The Journal of Visualized Experiments (JoVE) is a peer reviewed, PubMed-indexed video journal. Our mission is to increase the productivity of scientific research.
1The virology Core at the HIV Drug Resistance Program, NCI-Frederick, 2Division of Infectious Diseases, University of Pittsburgh, 3Department of Molecular Biology and Microbiology, Tuffts University
This article is a part of JoVE Immunology and Infection. If you think this article would be useful for your research, please recommend JoVE to your institution's librarian.
Recommend JoVE to Your LibrarianCurrent Access Through Your IP Address
Current Access Through Your Registered Email Address
Mens, H., Kearney, M., Wiegand, A., Spindler, J., Maldarelli, F., Mellors, J. W., et al. Amplifying and Quantifying HIV-1 RNA in HIV Infected Individuals with Viral Loads Below the Limit of Detection by Standard Clinical Assays. J. Vis. Exp. (55), e2960, doi:10.3791/2960 (2011).
Amplifying viral genes and quantifying HIV-1 RNA in HIV-1 infected individuals with viral loads below the limit of detection by standard assays (below 50-75 copies/ml) is necessary to gain insight to viral dynamics and virus host interactions in patients who naturally control the infection and those who are on combination antiretroviral therapy (cART).
Here we describe how to amplify viral genomes by single genome sequencing (the SGS protocol) 13, 19 and how to accurately quantify HIV-1 RNA in patients with low viral loads (the single-copy assay (SCA) protocol) 12, 20.
The single-copy assay is a real-time PCR assay with sensitivity depending on the volume of plasma being assayed. If a single virus genome is detected in 7 ml of plasma, then the RNA copy number is reported to be 0.3 copies/ml. The assay has an internal control testing for the efficiency of RNA extraction, and controls for possible amplification from DNA or contamination. Patient samples are measured in triplicate.
The single-genome sequencing assay (SGS), now widely used and considered to be non-labor intensive 3, 7, 12, 14, 15,is a limiting dilution assay, in which endpoint diluted cDNA product is spread over a 96-well plate. According to a Poisson distribution, when less than 1/3 of the wells give product, there is an 80% chance of the PCR product being resultant of amplification from a single cDNA molecule. SGS has the advantage over cloning of not being subjected to resampling and not being biased by PCR-introduced recombination 19. However, the amplification success of SCA and SGS depend on primer design. Both assays were developed for HIV-1 subtype B, but can be adapted for other subtypes and other regions of the genome by changing primers, probes, and standards.
1. Extraction of RNA from large volumes of plasma
An overview of the single copy assay (SCA) and the single genome sequencing (SGS) protocol are provided in Figures 1 and 2.
2. The Single Copy assay
A 96-well plate holds 8 patient samples including both HIV and RCAS standards and controls. This protocol will describe the set-up of a single plate.
3. Single Genome Sequencing
4. Representative results:
SCA:
All the controls should pass in order to consider the HIV-1 RNA measurement correct. If a negative control is positive, the run should be disregarded because of possible contamination. In order to control for losses of RNA during the extraction step, at least 50% of the RCAS spiked in plasma should be recovered. If the average RCAS is <15,000 copies, the sample fails and should be disregarded because a significant amount of RNA could have been lost during extraction or other steps of the protocol. This occurs in about 10% of all patient samples tested likely due to high lipids in plasma6. The recovery of the RCAS virus is meant to control for the quality of the extraction and the efficiency of cDNA synthesis and PCR amplification. It is not used to correct for HIV recovery since HIV is likely bound to immunoglobulins and other human proteins making it slightly different from virus isolated from tissue culture. The recovery of the RCAS in our lab was on average 25,716 +/- 4,057 copies/reaction mixture, or about 95% +/-15% of the RCAS RNA added17. The NRT (no reverse transcriptase) control is run in parallel in order to test for the amplification from DNA. The NRT value is subtracted from each of the three HIV-1 RNA values, then the average is calculated and if this number is less than zero (the amplification of DNA exceeds the amplification of RNA), the result would fail and should be disregarded because of risk of amplification from DNA rather than RNA. If HIV-1 RNA is only amplified from 1/3 wells, re-testing the sample is recommended to ensure that the amplification is true for the actual sample being assayed and not due to a possible contaminant.
If all the controls pass, the average HIV-1 RNA copy number in plasma can be calculated.
Example 1: If the average HIV-1 copy number is zero, the limit of detection is calculated based on the volume of plasma assayed. As an example; let's say 7 ml of plasma was assayed. The smallest amount of RNA that could have been detected with this assay would have been 1 copy in one of the wells and 0 copies in the two other wells giving an average of 0.33 copies per well. The average copy number then has to be multiplied by a factor of 5.5 to get to the total copy number in the RNA elution (there is 10 ul in each well, but the total elution volume was 55 ul). The lower limit of detection is then: 5.5 x 0.33 copies divided by 7ml = 1.83/7=0.3 copies/ml. The concentration of HIV-1 RNA in plasma in this example was<0.3 copies/ml.
Example 2: HIV-1 RNA is detectable. RNA was extracted from 7 ml of plasma. The average copy number of HIV-1 RNA per well is calculated to be 2.0 copies per well. Then the average copy number per ml of plasma is 5.5 x 2.0 copies/7 ml = 1.6 HIV-1 RNA/ml of plasma.
A template Excel sheet used to calculate copy numbers can be down loaded from the website.
SGS:
If one of the negative controls is positive the run should be disregarded due to possible contamination. The number of product from each run will depend on the viral load in each sample and the condition of the sample. In our experience a lot of lipids or cells in plasma will reduce the chance of obtaining product. Storing conditions and previous freezing and thawing of the sample will also influence the recovery of RNA greatly. In general, when working with samples with viral loads below 50 copies/ml, product (bands on gel) is to be expected in about 1/3 -1/2 of the samples processed. Depending on the above mentioned factors, 1-5 bands per plate should be considered a good result due to the low viral loads in these patients.
| cDNA synthesis (RT Cocktail/cDNA reaction) | 1 reaction | No reverse transcriptase (NRT) cocktail/cDNA reaction (1 reaction) |
| Molecular Grade H2O | 8.1 ul | 8.2 ul |
| 25 mM MgCl2 | 6 ul | 6 ul |
| 25 mM dNTPs | 0.6 ul | 0.6 ul |
| 100 mM DTT | 0.2 ul | 0.2 ul |
| Random Hexamers (0.1 ug/ul) | 1.5 ul | 1.5 ul |
| 10X TaqMan Buffer A | 3.0 ul | 3.0 ul |
| Rnasin (40 U/uL) | 0.5 ul | 0.5 ul |
| Strategene RT (200 U/ul) | 0.1 ul | Do not add |
| Total | 20 ul | 20 ul |
| Sample RNA | 10 ul | 10 ul |
| Total volume | 30 ul | 30 ul |
Table 1. Reaction mixtures for cDNA synthesis in Single Copy Assay.
| PCR master mix | 1 reaction | Primers |
| H2O | 15.1 ul | HIV Forward Primer 5'-CATGTTTTCAGCATTATCAGAAGGA-3' |
| 10X PCR Gold Buffer | 2.0 ul | HIV Reverse Primer 5'-TGCTTGATGTCCCCCCACT-3' |
| 25 mM MgCl2 | 2.0 ul | HIV Probe5'FAM-CCACCCCACAAGATTTAAACACCATGCTAA-TAMRA 3' |
| *Forward Primer (100 um) | 0.3 ul | |
| *Reverse Primer (100 um) | 0.3 ul | RCAS Forward Primer5'-GTCAATAGAGAGAGGGATGGACAAA-3' |
| *Probe (100 um) | 0.05 ul | RCAS Reverse Primer5'-TCCACAAGTGTAGCAGAGCCC-3' |
| TaqGold (5 U/ul) | 0.25 ul | RCAS Probe 5'FAM-TGGGTCGGGTGGTCGTGCC-TAMRA 3' |
| Total | 20.0 ul |
Table 2. PCR master mix and primers for Single Copy Assay.
| cDNA cocktail/cDNA reactions | 1 RNA sample | First PCR cocktail | 1 plate (75 reactions) | Nested PCR cocktail | 1 plate (75 reactions) |
| 10X RT Buffer (Invitrogen) | 10 ul | 10X PCR buffer (Invitrogen) | 75 ul | 10X PCR buffer | 150 ul |
| 25 mM MgCl2 | 20 ul | 50 mM MgSO4 | 30 ul | 50 mM MgSO4 | 60 ul |
| 0.1M DTT | 1 ul | 10 mM dNTPs | 15 ul | 10 mM dNTPs | 30 ul |
| RNase-free water | 17.5 ul | 50 uM primers (ea) | 3 ul | 50 uM primers (ea) | 6 ul |
| Rnase-Out (Invitrogen) | 1 ul | Platinum Taq Hi Fi Enzyme (invitrogen) | 6 ul | Platinum Taq Hi Fi Enzyme (Invitrogen) | 12 ul |
| Superscript III (200 U/ul) (invitrogen) | 0.5 ul | Molecular-grade water | 468 ul | Molecular-grade water | 1086 ul |
Table 1. cDNA and PCR mixtures for Single Genome Sequencing.
| P6-RT 1 PCR program | Env 1 PCR program |
| 1. 94°C for 2 minute | 1. 94°C for 2 minute |
| 2. 94°C for 30 seconds | 2 .94°C for 30 seconds |
| 2 .94°C for 30 seconds | 3. 52°C for 30 seconds |
| 4. 72°C for 1 minute 30 seconds | 4. 72°C for 1 minute |
| 5. Go to #2, 44 cycles | 5. Go to #2, 44 cycles |
| 6. 72°C for 3 minutes | 6. 72°C for 3 minutes |
| 7. 4°C hold | 7. 4°C hold |
| P6-RT 2 PCR program | Env 2 PCR program |
| 1. 94°C for 2 minutes | 1. 94°C for 2 minutes |
| 2. 94°C for 30 seconds | 2. 94°C for 30 seconds |
| 3. 55°C for 30 seconds | 3. 56°C for 30 seconds |
| 4. 72°C for 1 minute | 4. 72°C for 45 seconds |
| 5. Go to # 1, 40 (41 cycles total) | 5. Go to # 1, 40 (41 cycles total) |
| 6. 72°C for 3 minutes | 6. 72°C for 3 minutes |
| 7. 4°C hold | 7. 4°C hold |
Table 4. Thermocycler conditions for the Single Genome Sequencing Assay.
| Reaction | Primer | Sequence |
| P6-RT cDNA | 3500- | 5' CTATTAAGTATTTTGATGGGTCATAA 3' |
| env cDNA | E115- | 5'AGAAAAATTCCCCTCCACAATTAA 3' |
| P6-RT 1. PCR | 3500- | 5' CTATTAAGTATTTTGATGGGTCATAA 3' |
| P6-RT 1. PCR | 1849+ | 5' GATGACAGCATGTCAGGGAG 3' |
| P6-RT 2.PCR | 1870+ | 5' GAGTTTTGGCTGAGGCAATGAG 3' |
| P6-RT 2.PCR | 3410- | 5' CAGTTAGTGGTATTACTTCTGTTAGTGCTT 3' |
| env 1. PCR | E115- | 5'AGAAAAATTCCCCTCCACAATTAA 3' |
| env 1. PCR | E20+ | 5'GGGCCACACATGCCTGTGTACCCACAG 3' |
| env 2. PCR | E30+ | 5'GTGTACCCACAGACCCCAGCCCACAAG3' |
| env 2. PCR | E125- | 5'CAATTTCTGGGTCCCCTCCTGAGG 3' |
| P6-RT sequencing | 2030+ | 5'TGTTGGAAATGTGGAAAGGAAGGAC 3' |
| P6-RT sequencing | 2600+ | 5'ATGGCCCAAAAGTTAAACAATGGC3' |
| P6-RT sequencing | 2610- | 5'TTCTTCTGTCAATGGCCATTGTTTAAC3' |
| P6-RT sequencing | 3330- | 5'TTGCCCAATTCAATTTTCCCACTAA 3' |
| env sequencing | E30+ | 5'GTGTACCCACAGACCCCAGCCCACAAG3' |
| env sequencing | E125- | 5'CAATTTCTGGGTCCCCTCCTGAGG 3' |
Table 5. Primers for the Single Genome Sequencing Assay.

Figure 1. Overview of the Singe Genome Sequencing Assay (SGS).

Figure 2. Overview of the Single Copy Assay (SCA).

Figure 3. Plate set-up for the Single Copy Assay.

Figure 4. Screen shot from the ABI 7700. A. showing the HIV-1 RNA standard curve with patient samples and B. showing RCAS standard curve with spiked patient samples.
Subscription Required. Please recommend JoVE to your librarian.
HIV-1 infected individuals on combination antiretroviral treatment (cART) or who naturally control the infection have very low viral loads, typically around 1 copy per ml of plasma4, 11, 12, 17, 18. Viral loads in patients with natural control, often fluctuate around an individual set point1, 2, 17. The sensitivity of the assays described herein is highly dependent on the input volume of plasma. Generally, we have been working with 7 ml of plasma, but positive results can be obtained from smaller amounts of plasma, as well, depending on the actual plasma viral load. The RNA extraction method described herein is a "home brew" which is labor intensive. We have found that this extraction method is very reliable and more effective than existing commercially available kits for RNA extraction. The quality of the plasma is important to get product. Previous freezing and thawing of plasma or storing at temperatures higher than -80 degrees will damage the RNA and reduce chances of product. A "pre-spin" of plasma is also highly recommended to separate out lipids, cells and other particularities that may interfere with the assay before ultra-centrifugation.
Several steps in the protocols have been automated.
The SCA assay has the advantage of being more sensitive than other ultrasensitive assays, as for example the real time assay described by Dornadula et al. with a lower limit of detection of 5.0 copies per ml of plasma5, the modified Amplicor ultrasensitive assay (Roche, Basel, Switzerland) described by Havlir et al.9 detecting down to 2.5 copies per ml of plasma and the semi-quantitative transcription-mediated amplification (TMA) assay described by Hatano et al.8 with an estimated lower limit of detection of 3.5 copies/ml. Compared to the other ultrasensitive assays5, 8, 9 RNA recovery in the SCA assay is monitored by an internal virion standard (RCAS) that possesses the same sedimentation rate as HIV-1, thus it acts as a backup virus to ensure that all viruses have been pelleted during the ultracentrifugation spin and have endured the remainder of the stringent extraction procedure. This is also very useful to help eliminate the possibility of false negative detection. The SCA assay has the obvious advantage over the TMA assay8 of being directly quantitative. However the SCA assay is compared to other ultrasensitive assays very labor intense and expensive. Results from the SCA assay are only reliable if all internal controls pass.
The single-genome assay is the gold standard for amplification of genomes. It has the advantage over cloning of not being subjected to re-sampling if the amount of input is low16 and is not biased by PCR introduced recombination15. However SGS is limited by primer design which may bias which HIV-1 populations are amplified10.
Both the SCA and SGS are highly dependent on primer design. Both assays described here were designed to amplify HIV-1 subtype B. Because of the variability within the B subtype, product is not obtained in about 10% of samples because of mismatches between primers and template. However, both assays can easily be adapted to other subtypes or other genomic regions by changing primer design and the standard curve.
Subscription Required. Please recommend JoVE to your librarian.
No conflicts of interest declared.
The authors wish to acknowledge the patients who participated in the many studies of HIV-1.
J.M.C. was a Research Professor of the American Cancer Society with support from the F.M. Kirby Foundation.
| Name | Company | Catalog Number | Comments |
| Random hexamers (500 ug/ml) | Promega Corp. | C118A | |
| Taqman buffer A | Applied Biosystems | 4304441 | |
| RNAsin (40 U/ul) | Promega Corp. | N211B | |
| RT enzyme (200 U/ul) | Stratagene, Agilent Technologies | 600107-51 | |
| Amplitaq Gold DNA polymerase | Applied Biosystems | 4311814 | 6-pack |
| Amplitaq 10XGold PCR buffer II | Applied Biosystems | 4311814 | comes with the enzyme |
| Magnesiumcloride 25 mM | Applied Biosystems | 4311814 | comes with the enzyme |
| 1M Tris-HCl buffer, pH 8.0, 5 mM | Invitrogen | AM9855G | |
| Superscript III reverse transcriptase enzyme, 200 U/ul | Invitrogen | 18080-044 | |
| Superscript III 10X buffer | Invitrogen | comes with the enzyme | |
| DTT 100 mM | Invitrogen | comes with the enzyme | |
| Platinum Taq DNA polymerase High Fidelity 5 U/ul | Invitrogen | 11304-102 | |
| 10X High Fidelity PCR Buffer | Invitrogen | 11304-102 | comes with the enzyme |
| Proteinase-K 20 mg/ml | Ambion | 2546 | |
| Guanidinium Thiocyanate solution 6M | Fluka | 50983 | |
| Glycogen 20 mg/ml | Roche Group | 10901393001 | |
| Isopropanol | Sigma-Aldrich | 19516 | |
| Ethanol 70% | Sigma-Aldrich | E702-3 | |
| Molecular grade water | GIBCO, by Life Technologies | 10977-015 | |
| dNTPs (25 mmol each) | Bioline | BIO-39025 | |
| Easy Seal Centrifuge Tubes (16x73mm) | Seaton Scientific | 6041 | |
| White Delrin crowns | Seaton Scientific | 4020 | Caps for the Easy Seal Tubes |
| Tube Rack for Optiseal Bell-Top Tubes, 8.9 ml | Beckman Coulter Inc. | 361642 | |
| Hex driver ½ inc opening | Seaton Scientific | 4013 | |
| cap removal tupe | Seaton Scientific | 4014 | |
| 5 ml serological pipettes | Costar | 4051 | |
| Pipetboy | Any Supplier | ||
| 15 ml Transfer pipettes | ISC Bioexpress | P-5005-7 | |
| 5.8 ml Dispossable transfer pipettes, fine tip | VWR international | 14670-329 | |
| 15 ml centrifuge tubes | Falcon BD | ||
| 1 ml centrifuge tubes | Any Supplier | ||
| Tris buffer Saline tablets | Sigma-Aldrich | T5030-100TAB | |
| Ultracentrifuge and rotor | Sorvall, Thermo Scientific | 90SE and T-1270 | |
| 96-well PCR plates | Bio-Rad | HSS-9601 | |
| 50 ml Reagent reservoir | Costar | 4870 | |
| Microamp optical 96-well reaction plate | Applied Biosystems | N801-0560 | |
| Optical plate covers | Applied Biosystems | 4333183 | |
| MicroAmp Optical Compression Pad | Applied Biosystems | 4312639 | |
| Microseal A film | Bio-Rad | MSA-5001 | |
| 2 ml centrifuge tubes | Any Supplier | ||
| 1% agarose gels (E-gel, invitrogen) | Invitrogen | G-7008-01 | |
| E-base (Invitrogen) | Invitrogen | EB-M03 | |
| EDTA Collection tubes any brand | |||