JoVE Visualize What is visualize?
Related JoVE Video
Pubmed Article
Transcriptomic study reveals widespread spliced leader trans-splicing, short 5-UTRs and potential complex carbon fixation mechanisms in the euglenoid Alga Eutreptiella sp.
PUBLISHED: 01-01-2013
Eutreptiella are an evolutionarily unique and ecologically important genus of microalgae, but they are poorly understood with regard to their genomic make-up and expression profiles. Through the analysis of the full-length cDNAs from a Eutreptiella species, we found a conserved 28-nt spliced leader sequence (Eut-SL, ACACUUUCUGAGUGUCUAUUUUUUUUCG) was trans-spliced to the mRNAs of Eutreptiella sp. Using a primer derived from Eut-SL, we constructed four cDNA libraries under contrasting physiological conditions for 454 pyrosequencing. Clustering analysis of the ?1.9×10(6) original reads (average length 382 bp) yielded 36,643 unique transcripts. Although only 28% of the transcripts matched documented genes, this fraction represents a functionally very diverse gene set, suggesting that SL trans-splicing is likely ubiquitous in this algas transcriptome. The mRNAs of Eutreptiella sp. seemed to have short 5- untranslated regions, estimated to be 21 nucleotides on average. Among the diverse biochemical pathways represented in the transcriptome we obtained, carbonic anhydrase and genes known to function in the C4 pathway and heterotrophic carbon fixation were found, posing a question whether Eutreptiella sp. employs multifaceted strategies to acquire and fix carbon efficiently. This first large-scale transcriptomic dataset for a euglenoid uncovers many potential novel genes and overall offers a valuable genetic resource for research on euglenoid algae.
Authors: Markus Hafner, Markus Landthaler, Lukas Burger, Mohsen Khorshid, Jean Hausser, Philipp Berninger, Andrea Rothballer, Manuel Ascano, Anna-Carina Jungkamp, Mathias Munschauer, Alexander Ulrich, Greg S. Wardle, Scott Dewell, Mihaela Zavolan, Thomas Tuschl.
Published: 07-02-2010
RNA transcripts are subjected to post-transcriptional gene regulation by interacting with hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) that are often expressed in a cell-type dependently. To understand how the interplay of these RNA-binding factors affects the regulation of individual transcripts, high resolution maps of in vivo protein-RNA interactions are necessary1. A combination of genetic, biochemical and computational approaches are typically applied to identify RNA-RBP or RNA-RNP interactions. Microarray profiling of RNAs associated with immunopurified RBPs (RIP-Chip)2 defines targets at a transcriptome level, but its application is limited to the characterization of kinetically stable interactions and only in rare cases3,4 allows to identify the RBP recognition element (RRE) within the long target RNA. More direct RBP target site information is obtained by combining in vivo UV crosslinking5,6 with immunoprecipitation7-9 followed by the isolation of crosslinked RNA segments and cDNA sequencing (CLIP)10. CLIP was used to identify targets of a number of RBPs11-17. However, CLIP is limited by the low efficiency of UV 254 nm RNA-protein crosslinking, and the location of the crosslink is not readily identifiable within the sequenced crosslinked fragments, making it difficult to separate UV-crosslinked target RNA segments from background non-crosslinked RNA fragments also present in the sample. We developed a powerful cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs that we term PAR-CliP (Photoactivatable-Ribonucleoside-Enhanced Crosslinking and Immunoprecipitation) (see Fig. 1A for an outline of the method). The method relies on the incorporation of photoreactive ribonucleoside analogs, such as 4-thiouridine (4-SU) and 6-thioguanosine (6-SG) into nascent RNA transcripts by living cells. Irradiation of the cells by UV light of 365 nm induces efficient crosslinking of photoreactive nucleoside-labeled cellular RNAs to interacting RBPs. Immunoprecipitation of the RBP of interest is followed by isolation of the crosslinked and coimmunoprecipitated RNA. The isolated RNA is converted into a cDNA library and deep sequenced using Solexa technology. One characteristic feature of cDNA libraries prepared by PAR-CliP is that the precise position of crosslinking can be identified by mutations residing in the sequenced cDNA. When using 4-SU, crosslinked sequences thymidine to cytidine transition, whereas using 6-SG results in guanosine to adenosine mutations. The presence of the mutations in crosslinked sequences makes it possible to separate them from the background of sequences derived from abundant cellular RNAs. Application of the method to a number of diverse RNA binding proteins was reported in Hafner et al.18
26 Related JoVE Articles!
Play Button
Synthesis of an Intein-mediated Artificial Protein Hydrogel
Authors: Miguel A. Ramirez, Zhilei Chen.
Institutions: Texas A&M University, College Station, Texas A&M University, College Station.
We present the synthesis of a highly stable protein hydrogel mediated by a split-intein-catalyzed protein trans-splicing reaction. The building blocks of this hydrogel are two protein block-copolymers each containing a subunit of a trimeric protein that serves as a crosslinker and one half of a split intein. A highly hydrophilic random coil is inserted into one of the block-copolymers for water retention. Mixing of the two protein block copolymers triggers an intein trans-splicing reaction, yielding a polypeptide unit with crosslinkers at either end that rapidly self-assembles into a hydrogel. This hydrogel is very stable under both acidic and basic conditions, at temperatures up to 50 °C, and in organic solvents. The hydrogel rapidly reforms after shear-induced rupture. Incorporation of a "docking station peptide" into the hydrogel building block enables convenient incorporation of "docking protein"-tagged target proteins. The hydrogel is compatible with tissue culture growth media, supports the diffusion of 20 kDa molecules, and enables the immobilization of bioactive globular proteins. The application of the intein-mediated protein hydrogel as an organic-solvent-compatible biocatalyst was demonstrated by encapsulating the horseradish peroxidase enzyme and corroborating its activity.
Bioengineering, Issue 83, split-intein, self-assembly, shear-thinning, enzyme, immobilization, organic synthesis
Play Button
Characterization of Complex Systems Using the Design of Experiments Approach: Transient Protein Expression in Tobacco as a Case Study
Authors: Johannes Felix Buyel, Rainer Fischer.
Institutions: RWTH Aachen University, Fraunhofer Gesellschaft.
Plants provide multiple benefits for the production of biopharmaceuticals including low costs, scalability, and safety. Transient expression offers the additional advantage of short development and production times, but expression levels can vary significantly between batches thus giving rise to regulatory concerns in the context of good manufacturing practice. We used a design of experiments (DoE) approach to determine the impact of major factors such as regulatory elements in the expression construct, plant growth and development parameters, and the incubation conditions during expression, on the variability of expression between batches. We tested plants expressing a model anti-HIV monoclonal antibody (2G12) and a fluorescent marker protein (DsRed). We discuss the rationale for selecting certain properties of the model and identify its potential limitations. The general approach can easily be transferred to other problems because the principles of the model are broadly applicable: knowledge-based parameter selection, complexity reduction by splitting the initial problem into smaller modules, software-guided setup of optimal experiment combinations and step-wise design augmentation. Therefore, the methodology is not only useful for characterizing protein expression in plants but also for the investigation of other complex systems lacking a mechanistic description. The predictive equations describing the interconnectivity between parameters can be used to establish mechanistic models for other complex systems.
Bioengineering, Issue 83, design of experiments (DoE), transient protein expression, plant-derived biopharmaceuticals, promoter, 5'UTR, fluorescent reporter protein, model building, incubation conditions, monoclonal antibody
Play Button
Transient Gene Expression in Tobacco using Gibson Assembly and the Gene Gun
Authors: Matthew D. Mattozzi, Mathias J. Voges, Pamela A. Silver, Jeffrey C. Way.
Institutions: Harvard University, Harvard Medical School, Delft University of Technology.
In order to target a single protein to multiple subcellular organelles, plants typically duplicate the relevant genes, and express each gene separately using complex regulatory strategies including differential promoters and/or signal sequences. Metabolic engineers and synthetic biologists interested in targeting enzymes to a particular organelle are faced with a challenge: For a protein that is to be localized to more than one organelle, the engineer must clone the same gene multiple times. This work presents a solution to this strategy: harnessing alternative splicing of mRNA. This technology takes advantage of established chloroplast and peroxisome targeting sequences and combines them into a single mRNA that is alternatively spliced. Some splice variants are sent to the chloroplast, some to the peroxisome, and some to the cytosol. Here the system is designed for multiple-organelle targeting with alternative splicing. In this work, GFP was expected to be expressed in the chloroplast, cytosol, and peroxisome by a series of rationally designed 5’ mRNA tags. These tags have the potential to reduce the amount of cloning required when heterologous genes need to be expressed in multiple subcellular organelles. The constructs were designed in previous work11, and were cloned using Gibson assembly, a ligation independent cloning method that does not require restriction enzymes. The resultant plasmids were introduced into Nicotiana benthamiana epidermal leaf cells with a modified Gene Gun protocol. Finally, transformed leaves were observed with confocal microscopy.
Environmental Sciences, Issue 86, Plant Leaves, Synthetic Biology, Plants, Genetically Modified, DNA, Plant, RNA, Gene Targeting, Plant Physiological Processes, Genes, Gene gun, Gibson assembly, Nicotiana benthamiana, Alternative splicing, confocal microscopy, chloroplast, peroxisome
Play Button
Profiling of Estrogen-regulated MicroRNAs in Breast Cancer Cells
Authors: Anne Katchy, Cecilia Williams.
Institutions: University of Houston.
Estrogen plays vital roles in mammary gland development and breast cancer progression. It mediates its function by binding to and activating the estrogen receptors (ERs), ERα, and ERβ. ERα is frequently upregulated in breast cancer and drives the proliferation of breast cancer cells. The ERs function as transcription factors and regulate gene expression. Whereas ERα's regulation of protein-coding genes is well established, its regulation of noncoding microRNA (miRNA) is less explored. miRNAs play a major role in the post-transcriptional regulation of genes, inhibiting their translation or degrading their mRNA. miRNAs can function as oncogenes or tumor suppressors and are also promising biomarkers. Among the miRNA assays available, microarray and quantitative real-time polymerase chain reaction (qPCR) have been extensively used to detect and quantify miRNA levels. To identify miRNAs regulated by estrogen signaling in breast cancer, their expression in ERα-positive breast cancer cell lines were compared before and after estrogen-activation using both the µParaflo-microfluidic microarrays and Dual Labeled Probes-low density arrays. Results were validated using specific qPCR assays, applying both Cyanine dye-based and Dual Labeled Probes-based chemistry. Furthermore, a time-point assay was used to identify regulations over time. Advantages of the miRNA assay approach used in this study is that it enables a fast screening of mature miRNA regulations in numerous samples, even with limited sample amounts. The layout, including the specific conditions for cell culture and estrogen treatment, biological and technical replicates, and large-scale screening followed by in-depth confirmations using separate techniques, ensures a robust detection of miRNA regulations, and eliminates false positives and other artifacts. However, mutated or unknown miRNAs, or regulations at the primary and precursor transcript level, will not be detected. The method presented here represents a thorough investigation of estrogen-mediated miRNA regulation.
Medicine, Issue 84, breast cancer, microRNA, estrogen, estrogen receptor, microarray, qPCR
Play Button
Profiling Individual Human Embryonic Stem Cells by Quantitative RT-PCR
Authors: HoTae Lim, In Young Choi, Gabsang Lee.
Institutions: Johns Hopkins University School of Medicine.
Heterogeneity of stem cell population hampers detailed understanding of stem cell biology, such as their differentiation propensity toward different lineages. A single cell transcriptome assay can be a new approach for dissecting individual variation. We have developed the single cell qRT-PCR method, and confirmed that this method works well in several gene expression profiles. In single cell level, each human embryonic stem cell, sorted by OCT4::EGFP positive cells, has high expression in OCT4, but a different level of NANOG expression. Our single cell gene expression assay should be useful to interrogate population heterogeneities.
Molecular Biology, Issue 87, Single cell, heterogeneity, Amplification, qRT-PCR, Reverse transcriptase, human Embryonic Stem cell, FACS
Play Button
A Restriction Enzyme Based Cloning Method to Assess the In vitro Replication Capacity of HIV-1 Subtype C Gag-MJ4 Chimeric Viruses
Authors: Daniel T. Claiborne, Jessica L. Prince, Eric Hunter.
Institutions: Emory University, Emory University.
The protective effect of many HLA class I alleles on HIV-1 pathogenesis and disease progression is, in part, attributed to their ability to target conserved portions of the HIV-1 genome that escape with difficulty. Sequence changes attributed to cellular immune pressure arise across the genome during infection, and if found within conserved regions of the genome such as Gag, can affect the ability of the virus to replicate in vitro. Transmission of HLA-linked polymorphisms in Gag to HLA-mismatched recipients has been associated with reduced set point viral loads. We hypothesized this may be due to a reduced replication capacity of the virus. Here we present a novel method for assessing the in vitro replication of HIV-1 as influenced by the gag gene isolated from acute time points from subtype C infected Zambians. This method uses restriction enzyme based cloning to insert the gag gene into a common subtype C HIV-1 proviral backbone, MJ4. This makes it more appropriate to the study of subtype C sequences than previous recombination based methods that have assessed the in vitro replication of chronically derived gag-pro sequences. Nevertheless, the protocol could be readily modified for studies of viruses from other subtypes. Moreover, this protocol details a robust and reproducible method for assessing the replication capacity of the Gag-MJ4 chimeric viruses on a CEM-based T cell line. This method was utilized for the study of Gag-MJ4 chimeric viruses derived from 149 subtype C acutely infected Zambians, and has allowed for the identification of residues in Gag that affect replication. More importantly, the implementation of this technique has facilitated a deeper understanding of how viral replication defines parameters of early HIV-1 pathogenesis such as set point viral load and longitudinal CD4+ T cell decline.
Infectious Diseases, Issue 90, HIV-1, Gag, viral replication, replication capacity, viral fitness, MJ4, CEM, GXR25
Play Button
Detection of Alternative Splicing During Epithelial-Mesenchymal Transition
Authors: Huilin Huang, Yilin Xu, Chonghui Cheng.
Institutions: Northwestern University Feinberg School of Medicine.
Alternative splicing plays a critical role in the epithelial-mesenchymal transition (EMT), an essential cellular program that occurs in various physiological and pathological processes. Here we describe a strategy to detect alternative splicing during EMT using an inducible EMT model by expressing the transcription repressor Twist. EMT is monitored by changes in cell morphology, loss of E-cadherin localization at cell-cell junctions, and the switched expression of EMT markers, such as loss of epithelial markers E-cadherin and γ-catenin and gain of mesenchymal markers N-cadherin and vimentin. Using isoform-specific primer sets, the alternative splicing of interested mRNAs are analyzed by quantitative RT-PCR. The production of corresponding protein isoforms is validated by immunoblotting assays. The method of detecting splice isoforms described here is also suitable for the study of alternative splicing in other biological processes.
Cellular Biology, Issue 92, alternative splicing, EMT, RNA, primer design, real time PCR, splice isoforms
Play Button
Generation of Enterobacter sp. YSU Auxotrophs Using Transposon Mutagenesis
Authors: Jonathan James Caguiat.
Institutions: Youngstown State University.
Prototrophic bacteria grow on M-9 minimal salts medium supplemented with glucose (M-9 medium), which is used as a carbon and energy source. Auxotrophs can be generated using a transposome. The commercially available, Tn5-derived transposome used in this protocol consists of a linear segment of DNA containing an R6Kγ replication origin, a gene for kanamycin resistance and two mosaic sequence ends, which serve as transposase binding sites. The transposome, provided as a DNA/transposase protein complex, is introduced by electroporation into the prototrophic strain, Enterobacter sp. YSU, and randomly incorporates itself into this host’s genome. Transformants are replica plated onto Luria-Bertani agar plates containing kanamycin, (LB-kan) and onto M-9 medium agar plates containing kanamycin (M-9-kan). The transformants that grow on LB-kan plates but not on M-9-kan plates are considered to be auxotrophs. Purified genomic DNA from an auxotroph is partially digested, ligated and transformed into a pir+ Escherichia coli (E. coli) strain. The R6Kγ replication origin allows the plasmid to replicate in pir+ E. coli strains, and the kanamycin resistance marker allows for plasmid selection. Each transformant possesses a new plasmid containing the transposon flanked by the interrupted chromosomal region. Sanger sequencing and the Basic Local Alignment Search Tool (BLAST) suggest a putative identity of the interrupted gene. There are three advantages to using this transposome mutagenesis strategy. First, it does not rely on the expression of a transposase gene by the host. Second, the transposome is introduced into the target host by electroporation, rather than by conjugation or by transduction and therefore is more efficient. Third, the R6Kγ replication origin makes it easy to identify the mutated gene which is partially recovered in a recombinant plasmid. This technique can be used to investigate the genes involved in other characteristics of Enterobacter sp. YSU or of a wider variety of bacterial strains.
Microbiology, Issue 92, Auxotroph, transposome, transposon, mutagenesis, replica plating, glucose minimal medium, complex medium, Enterobacter
Play Button
RNA-Seq Analysis of Differential Gene Expression in Electroporated Chick Embryonic Spinal Cord
Authors: Felipe M. Vieceli, C.Y. Irene Yan.
Institutions: Universidade de São Paulo.
In ovo electroporation of the chick neural tube is a fast and inexpensive method for identification of gene function during neural development. Genome wide analysis of differentially expressed transcripts after such an experimental manipulation has the potential to uncover an almost complete picture of the downstream effects caused by the transfected construct. This work describes a simple method for comparing transcriptomes from samples of transfected embryonic spinal cords comprising all steps between electroporation and identification of differentially expressed transcripts. The first stage consists of guidelines for electroporation and instructions for dissection of transfected spinal cord halves from HH23 embryos in ribonuclease-free environment and extraction of high-quality RNA samples suitable for transcriptome sequencing. The next stage is that of bioinformatic analysis with general guidelines for filtering and comparison of RNA-Seq datasets in the Galaxy public server, which eliminates the need of a local computational structure for small to medium scale experiments. The representative results show that the dissection methods generate high quality RNA samples and that the transcriptomes obtained from two control samples are essentially the same, an important requirement for detection of differential expression genes in experimental samples. Furthermore, one example is provided where experimental overexpression of a DNA construct can be visually verified after comparison with control samples. The application of this method may be a powerful tool to facilitate new discoveries on the function of neural factors involved in spinal cord early development.
Developmental Biology, Issue 93, chicken embryo, in ovo electroporation, spinal cord, RNA-Seq, transcriptome profiling, Galaxy workflow
Play Button
Identification of Key Factors Regulating Self-renewal and Differentiation in EML Hematopoietic Precursor Cells by RNA-sequencing Analysis
Authors: Shan Zong, Shuyun Deng, Kenian Chen, Jia Qian Wu.
Institutions: The University of Texas Graduate School of Biomedical Sciences at Houston.
Hematopoietic stem cells (HSCs) are used clinically for transplantation treatment to rebuild a patient's hematopoietic system in many diseases such as leukemia and lymphoma. Elucidating the mechanisms controlling HSCs self-renewal and differentiation is important for application of HSCs for research and clinical uses. However, it is not possible to obtain large quantity of HSCs due to their inability to proliferate in vitro. To overcome this hurdle, we used a mouse bone marrow derived cell line, the EML (Erythroid, Myeloid, and Lymphocytic) cell line, as a model system for this study. RNA-sequencing (RNA-Seq) has been increasingly used to replace microarray for gene expression studies. We report here a detailed method of using RNA-Seq technology to investigate the potential key factors in regulation of EML cell self-renewal and differentiation. The protocol provided in this paper is divided into three parts. The first part explains how to culture EML cells and separate Lin-CD34+ and Lin-CD34- cells. The second part of the protocol offers detailed procedures for total RNA preparation and the subsequent library construction for high-throughput sequencing. The last part describes the method for RNA-Seq data analysis and explains how to use the data to identify differentially expressed transcription factors between Lin-CD34+ and Lin-CD34- cells. The most significantly differentially expressed transcription factors were identified to be the potential key regulators controlling EML cell self-renewal and differentiation. In the discussion section of this paper, we highlight the key steps for successful performance of this experiment. In summary, this paper offers a method of using RNA-Seq technology to identify potential regulators of self-renewal and differentiation in EML cells. The key factors identified are subjected to downstream functional analysis in vitro and in vivo.
Genetics, Issue 93, EML Cells, Self-renewal, Differentiation, Hematopoietic precursor cell, RNA-Sequencing, Data analysis
Play Button
Inhibitory Synapse Formation in a Co-culture Model Incorporating GABAergic Medium Spiny Neurons and HEK293 Cells Stably Expressing GABAA Receptors
Authors: Laura E. Brown, Celine Fuchs, Martin W. Nicholson, F. Anne Stephenson, Alex M. Thomson, Jasmina N. Jovanovic.
Institutions: University College London.
Inhibitory neurons act in the central nervous system to regulate the dynamics and spatio-temporal co-ordination of neuronal networks. GABA (γ-aminobutyric acid) is the predominant inhibitory neurotransmitter in the brain. It is released from the presynaptic terminals of inhibitory neurons within highly specialized intercellular junctions known as synapses, where it binds to GABAA receptors (GABAARs) present at the plasma membrane of the synapse-receiving, postsynaptic neurons. Activation of these GABA-gated ion channels leads to influx of chloride resulting in postsynaptic potential changes that decrease the probability that these neurons will generate action potentials. During development, diverse types of inhibitory neurons with distinct morphological, electrophysiological and neurochemical characteristics have the ability to recognize their target neurons and form synapses which incorporate specific GABAARs subtypes. This principle of selective innervation of neuronal targets raises the question as to how the appropriate synaptic partners identify each other. To elucidate the underlying molecular mechanisms, a novel in vitro co-culture model system was established, in which medium spiny GABAergic neurons, a highly homogenous population of neurons isolated from the embryonic striatum, were cultured with stably transfected HEK293 cell lines that express different GABAAR subtypes. Synapses form rapidly, efficiently and selectively in this system, and are easily accessible for quantification. Our results indicate that various GABAAR subtypes differ in their ability to promote synapse formation, suggesting that this reduced in vitro model system can be used to reproduce, at least in part, the in vivo conditions required for the recognition of the appropriate synaptic partners and formation of specific synapses. Here the protocols for culturing the medium spiny neurons and generating HEK293 cells lines expressing GABAARs are first described, followed by detailed instructions on how to combine these two cell types in co-culture and analyze the formation of synaptic contacts.
Neuroscience, Issue 93, Developmental neuroscience, synaptogenesis, synaptic inhibition, co-culture, stable cell lines, GABAergic, medium spiny neurons, HEK 293 cell line
Play Button
Monitoring Intraspecies Competition in a Bacterial Cell Population by Cocultivation of Fluorescently Labelled Strains
Authors: Lorena Stannek, Richard Egelkamp, Katrin Gunka, Fabian M. Commichau.
Institutions: Georg-August University.
Many microorganisms such as bacteria proliferate extremely fast and the populations may reach high cell densities. Small fractions of cells in a population always have accumulated mutations that are either detrimental or beneficial for the cell. If the fitness effect of a mutation provides the subpopulation with a strong selective growth advantage, the individuals of this subpopulation may rapidly outcompete and even completely eliminate their immediate fellows. Thus, small genetic changes and selection-driven accumulation of cells that have acquired beneficial mutations may lead to a complete shift of the genotype of a cell population. Here we present a procedure to monitor the rapid clonal expansion and elimination of beneficial and detrimental mutations, respectively, in a bacterial cell population over time by cocultivation of fluorescently labeled individuals of the Gram-positive model bacterium Bacillus subtilis. The method is easy to perform and very illustrative to display intraspecies competition among the individuals in a bacterial cell population.
Cellular Biology, Issue 83, Bacillus subtilis, evolution, adaptation, selective pressure, beneficial mutation, intraspecies competition, fluorophore-labelling, Fluorescence Microscopy
Play Button
A New Approach for the Comparative Analysis of Multiprotein Complexes Based on 15N Metabolic Labeling and Quantitative Mass Spectrometry
Authors: Kerstin Trompelt, Janina Steinbeck, Mia Terashima, Michael Hippler.
Institutions: University of Münster, Carnegie Institution for Science.
The introduced protocol provides a tool for the analysis of multiprotein complexes in the thylakoid membrane, by revealing insights into complex composition under different conditions. In this protocol the approach is demonstrated by comparing the composition of the protein complex responsible for cyclic electron flow (CEF) in Chlamydomonas reinhardtii, isolated from genetically different strains. The procedure comprises the isolation of thylakoid membranes, followed by their separation into multiprotein complexes by sucrose density gradient centrifugation, SDS-PAGE, immunodetection and comparative, quantitative mass spectrometry (MS) based on differential metabolic labeling (14N/15N) of the analyzed strains. Detergent solubilized thylakoid membranes are loaded on sucrose density gradients at equal chlorophyll concentration. After ultracentrifugation, the gradients are separated into fractions, which are analyzed by mass-spectrometry based on equal volume. This approach allows the investigation of the composition within the gradient fractions and moreover to analyze the migration behavior of different proteins, especially focusing on ANR1, CAS, and PGRL1. Furthermore, this method is demonstrated by confirming the results with immunoblotting and additionally by supporting the findings from previous studies (the identification and PSI-dependent migration of proteins that were previously described to be part of the CEF-supercomplex such as PGRL1, FNR, and cyt f). Notably, this approach is applicable to address a broad range of questions for which this protocol can be adopted and e.g. used for comparative analyses of multiprotein complex composition isolated from distinct environmental conditions.
Microbiology, Issue 85, Sucrose density gradients, Chlamydomonas, multiprotein complexes, 15N metabolic labeling, thylakoids
Play Button
Microarray-based Identification of Individual HERV Loci Expression: Application to Biomarker Discovery in Prostate Cancer
Authors: Philippe Pérot, Valérie Cheynet, Myriam Decaussin-Petrucci, Guy Oriol, Nathalie Mugnier, Claire Rodriguez-Lafrasse, Alain Ruffion, François Mallet.
Institutions: Joint Unit Hospices de Lyon-bioMérieux, BioMérieux, Hospices Civils de Lyon, Lyon 1 University, BioMérieux, Hospices Civils de Lyon, Hospices Civils de Lyon.
The prostate-specific antigen (PSA) is the main diagnostic biomarker for prostate cancer in clinical use, but it lacks specificity and sensitivity, particularly in low dosage values1​​. ‘How to use PSA' remains a current issue, either for diagnosis as a gray zone corresponding to a concentration in serum of 2.5-10 ng/ml which does not allow a clear differentiation to be made between cancer and noncancer2 or for patient follow-up as analysis of post-operative PSA kinetic parameters can pose considerable challenges for their practical application3,4. Alternatively, noncoding RNAs (ncRNAs) are emerging as key molecules in human cancer, with the potential to serve as novel markers of disease, e.g. PCA3 in prostate cancer5,6 and to reveal uncharacterized aspects of tumor biology. Moreover, data from the ENCODE project published in 2012 showed that different RNA types cover about 62% of the genome. It also appears that the amount of transcriptional regulatory motifs is at least 4.5x higher than the one corresponding to protein-coding exons. Thus, long terminal repeats (LTRs) of human endogenous retroviruses (HERVs) constitute a wide range of putative/candidate transcriptional regulatory sequences, as it is their primary function in infectious retroviruses. HERVs, which are spread throughout the human genome, originate from ancestral and independent infections within the germ line, followed by copy-paste propagation processes and leading to multicopy families occupying 8% of the human genome (note that exons span 2% of our genome). Some HERV loci still express proteins that have been associated with several pathologies including cancer7-10. We have designed a high-density microarray, in Affymetrix format, aiming to optimally characterize individual HERV loci expression, in order to better understand whether they can be active, if they drive ncRNA transcription or modulate coding gene expression. This tool has been applied in the prostate cancer field (Figure 1).
Medicine, Issue 81, Cancer Biology, Genetics, Molecular Biology, Prostate, Retroviridae, Biomarkers, Pharmacological, Tumor Markers, Biological, Prostatectomy, Microarray Analysis, Gene Expression, Diagnosis, Human Endogenous Retroviruses, HERV, microarray, Transcriptome, prostate cancer, Affymetrix
Play Button
Genomic MRI - a Public Resource for Studying Sequence Patterns within Genomic DNA
Authors: Ashwin Prakash, Jason Bechtel, Alexei Fedorov.
Institutions: University of Toledo Health Science Campus.
Non-coding genomic regions in complex eukaryotes, including intergenic areas, introns, and untranslated segments of exons, are profoundly non-random in their nucleotide composition and consist of a complex mosaic of sequence patterns. These patterns include so-called Mid-Range Inhomogeneity (MRI) regions -- sequences 30-10000 nucleotides in length that are enriched by a particular base or combination of bases (e.g. (G+T)-rich, purine-rich, etc.). MRI regions are associated with unusual (non-B-form) DNA structures that are often involved in regulation of gene expression, recombination, and other genetic processes (Fedorova & Fedorov 2010). The existence of a strong fixation bias within MRI regions against mutations that tend to reduce their sequence inhomogeneity additionally supports the functionality and importance of these genomic sequences (Prakash et al. 2009). Here we demonstrate a freely available Internet resource -- the Genomic MRI program package -- designed for computational analysis of genomic sequences in order to find and characterize various MRI patterns within them (Bechtel et al. 2008). This package also allows generation of randomized sequences with various properties and level of correspondence to the natural input DNA sequences. The main goal of this resource is to facilitate examination of vast regions of non-coding DNA that are still scarcely investigated and await thorough exploration and recognition.
Genetics, Issue 51, bioinformatics, computational biology, genomics, non-randomness, signals, gene regulation, DNA conformation
Play Button
Single Read and Paired End mRNA-Seq Illumina Libraries from 10 Nanograms Total RNA
Authors: Srikumar Sengupta, Jennifer M. Bolin, Victor Ruotti, Bao Kim Nguyen, James A. Thomson, Angela L. Elwell, Ron Stewart.
Institutions: Morgridge Institute for Research, University of Wisconsin, University of California.
Whole transcriptome sequencing by mRNA-Seq is now used extensively to perform global gene expression, mutation, allele-specific expression and other genome-wide analyses. mRNA-Seq even opens the gate for gene expression analysis of non-sequenced genomes. mRNA-Seq offers high sensitivity, a large dynamic range and allows measurement of transcript copy numbers in a sample. Illumina’s genome analyzer performs sequencing of a large number (> 107) of relatively short sequence reads (< 150 bp).The "paired end" approach, wherein a single long read is sequenced at both its ends, allows for tracking alternate splice junctions, insertions and deletions, and is useful for de novo transcriptome assembly. One of the major challenges faced by researchers is a limited amount of starting material. For example, in experiments where cells are harvested by laser micro-dissection, available starting total RNA may measure in nanograms. Preparation of mRNA-Seq libraries from such samples have been described1, 2 but involves significant PCR amplification that may introduce bias. Other RNA-Seq library construction procedures with minimal PCR amplification have been published3, 4 but require microgram amounts of starting total RNA. Here we describe a protocol for the Illumina Genome Analyzer II platform for mRNA-Seq sequencing for library preparation that avoids significant PCR amplification and requires only 10 nanograms of total RNA. While this protocol has been described previously and validated for single-end sequencing5, where it was shown to produce directional libraries without introducing significant amplification bias, here we validate it further for use as a paired end protocol. We selectively amplify polyadenylated messenger RNAs from starting total RNA using the T7 based Eberwine linear amplification method, coined "T7LA" (T7 linear amplification). The amplified poly-A mRNAs are fragmented, reverse transcribed and adapter ligated to produce the final sequencing library. For both single read and paired end runs, sequences are mapped to the human transcriptome6 and normalized so that data from multiple runs can be compared. We report the gene expression measurement in units of transcripts per million (TPM), which is a superior measure to RPKM when comparing samples7.
Molecular Biology, Issue 56, Genetics, mRNA-Seq, Illumina-Seq, gene expression profiling, high throughput sequencing
Play Button
Single-cell Profiling of Developing and Mature Retinal Neurons
Authors: Jillian J. Goetz, Jeffrey M. Trimarchi.
Institutions: Iowa State University.
Highly specialized, but exceedingly small populations of cells play important roles in many tissues. The identification of cell-type specific markers and gene expression programs for extremely rare cell subsets has been a challenge using standard whole-tissue approaches. Gene expression profiling of individual cells allows for unprecedented access to cell types that comprise only a small percentage of the total tissue1-7. In addition, this technique can be used to examine the gene expression programs that are transiently expressed in small numbers of cells during dynamic developmental transitions8. This issue of cellular diversity arises repeatedly in the central nervous system (CNS) where neuronal connections can occur between quite diverse cells9. The exact number of distinct cell types is not precisely known, but it has been estimated that there may be as many as 1000 different types in the cortex itself10. The function(s) of complex neural circuits may rely on some of the rare neuronal types and the genes they express. By identifying new markers and helping to molecularly classify different neurons, the single-cell approach is particularly useful in the analysis of cell types in the nervous system. It may also help to elucidate mechanisms of neural development by identifying differentially expressed genes and gene pathways during early stages of neuronal progenitor development. As a simple, easily accessed tissue with considerable neuronal diversity, the vertebrate retina is an excellent model system for studying the processes of cellular development, neuronal differentiation and neuronal diversification. However, as in other parts of the CNS, this cellular diversity can present a problem for determining the genetic pathways that drive retinal progenitors to adopt a specific cell fate, especially given that rod photoreceptors make up the majority of the total retinal cell population11. Here we report a method for the identification of the transcripts expressed in single retinal cells (Figure 1). The single-cell profiling technique allows for the assessment of the amount of heterogeneity present within different cellular populations of the retina2,4,5,12. In addition, this method has revealed a host of new candidate genes that may play role(s) in the cell fate decision-making processes that occur in subsets of retinal progenitor cells8. With some simple adjustments to the protocol, this technique can be utilized for many different tissues and cell types.
Neuroscience, Issue 62, Single-cells, transcriptomics, gene expression, cell-type markers, retina, neurons, genetics
Play Button
Establishment of Microbial Eukaryotic Enrichment Cultures from a Chemically Stratified Antarctic Lake and Assessment of Carbon Fixation Potential
Authors: Jenna M. Dolhi, Nicholas Ketchum, Rachael M. Morgan-Kiss.
Institutions: Miami University .
Lake Bonney is one of numerous permanently ice-covered lakes located in the McMurdo Dry Valleys, Antarctica. The perennial ice cover maintains a chemically stratified water column and unlike other inland bodies of water, largely prevents external input of carbon and nutrients from streams. Biota are exposed to numerous environmental stresses, including year-round severe nutrient deficiency, low temperatures, extreme shade, hypersalinity, and 24-hour darkness during the winter 1. These extreme environmental conditions limit the biota in Lake Bonney almost exclusively to microorganisms 2. Single-celled microbial eukaryotes (called "protists") are important players in global biogeochemical cycling 3 and play important ecological roles in the cycling of carbon in the dry valley lakes, occupying both primary and tertiary roles in the aquatic food web. In the dry valley aquatic food web, protists that fix inorganic carbon (autotrophy) are the major producers of organic carbon for organotrophic organisms 4, 2. Phagotrophic or heterotrophic protists capable of ingesting bacteria and smaller protists act as the top predators in the food web 5. Last, an unknown proportion of the protist population is capable of combined mixotrophic metabolism 6, 7. Mixotrophy in protists involves the ability to combine photosynthetic capability with phagotrophic ingestion of prey microorganisms. This form of mixotrophy differs from mixotrophic metabolism in bacterial species, which generally involves uptake dissolved carbon molecules. There are currently very few protist isolates from permanently ice-capped polar lakes, and studies of protist diversity and ecology in this extreme environment have been limited 8, 4, 9, 10, 5. A better understanding of protist metabolic versatility in the simple dry valley lake food web will aid in the development of models for the role of protists in the global carbon cycle. We employed an enrichment culture approach to isolate potentially phototrophic and mixotrophic protists from Lake Bonney. Sampling depths in the water column were chosen based on the location of primary production maxima and protist phylogenetic diversity 4, 11, as well as variability in major abiotic factors affecting protist trophic modes: shallow sampling depths are limited for major nutrients, while deeper sampling depths are limited by light availability. In addition, lake water samples were supplemented with multiple types of growth media to promote the growth of a variety of phototrophic organisms. RubisCO catalyzes the rate limiting step in the Calvin Benson Bassham (CBB) cycle, the major pathway by which autotrophic organisms fix inorganic carbon and provide organic carbon for higher trophic levels in aquatic and terrestrial food webs 12. In this study, we applied a radioisotope assay modified for filtered samples 13 to monitor maximum carboxylase activity as a proxy for carbon fixation potential and metabolic versatility in the Lake Bonney enrichment cultures.
Microbiology, Issue 62, Antarctic lake, McMurdo Dry Valleys, Enrichment cultivation, Microbial eukaryotes, RubisCO
Play Button
Mapping Bacterial Functional Networks and Pathways in Escherichia Coli using Synthetic Genetic Arrays
Authors: Alla Gagarinova, Mohan Babu, Jack Greenblatt, Andrew Emili.
Institutions: University of Toronto, University of Toronto, University of Regina.
Phenotypes are determined by a complex series of physical (e.g. protein-protein) and functional (e.g. gene-gene or genetic) interactions (GI)1. While physical interactions can indicate which bacterial proteins are associated as complexes, they do not necessarily reveal pathway-level functional relationships1. GI screens, in which the growth of double mutants bearing two deleted or inactivated genes is measured and compared to the corresponding single mutants, can illuminate epistatic dependencies between loci and hence provide a means to query and discover novel functional relationships2. Large-scale GI maps have been reported for eukaryotic organisms like yeast3-7, but GI information remains sparse for prokaryotes8, which hinders the functional annotation of bacterial genomes. To this end, we and others have developed high-throughput quantitative bacterial GI screening methods9, 10. Here, we present the key steps required to perform quantitative E. coli Synthetic Genetic Array (eSGA) screening procedure on a genome-scale9, using natural bacterial conjugation and homologous recombination to systemically generate and measure the fitness of large numbers of double mutants in a colony array format. Briefly, a robot is used to transfer, through conjugation, chloramphenicol (Cm) - marked mutant alleles from engineered Hfr (High frequency of recombination) 'donor strains' into an ordered array of kanamycin (Kan) - marked F- recipient strains. Typically, we use loss-of-function single mutants bearing non-essential gene deletions (e.g. the 'Keio' collection11) and essential gene hypomorphic mutations (i.e. alleles conferring reduced protein expression, stability, or activity9, 12, 13) to query the functional associations of non-essential and essential genes, respectively. After conjugation and ensuing genetic exchange mediated by homologous recombination, the resulting double mutants are selected on solid medium containing both antibiotics. After outgrowth, the plates are digitally imaged and colony sizes are quantitatively scored using an in-house automated image processing system14. GIs are revealed when the growth rate of a double mutant is either significantly better or worse than expected9. Aggravating (or negative) GIs often result between loss-of-function mutations in pairs of genes from compensatory pathways that impinge on the same essential process2. Here, the loss of a single gene is buffered, such that either single mutant is viable. However, the loss of both pathways is deleterious and results in synthetic lethality or sickness (i.e. slow growth). Conversely, alleviating (or positive) interactions can occur between genes in the same pathway or protein complex2 as the deletion of either gene alone is often sufficient to perturb the normal function of the pathway or complex such that additional perturbations do not reduce activity, and hence growth, further. Overall, systematically identifying and analyzing GI networks can provide unbiased, global maps of the functional relationships between large numbers of genes, from which pathway-level information missed by other approaches can be inferred9.
Genetics, Issue 69, Molecular Biology, Medicine, Biochemistry, Microbiology, Aggravating, alleviating, conjugation, double mutant, Escherichia coli, genetic interaction, Gram-negative bacteria, homologous recombination, network, synthetic lethality or sickness, suppression
Play Button
Small-scale Nuclear Extracts for Functional Assays of Gene-expression Machineries
Authors: Eric G. Folco, Haixin Lei, Jeanne L. Hsu, Robin Reed.
Institutions: Harvard Medical School.
A great deal of progress in understanding gene expression has been made using in vitro systems. For most studies, functional assays are carried out using extracts that are prepared in bulk from 10-50 or more liters of cells grown in suspension. However, these large-scale preparations are not amenable to rapidly testing in vitro effects that result from a variety of in vivo cellular treatments or conditions. This journal video article shows a method for preparing functional small-scale nuclear extracts, using HeLa cells as an example. This method is carried out using as few as three 150 mm plates of cells grown as adherent monolayers. To illustrate the efficiency of the small-scale extracts, we show that they are as active as bulk nuclear extracts for coupled RNA Polymerase II transcription/splicing reactions. To demonstrate the utility of the extract protocol, we show that splicing is abolished in extracts prepared from HeLa cells treated with the splicing inhibitor drug E7107. The small-scale protocol should be generally applicable to any process or cell type that can be investigated in vitro using cellular extracts. These include patient cells that are only available in limited quantities or cells exposed to numerous agents such as drugs, DNA damaging agents, RNAi, or transfection, which require the use of small cell populations. In addition, small amounts of freshly grown cells are convenient and/or required for some applications.
Cellular Biology, Issue 64, Genetics, HeLa nuclear extract, small-scale extract, pre-mRNA splicing, RNA polymerase II transcription, RNAi, coupled transcription/splicing, in vitro gene expression assays
Play Button
RNA-seq Analysis of Transcriptomes in Thrombin-treated and Control Human Pulmonary Microvascular Endothelial Cells
Authors: Dilyara Cheranova, Margaret Gibson, Suman Chaudhary, Li Qin Zhang, Daniel P. Heruth, Dmitry N. Grigoryev, Shui Qing Ye.
Institutions: Children's Mercy Hospital and Clinics, School of Medicine, University of Missouri-Kansas City.
The characterization of gene expression in cells via measurement of mRNA levels is a useful tool in determining how the transcriptional machinery of the cell is affected by external signals (e.g. drug treatment), or how cells differ between a healthy state and a diseased state. With the advent and continuous refinement of next-generation DNA sequencing technology, RNA-sequencing (RNA-seq) has become an increasingly popular method of transcriptome analysis to catalog all species of transcripts, to determine the transcriptional structure of all expressed genes and to quantify the changing expression levels of the total set of transcripts in a given cell, tissue or organism1,2 . RNA-seq is gradually replacing DNA microarrays as a preferred method for transcriptome analysis because it has the advantages of profiling a complete transcriptome, providing a digital type datum (copy number of any transcript) and not relying on any known genomic sequence3. Here, we present a complete and detailed protocol to apply RNA-seq to profile transcriptomes in human pulmonary microvascular endothelial cells with or without thrombin treatment. This protocol is based on our recent published study entitled "RNA-seq Reveals Novel Transcriptome of Genes and Their Isoforms in Human Pulmonary Microvascular Endothelial Cells Treated with Thrombin,"4 in which we successfully performed the first complete transcriptome analysis of human pulmonary microvascular endothelial cells treated with thrombin using RNA-seq. It yielded unprecedented resources for further experimentation to gain insights into molecular mechanisms underlying thrombin-mediated endothelial dysfunction in the pathogenesis of inflammatory conditions, cancer, diabetes, and coronary heart disease, and provides potential new leads for therapeutic targets to those diseases. The descriptive text of this protocol is divided into four parts. The first part describes the treatment of human pulmonary microvascular endothelial cells with thrombin and RNA isolation, quality analysis and quantification. The second part describes library construction and sequencing. The third part describes the data analysis. The fourth part describes an RT-PCR validation assay. Representative results of several key steps are displayed. Useful tips or precautions to boost success in key steps are provided in the Discussion section. Although this protocol uses human pulmonary microvascular endothelial cells treated with thrombin, it can be generalized to profile transcriptomes in both mammalian and non-mammalian cells and in tissues treated with different stimuli or inhibitors, or to compare transcriptomes in cells or tissues between a healthy state and a disease state.
Genetics, Issue 72, Molecular Biology, Immunology, Medicine, Genomics, Proteins, RNA-seq, Next Generation DNA Sequencing, Transcriptome, Transcription, Thrombin, Endothelial cells, high-throughput, DNA, genomic DNA, RT-PCR, PCR
Play Button
Metabolic Labeling of Newly Transcribed RNA for High Resolution Gene Expression Profiling of RNA Synthesis, Processing and Decay in Cell Culture
Authors: Bernd Rädle, Andrzej J. Rutkowski, Zsolt Ruzsics, Caroline C. Friedel, Ulrich H. Koszinowski, Lars Dölken.
Institutions: Max von Pettenkofer Institute, University of Cambridge, Ludwig-Maximilians-University Munich.
The development of whole-transcriptome microarrays and next-generation sequencing has revolutionized our understanding of the complexity of cellular gene expression. Along with a better understanding of the involved molecular mechanisms, precise measurements of the underlying kinetics have become increasingly important. Here, these powerful methodologies face major limitations due to intrinsic properties of the template samples they study, i.e. total cellular RNA. In many cases changes in total cellular RNA occur either too slowly or too quickly to represent the underlying molecular events and their kinetics with sufficient resolution. In addition, the contribution of alterations in RNA synthesis, processing, and decay are not readily differentiated. We recently developed high-resolution gene expression profiling to overcome these limitations. Our approach is based on metabolic labeling of newly transcribed RNA with 4-thiouridine (thus also referred to as 4sU-tagging) followed by rigorous purification of newly transcribed RNA using thiol-specific biotinylation and streptavidin-coated magnetic beads. It is applicable to a broad range of organisms including vertebrates, Drosophila, and yeast. We successfully applied 4sU-tagging to study real-time kinetics of transcription factor activities, provide precise measurements of RNA half-lives, and obtain novel insights into the kinetics of RNA processing. Finally, computational modeling can be employed to generate an integrated, comprehensive analysis of the underlying molecular mechanisms.
Genetics, Issue 78, Cellular Biology, Molecular Biology, Microbiology, Biochemistry, Eukaryota, Investigative Techniques, Biological Phenomena, Gene expression profiling, RNA synthesis, RNA processing, RNA decay, 4-thiouridine, 4sU-tagging, microarray analysis, RNA-seq, RNA, DNA, PCR, sequencing
Play Button
Genetic Manipulation in Δku80 Strains for Functional Genomic Analysis of Toxoplasma gondii
Authors: Leah M. Rommereim, Miryam A. Hortua Triana, Alejandra Falla, Kiah L. Sanders, Rebekah B. Guevara, David J. Bzik, Barbara A. Fox.
Institutions: The Geisel School of Medicine at Dartmouth.
Targeted genetic manipulation using homologous recombination is the method of choice for functional genomic analysis to obtain a detailed view of gene function and phenotype(s). The development of mutant strains with targeted gene deletions, targeted mutations, complemented gene function, and/or tagged genes provides powerful strategies to address gene function, particularly if these genetic manipulations can be efficiently targeted to the gene locus of interest using integration mediated by double cross over homologous recombination. Due to very high rates of nonhomologous recombination, functional genomic analysis of Toxoplasma gondii has been previously limited by the absence of efficient methods for targeting gene deletions and gene replacements to specific genetic loci. Recently, we abolished the major pathway of nonhomologous recombination in type I and type II strains of T. gondii by deleting the gene encoding the KU80 protein1,2. The Δku80 strains behave normally during tachyzoite (acute) and bradyzoite (chronic) stages in vitro and in vivo and exhibit essentially a 100% frequency of homologous recombination. The Δku80 strains make functional genomic studies feasible on the single gene as well as on the genome scale1-4. Here, we report methods for using type I and type II Δku80Δhxgprt strains to advance gene targeting approaches in T. gondii. We outline efficient methods for generating gene deletions, gene replacements, and tagged genes by targeted insertion or deletion of the hypoxanthine-xanthine-guanine phosphoribosyltransferase (HXGPRT) selectable marker. The described gene targeting protocol can be used in a variety of ways in Δku80 strains to advance functional analysis of the parasite genome and to develop single strains that carry multiple targeted genetic manipulations. The application of this genetic method and subsequent phenotypic assays will reveal fundamental and unique aspects of the biology of T. gondii and related significant human pathogens that cause malaria (Plasmodium sp.) and cryptosporidiosis (Cryptosporidium).
Infectious Diseases, Issue 77, Genetics, Microbiology, Infection, Medicine, Immunology, Molecular Biology, Cellular Biology, Biomedical Engineering, Bioengineering, Genomics, Parasitology, Pathology, Apicomplexa, Coccidia, Toxoplasma, Genetic Techniques, Gene Targeting, Eukaryota, Toxoplasma gondii, genetic manipulation, gene targeting, gene deletion, gene replacement, gene tagging, homologous recombination, DNA, sequencing
Play Button
Unraveling the Unseen Players in the Ocean - A Field Guide to Water Chemistry and Marine Microbiology
Authors: Andreas Florian Haas, Ben Knowles, Yan Wei Lim, Tracey McDole Somera, Linda Wegley Kelly, Mark Hatay, Forest Rohwer.
Institutions: San Diego State University, University of California San Diego.
Here we introduce a series of thoroughly tested and well standardized research protocols adapted for use in remote marine environments. The sampling protocols include the assessment of resources available to the microbial community (dissolved organic carbon, particulate organic matter, inorganic nutrients), and a comprehensive description of the viral and bacterial communities (via direct viral and microbial counts, enumeration of autofluorescent microbes, and construction of viral and microbial metagenomes). We use a combination of methods, which represent a dispersed field of scientific disciplines comprising already established protocols and some of the most recent techniques developed. Especially metagenomic sequencing techniques used for viral and bacterial community characterization, have been established only in recent years, and are thus still subjected to constant improvement. This has led to a variety of sampling and sample processing procedures currently in use. The set of methods presented here provides an up to date approach to collect and process environmental samples. Parameters addressed with these protocols yield the minimum on information essential to characterize and understand the underlying mechanisms of viral and microbial community dynamics. It gives easy to follow guidelines to conduct comprehensive surveys and discusses critical steps and potential caveats pertinent to each technique.
Environmental Sciences, Issue 93, dissolved organic carbon, particulate organic matter, nutrients, DAPI, SYBR, microbial metagenomics, viral metagenomics, marine environment
Play Button
Using SCOPE to Identify Potential Regulatory Motifs in Coregulated Genes
Authors: Viktor Martyanov, Robert H. Gross.
Institutions: Dartmouth College.
SCOPE is an ensemble motif finder that uses three component algorithms in parallel to identify potential regulatory motifs by over-representation and motif position preference1. Each component algorithm is optimized to find a different kind of motif. By taking the best of these three approaches, SCOPE performs better than any single algorithm, even in the presence of noisy data1. In this article, we utilize a web version of SCOPE2 to examine genes that are involved in telomere maintenance. SCOPE has been incorporated into at least two other motif finding programs3,4 and has been used in other studies5-8. The three algorithms that comprise SCOPE are BEAM9, which finds non-degenerate motifs (ACCGGT), PRISM10, which finds degenerate motifs (ASCGWT), and SPACER11, which finds longer bipartite motifs (ACCnnnnnnnnGGT). These three algorithms have been optimized to find their corresponding type of motif. Together, they allow SCOPE to perform extremely well. Once a gene set has been analyzed and candidate motifs identified, SCOPE can look for other genes that contain the motif which, when added to the original set, will improve the motif score. This can occur through over-representation or motif position preference. Working with partial gene sets that have biologically verified transcription factor binding sites, SCOPE was able to identify most of the rest of the genes also regulated by the given transcription factor. Output from SCOPE shows candidate motifs, their significance, and other information both as a table and as a graphical motif map. FAQs and video tutorials are available at the SCOPE web site which also includes a "Sample Search" button that allows the user to perform a trial run. Scope has a very friendly user interface that enables novice users to access the algorithm's full power without having to become an expert in the bioinformatics of motif finding. As input, SCOPE can take a list of genes, or FASTA sequences. These can be entered in browser text fields, or read from a file. The output from SCOPE contains a list of all identified motifs with their scores, number of occurrences, fraction of genes containing the motif, and the algorithm used to identify the motif. For each motif, result details include a consensus representation of the motif, a sequence logo, a position weight matrix, and a list of instances for every motif occurrence (with exact positions and "strand" indicated). Results are returned in a browser window and also optionally by email. Previous papers describe the SCOPE algorithms in detail1,2,9-11.
Genetics, Issue 51, gene regulation, computational biology, algorithm, promoter sequence motif
Play Button
A Strategy to Identify de Novo Mutations in Common Disorders such as Autism and Schizophrenia
Authors: Gauthier Julie, Fadi F. Hamdan, Guy A. Rouleau.
Institutions: Universite de Montreal, Universite de Montreal, Universite de Montreal.
There are several lines of evidence supporting the role of de novo mutations as a mechanism for common disorders, such as autism and schizophrenia. First, the de novo mutation rate in humans is relatively high, so new mutations are generated at a high frequency in the population. However, de novo mutations have not been reported in most common diseases. Mutations in genes leading to severe diseases where there is a strong negative selection against the phenotype, such as lethality in embryonic stages or reduced reproductive fitness, will not be transmitted to multiple family members, and therefore will not be detected by linkage gene mapping or association studies. The observation of very high concordance in monozygotic twins and very low concordance in dizygotic twins also strongly supports the hypothesis that a significant fraction of cases may result from new mutations. Such is the case for diseases such as autism and schizophrenia. Second, despite reduced reproductive fitness1 and extremely variable environmental factors, the incidence of some diseases is maintained worldwide at a relatively high and constant rate. This is the case for autism and schizophrenia, with an incidence of approximately 1% worldwide. Mutational load can be thought of as a balance between selection for or against a deleterious mutation and its production by de novo mutation. Lower rates of reproduction constitute a negative selection factor that should reduce the number of mutant alleles in the population, ultimately leading to decreased disease prevalence. These selective pressures tend to be of different intensity in different environments. Nonetheless, these severe mental disorders have been maintained at a constant relatively high prevalence in the worldwide population across a wide range of cultures and countries despite a strong negative selection against them2. This is not what one would predict in diseases with reduced reproductive fitness, unless there was a high new mutation rate. Finally, the effects of paternal age: there is a significantly increased risk of the disease with increasing paternal age, which could result from the age related increase in paternal de novo mutations. This is the case for autism and schizophrenia3. The male-to-female ratio of mutation rate is estimated at about 4–6:1, presumably due to a higher number of germ-cell divisions with age in males. Therefore, one would predict that de novo mutations would more frequently come from males, particularly older males4. A high rate of new mutations may in part explain why genetic studies have so far failed to identify many genes predisposing to complexes diseases genes, such as autism and schizophrenia, and why diseases have been identified for a mere 3% of genes in the human genome. Identification for de novo mutations as a cause of a disease requires a targeted molecular approach, which includes studying parents and affected subjects. The process for determining if the genetic basis of a disease may result in part from de novo mutations and the molecular approach to establish this link will be illustrated, using autism and schizophrenia as examples.
Medicine, Issue 52, de novo mutation, complex diseases, schizophrenia, autism, rare variations, DNA sequencing
Copyright © JoVE 2006-2015. All Rights Reserved.
Policies | License Agreement | ISSN 1940-087X
simple hit counter

What is Visualize?

JoVE Visualize is a tool created to match the last 5 years of PubMed publications to methods in JoVE's video library.

How does it work?

We use abstracts found on PubMed and match them to JoVE videos to create a list of 10 to 30 related methods videos.

Video X seems to be unrelated to Abstract Y...

In developing our video relationships, we compare around 5 million PubMed articles to our library of over 4,500 methods videos. In some cases the language used in the PubMed abstracts makes matching that content to a JoVE video difficult. In other cases, there happens not to be any content in our video library that is relevant to the topic of a given abstract. In these cases, our algorithms are trying their best to display videos with relevant content, which can sometimes result in matched videos with only a slight relation.