The Journal of Visualized Experiments (JoVE) is a peer reviewed, PubMed-indexed video journal. Our mission is to increase the productivity of scientific research.
1Department of Medicine, Baylor College of Medicine, 2Division of Diabetes, Endocrinology & Metabolism, Diabetes & Endocrinology Research Center, Baylor College of Medicine, 3Department of Molecular & Cellular Biology, Baylor College of Medicine
Li, R., Oka, K., Yechoor, V. Neo-Islet Formation in Liver of Diabetic Mice by Helper-dependent Adenoviral Vector-Mediated Gene Transfer. J. Vis. Exp. (68), e4321, doi:10.3791/4321 (2012).
Type 1 diabetes is caused by T cell-mediated autoimmune destruction of insulin-producing cells in the pancreas. Until now insulin replacement is still the major therapy, because islet transplantation has been limited by donor availability and by the need for long-term immunosuppression. Induced islet neogenesis by gene transfer of Neuogenin3 (Ngn3), the islet lineage-defining specific transcription factor and Betacellulin (Btc), an islet growth factor has the potential to cure type 1 diabetes.
Adenoviral vectors (Ads) are highly efficient gene transfer vector; however, early generation Ads have several disadvantages for in vivo use. Helper-dependent Ads (HDAds) are the most advanced Ads that were developed to improve the safety profile of early generation of Ads and to prolong transgene expression1. They lack chronic toxicity because they lack viral coding sequences2-5 and retain only Ad cis elements necessary for vector replication and packaging. This allows cloning of up to 36 kb genes.
In this protocol, we describe the method to generate HDAd-Ngn3 and HDAd-Btc and to deliver these vectors into STZ-induced diabetic mice. Our results show that co-injection of HDAd-Ngn3 and HDAd-Btc induces 'neo islets' in the liver and reverses hyperglycemia in diabetic mice.
1. Clone the Therapeutic Genes into HDAd Shuttle Vector
2. Helper-dependent Adenoviral Vector Production
HDAd vector production involves multiple steps that need to be carefully followed for optimal results.
2.1 Transfection
2.2 Vector amplification
2.3 Large scale HDAd production
2.4 Vector purification
2.5 Characterization of HDAd vectors
3. Treatment of Diabetic Mice by HDAd-Ngn3 and -Btc
3.1 Induction of diabetes in mice and injection of HDAd vectors
3.2 Monitoring mice glucose and injection of HDAd vectors.
3.3 Analysis of effects of HDAd-Ngn3+HDAd-Btc treatment.
3.4 Perform glucose tolerance test (GTT) at 6 weeks after treatment.
3.5 Tissue analysis to assess the expression of the vectors and assess the induction of islet neogenesis.
In all these steps the controls that are required to reliably interpret the results include: (1) Empty vector treated diabetic mice (2) non-diabetic mice and (3) non-diabetic pancreas serving as a positive control for the expression of the islet specific hormones and transcription factors.
4. Representative Results
We cloned Ngn3 and Btc cDNA into pΔ28 vectors driven by ubiquitous promoter eIF2a (BOS) and generated HDAd-Ngn3 and HDAd-Btc. As shown in Figure 2, relative HV contamination decreased significantly (implying more vector amplification and less helper amplification) at passage 3. Therefore, we used P3 for subsequent vector production. After the first CsCl discontinuous gradient and ultracentrifugation, we collected the lowest vector band and then collected the opalescent band corresponding to HDAd vector in the second ultracentrifugation (Figure 3). The purified HDAd vector had less than 1% of HV contamination (Figure 4A) by qPCR and had no helper contamination visible on southern blotting (Figure 4B), indicating sufficient quality for vector infusion into mice. Further analysis included transgene expression by infection of 116 cells. The mRNA expression levels of Ngn3 and Btc were higher in vector infected cells by over 10,000-fold compared with those in non infected cells (Figure 5).
HDAd-Ngn3 and -Btc were then administered to STZ-induced diabetic mice via tail vein injection with empty vector injected and HDAd-Btc injected diabetic mice serving as negative control. Hyperglycemia was reversed and glucose-stimulated insulin secretion was restored in mice treated with both HDAd-Ngn3 and HDAd-Btc but not in mice treated with single gene vector or control empty vector (Figure 6). The HDAd-Ngn3-Btc treatment induced islet neogenesis and this was quantitated by assaying total insulin and c-peptide content (Figure 6E) with non-diabetic, diabetic empty vector treated mice serving as controls. The presence of c-peptide and insulin in equimolar ratios confirms that the insulin being detected in the liver is indeed being synthesized in the liver. RT-qPCR confirmed that the liver of HDAd-Ngn3-Btc treated mice expressed all the islet-specific hormones and transcription factors9. Immunohistochemistry showed insulin positive cells in the liver of mice treated with HDAd-Ngn3 and HDAd-Btc, but no insulin positive cells were observed in mice treated with control vector (Figure 7). We also confirmed that there were no residual islets in the pancreas of the Ngn3-Btc treated mice as compared to the numerous islets in non-diabetic pancreas. Vector (Ngn3 and Btc) along with islet specific lineage transcription factor (Pdx-1 and Nkx6.1) expression was also assessed by immunostaining of the liver (Figure 7).

Figure 1. Flow chart of gene therapy of diabetic mice using helper-dependent virus system. First, Ngn3 and Btc, in a cassette driven by a ubiquitous BOS promoter, are cloned into HDAd shuttle (pΔ28) vectors. HDAd is produced by several steps including transfection, serial passages of amplification, and a large scale infection followed by vector purification. After characterizing the quality, HDAds are injected intravenously into STZ-induced diabetic mice via tail vein. The effects of treatment are assessed by measuring glucose, body weight, GTT and by analyses of gene expression in the liver.

Figure 2. Determination HDAd vector amplification. DNA is extracted from passage P0 to P4 using DNA extraction kits (Qiagen). DNA is diluted 1,000-fold and 5μl DNA is used for real time PCR (qPCR). Helper and vector-specific primers are used. Standard curves are generated by serial dilutions (10-5 to 1 ng/ml) of HDAd shuttle vector plasmid and HV plasmid (top panels). Using the standard curves and the Ct values for the vector and helper virus copy number is calculated and the ratio of HDAd/HV is plotted as a percentage of the total virus (helper + HDAd). Hence, relative vector amplification is calculated as: [vector copy number / (vector + helper virus copy number)]. In the example shown (bottom panel) HDAd vector amplification plateaued at P4, while the relative HDAd/HV is increasing at P3. Therefore, P3 is selected for the subsequent step.

Figure 3. Representative HDAd vector bands after discontinuous CsCl density ultracentrifugation. HDAd vector is purified from a 3L spinner culture over sequential CsCl density gradient. (A) After first density gradient ultracentrifugation, a single opalescent vector band is visible (arrow) below opaque cell debris (CD). The opalescent band (arrow) is collected for the second density gradient centrifugation. (B) After the second density gradient ultracentrifugation, the opalescent band (arrow) is collected for dialysis.

Figure 4. Analysis of helper virus contamination. DNA is extracted from 50μl purified virus and helper contamination is assessed as in Figure 2. The figure shows helper contamination of HDAd-Ngn3 and HDAd-Btc is less than 1%.

Figure 5. Analysis of structure of HDAd vector. Southern blot is performed as described previously (Oka K, et al.). Lane 1: DNA from helper virus; Lane 2: DNA from P3; Lane 3: DNA from P4; Lane 4: purified vectopr. Open arrows indicate the helper virus derived bands and the filled arrows indicate the ITR bands derived from the HDAd vector.

Figure 6. Expression level of Ngn3 or Btc in 116 cells infected with HDAd-Ngn3 or HDAd-Btc vector. 116 Cells in a 12 well plates are infected with HDAd-Ngn3 or HDAd-Btc or empty vector at 1000 vp/cell for 2 days. Cells are harvested and total RNA is extracted using Trizol reagent. qRT-PCR is performed using Ngn3- or Btc-specific primers. The relative Ngn3 or Btc mRNA expression increased by over 10,000-fold in cells infected with HDAd-Ngn3 or HDAd-Btc. The figure is reprinted from Dev.Cell 2009 Mar; 16 (3) : 358-73; Yechoor et. al., with permission from Elsevier.

Figure 7. Gene transfer of HDAd-Ngn3 and HDAd-Btc into STZ-induced diabetic mice leads to reversal of diabetes and induction of islet neogenesis in the liver. (A) Plasma glucose and (B) body weight of STZ-induced diabetic mice treated with HDAd-Ngn3 and HDAd-Btc. (C) Plasma glucose and insulin during an IP-GTT at 6 weeks after treatment. (D) Representative insulin staining in the liver 12 weeks after treatment. *p<0.05 (vs. empty vector group). The figure is reprinted from Dev. Cell 2009 Mar; 16 (3) : 358-73; Yechoor et al., with permission from Elsevier.
| name | forward primer | reverse primer | |
| helper | GACCATCAATCTTGACGACC | ATGTCGCTTTCCAGAACCC | |
| vector | TTGGGCGTAACCGAGTAAG | ACTTCCTACCCATAAGCTCC | |
| Ngn3 | AAGAGCGAGTTGGCACTCAG | TCTGAGTCAGTGCCCAGATG | |
| Btc | GCACAGGTACCACCCCTAGA | TGAACACCACCATGACCACT | |
Table 1. Primer sequences.
HDAds have been developed to overcome the weakness of early generation Ads and to harness for gene therapy application. However, technical challenges remain. For example, HDAd requires HV for HDAd's packaging and vector amplification is not as efficient as early generation Ads. HV is a first generation Ad and any contamination of HV compromise the effectiveness of HDAd. Therefore, highly efficient transfection and optimal conditions for each serial passage are critical. Another critical parameter for vector production is which passage (P1-P4) should be used for subsequent passage 5 that is directly used as inoculum for suspension cells. To our experience, the best results are obtained by using the passage by which HDAd vector proportion is dramatically increased in the following passage (P3 in Figure 2). The yield of HDAd vectors depends on transgene cassettes. During vector production, both transgenes are expressed because both genes are under ubiquitous promoter. Ngn3 is a transcription factor and Btc is a growth factor, which suggests that HDAd vector expressing transcription factor which may influence cell lineage inhibits vector amplification while that expressing growth hormone helps in vector replication and packaging.
With diabetes assuming epidemic proportions, new approaches to restore b-cell mass are needed. In this report, we describe methods to harness the advantages of HDAd vectors to effect gene transfer of islet lineage-defining transcription factor, Ngn3 along with the islet growth factor, betacellulin to induce islet neogenesis in periportal regions of the liver. To assess the efficacy of this, it is important to choose mice with stable hyperglycemia and ensure that appropriate controls are always included. For this gene transfer experiments, the empty vector treated diabetic mice should always be utilized. In addition, using HDAd-Ngn3 and HDAd-Btc individually treated diabetic mice serves to test the individual contribution of these two genes in islet neogenesis. As our data demonstrates that Ngn3 alone is sufficient to induce islet neogenesis, but the addition of the growth factor, Btc, serves to augment the response leading to robust induction of islet neogenesis. It is also important to test that the vector expression is indeed achieved in the target tissue, the liver and also to demonstrate that the insulin assayed in the plasma of treated mice is not coming from residual islets in the pancreas, by demonstrating the absence of pancreatic islets in the diabetic mice.
In summary, the advantage of the HDAd-vector system for gene transfer lies in its high cloning capacity, efficient transduction and long lasting gene expression in the liver with minimum chronic toxicity as well as its nature of non-integration of vector genome into the host chromosome. The primary limitations are the complex steps involved in its generation and its in vivo application is primarily limited to the liver with the most popular Ad serotype 5. Islet neogenesis can be induced to fully restore plasma insulin and glucose tolerance in diabetic mice by inducing islet neogenesis in the liver by gene transfer of islet lineage-defining transcription factor, Ngn3 along with the islet growth factor, betacellulin. In this report, we show the optimal protocol to generate high quality HDAd-Ngn3 and HDAd-Btc, and demonstrate techniques to induce and assess islet neogenesis in the livers of diabetic mice to reverse hyperglycemia.
Footnote: The viral vectors and the cell lines described here are available from the Vector Production Core Laboratory, Diabetes Research Center, Baylor College of Medicine (http://www.bcm.edu/mcb/index.cfm?pmid=7731). Some commercial kits are also available for generating HDAd viruses (e.g. Microbix biosystems Inc.).
No conflicts of interest declared.
This work was supported by grants from the NIH: R03 DK089061-01 (VKY); NIH: K08 DK068391 (VKY); the Diabetes and Endocrinology Research Center-(DERC - P30DK079638) at Baylor College of Medicine, a Pilot & Feasibility grant from the DERC (VKY); Juvenile Diabetes Research Foundation: JDRF Award # 5-2006-134 (VKY).
| Name | Company | Catalog Number | Comments |
| ProFectionR Mammalian Transfection kit | Promega | E1200 | |
| DNeasy Blood & Tissue Kit (50) | Qiagen | 69504 | |
| PerfeCTa SYBR Green SuperMix, ROX | Quanta Biosciences | 95055-500 | |
| Sodium deoxycholate | Sigma | D6750-25G | |
| MEM powder | Invitrogen | 61100087 | |
| Penicillin Streptomycin | Sigma | 15140122 | |
| FBS | Atlanta Biologicals | S11150 | |
| L-glutamine | Invitrogen | 25030-081 | |
| Hygromycin B | Sigma | H0654-1G | |
| MEM EAGLE JOKLIK | Sigma | M0518-10L | |
| Rnase | Roche | 10109169001 | |
| DNase I, grade II | Roche | 10104159001 | |
| Streptozocin | Sigma | s0130 | |
| Glass spinner flasks | Corning | 4500-3L | |
| Glass spinner flasks | Corning | 4500-250 | |
| Slide A-lyzer casset | PIERCE CH | PI66380 | |
| Tube optiseal poly allomer, 11.2 ml | Beckman Coulter | 362181 | |
| Cesium chloride 1 kg | JT4042-2 | VWR | |
| Beckman LE-80K | Beckman Coulter | Optimal LE-80K ultracentrifuge | |
| Filter | VWR | 28143-338 | |
| centrifuge tube 500 ml | Corning | 431123 | |
| tailveiner restrainer | Braintree scientific , INC | tv-150 | |
| Insulin, Mouse ELISA | Mercodia | 10-1247-01 | |
| microvette CB300 | Sarstedt | 16.443.100 | |
| D-glucose | Sigma | G8270 | |
| Mouse C-peptide ELISA Kit | Wako Pure Chemical Industries, Ltd | #631-07231 | |
| guinea pig anti-insulin antibody | Abcam | ab7842 | |
| goat anti-Pdx1 antibody | gift from Dr. Christopher Wright | ||
| mouse anti Ngn3 antibody | Beta Cell Biology Consortium, Univ. of Pennsylvania |
AB2013 | |
| mouse anti Nkx6.1 antibody | Beta Cell Biology Consortium, Univ. of Pennsylvania |
F64A6B4 | |
| anti- betacellulin antibody | Cell Sciences | PAAQ1 | |
| ALT (SGPT) Color Reagent SET. | Teco Diagnostics | A526 - 120 | |
| AST/(SGOT), Color Endpoint Reagent Set | Teco Diagnostics | A561-120 | |
Table 2. Specific Reagents and Equipment. |
|||