incubate O/N at 4 degrees or 2hrs at RT using your diluted primary antibody in blocking solution (for example, anti-acetylated tubulin + anti-atypical PKC are nice markers for ciliated KV work).
11. Wash 5x PBT, 20' each.
12. Incubate O/N at 4 degrees or 2hrs at RT using your diluted secondary antibody in blocking solution.
13. Wash 5x PBT, 20' each.
14. (Optional) Counterstain with DAPI, TOTO3 or equivalent (for example, 1:20000 DAPI for 20' in PBT at RT) then do a quick wash in PBT.
15. Remove as much PBT as possible then add mounting medium and let equilibrate for 20' at RT.
16. Pipette onto a microscope slide and flat mount. Positioning is crucial, you want to lay the embryo perfectly flat with the ventral side facing you. Use nail polish to seal if desired.

Feel free to contact me if you have more questions!

Best,
Shiaulou

4.1

Reply

Posted by: ShiaulouSeptember 23, 2010, 6:15 PM

Thanks for the reply. By the way, is there a "time" not stage or somites that helps in fixing. such as 12hpf 14hpf etc....

4.1.1

Reply

Posted by: SPSeptember 24, 2010, 9:40 AM

Hi,
Time-wise, 6 somite is at 12hpf, 8 somite is at 13hpf and 10 somite is 14hpf. Depending on your experiment, there could be developmental delay (some morpholinos and compounds show this effect) so I strongly recommend counting somites rather than solely relying on time if stage-matching your control and experimental embryos are important.

Best,
Shiaulou

4.1.1.1

Reply

Posted by: ShiaulouSeptember 25, 2010, 8:38 PM

OK

5

Reply

Posted by: AnonymousNovember 18, 2010, 2:06 PM

Hi,

Thanks for this video! Other protocols suggest injecting DNA/RNA/morpholino dissolved in KCl or Danieau's. Do you just use miliQ water, and do you think diluting in other solutions improves survival?

Thanks!

6

Reply

Posted by: NFJanuary 24, 2012, 10:18 AM

Hi, I've tried Danieau's before and it doesn't seem to make a noticeable difference compared to water, except sometimes I've noticed that MO's in Danieau's can get cloudy or precipitate when in cold storage for a long time. Genetools themselves recommend dissolving in water but they also mention Ringer's or Danieau's as alternatives. From my observation, there doesn't seem to be a significant difference in survival between water or Danieau but if you're curious, you could always inject some wild type embryos with water and some others with Danieau to see. Thanks for watching
Cheers,
Shiaulou

6.1

Reply

Posted by: ShiaulouJanuary 24, 2012, 2:27 PM

Post a Question / Comment / Request

You must be signed in to post a comment. Please or create an account.

Waiting
simple hit counter