dissection-grading-ovarian-development-wild-type-female

Dissection and Grading of Ovarian Development in Wild-Type Female Insects

Migratory insect pests pose serious challenges to food production and security all over the world. The migratory pests can be monitored and captured using ...

Shandong Academy of Agricultural Sciences

In an effort to develop novel molecules with suitable insecticidal activities, 23,24-alkene-avermectin B2a derivatives have been synthesized  a one-pot multistep reaction using avermectin B2a, a byproduct of avermectin fermentation, as a starting material. All products and intermediates were characterized by H NMR, C NMR, and high-resolution mass spectrometry. Bioassay results showed that the LC values of compounds  and  against  were 0.63 and 0.50 mg/L, respectively, similar to that of avermectin (0.46 mg/L). Importantly, the LC values of compound  against  and  were 0.0067 and 0.047 mg/L, respectively, superior to that of avermectin. Through field experiments, it could be found that spraying 0.25% water-dispersible granules of compound  345 g ha could effectively control  outbreaks, with an efficacy of 84.9%. Combined with toxicity experiments, it could be further inferred that compound  may be useful as a low-toxicity pesticide. In summary, we efficiently synthesized a new B2a derivative as a potential pesticide and offered an important way for improving the utilization efficiency of avermectin fermentation products. In doing so, the environmental pollution associated with fermentation byproducts may be greatly reduced, potentially enabling a sustainable avermectin fermentation process.

High Value Utilization of an Avermectin Fermentation Byproduct: Novel B2a Derivatives as Pesticide Candidates.

'Baiwei' (swallowwort root,  Bunge), is a perennial cranberry type of Chinese medicinal herb, and grows in mountains with wide distribution in many provinces including Shandong, Henan, Hebei, Liaoning, Anhui and others. The functions of 'Baiwei' are strengthening myocardial contraction, detoxifying, and as a diuretic; thus it is one of very important herbs in China (Yunsi Su et al. 2021). With the increasing need for this herbal medicine in China, farmers are trying to cultivate the wild type of 'Baiwei'. In 2019, we found severe crop damage in a second-year planting of 'Baiwei' with many dead plants in a field (Fig. S1A, B) in Mengyin County of Shandong Province, China. Root galls were clearly seen in the roots and the typical root-knot nematode ( spp.) symptoms were observed (Fig. S1C). The previous crop was peanut. Peanut is widely planted in Shandong Province and peanut root-knot nematode () is one of its major root-knot nematode pests. We suspected that the damage was caused by peanut root-knot nematode. The roots were taken to the lab and kept at 10℃ for morphological and molecular identification of root-knot nematodes, and pathogenicity testing. Twenty females were picked up from the infected roots for perineal pattern observation. The perineal pattern had distinct characteristics such as a low dorsal arch and lateral field marked by forked and broken striae and without punctate markings between the anus and tail terminus (Fig. S2A), which is similar to the description of  (Eisenback et al., 1981). Eggs were extracted from roots and hatched to second-stage juveniles (J2s). The morphometric characters of J2s (n = 30) demonstrated body length = 437.35 ± SE 3.51 µm, body width = 16.74 ± 0.16 µm, stylet length = 11.31 ± 0.20 µm, DGO = 3.87 ± 0.07 µm, tail length = 53.32 ± 0.99 µm, and hyaline tail terminus = 11.14 ± 0.12 µm. The universal primer 194/195 (5.8S-18S rDNA TTAACTTGCCAGATCGGACG/TCTAATGAGCCGTACGC) for confirmation of Meloidogyne spp. was chosen and the sequence characterized amplified region (SCAR) PCR specific markers for  (Finc/Rinc GGGATGTGTAAATGCTCCTG/CCCGCTACACCCTCAACTTC),  (Fjav/Rjav ACGCTAGAATTCGACCCTGG/GGTACCAGAAGCAGCCATGC),  (Fent/Rent GAAATTGCTTTATTGTTACTAAG/TAGCCACAGCAAAATAGTTTTC),  (Fare/Rare TCGGCGATAGAGGTAAATGAC/TCGGCGATAGACACTACAACT),  (Fhap/Rhap TGACGGCGGTGAGTGCGA/TGACGGCGGTACCTCATAG) and  (Fchi/Rchi TGGAGAGCAGCAGGAGAAAGA/GGTCTGAGTGAGGACAAGAGTA) were utilized for species identification (Mao et al., 2019). PCR products of J2 amplification were run in the agar gel (Fig. S2B). A PCR product of 750 bp was obtained for 194/195 primer pair and a 420 bp band was identified for  for all tested J2 samples. There were no bands for other specific primers. The amplicons from 194/195 and  primer pairs were sequenced. A 100% identity of the Fare/Rare sequence (MZ522722.1) with  KP234264.1 and a 99.8% identity with  MW315990.1 were found through NCBI blast. A 100% identity of the 194/195 sequence (MZ555753.1) with both  GQ395518.1 and U42342.1 and  HF568829.1. To confirm the pathogenicity, 2000 J2s obtained from the same population as described above were used to inoculate each plant of one-month old 'Baiwei' seedlings (n = 5) and of one-month-old tomato cv. 'Zhongshu4' seedlings (n = 5) growing in 15-cm-diameter and 10-cm-height plastic pot containing sand and soil (2:1 ratio) in the glasshouse at 22-28℃ and 16/8 h day/night. Plants without J2s were used as control. Sixty days later, roots were stained with erioglaucine (Omwega et al. 1988) and an average of 107 ± SE 59 and 276 ± SE 31 egg masses per gram root were produced in each infected 'Baiwei' (Fig. S3A) and tomato (Fig. S3B) root, respectively. PCR amplification of the hatched J2s reconfirmed the reproduced nematode in 'Baiwei' and tomato was . This is the first report on  parasitizing the medicinal herb  in China.

First Report of  on  Bunge in China.

Spodoptera frugiperda is a major agricultural pest that has invaded China since January 2019. Given that most of the individuals present in China carried the diagnostic rice-strain mtDNA (COI-RS), there was no efficient method to distinguish populations of S. frugiperda. In this study, we identified and characterized two variant microsatellite alleles in the mitochondrial NAD6 gene of S. frugiperda retrieved from the National Center for Biotechnology Center GenBank. We then sequenced partial NAD6 genes containing the microsatellite region and the diagnostic COI barcoding gene (used to distinguish the corn-strain and the rice-strain) of 429 invasive S. frugiperda individuals that were collected from the main infested regions in China during 2019-2020. Our data indicates that two kinds of interrupted repeat sequences, (ATA)4T(ATA)3 and (ATA)5T(ATA)3, exist in the microsatellite region which we defined as the deletion type (NAD6-D), and the insertion type (NAD6-I) based on the repeat units' differentiation, respectively. The presence of these two microsatellite types in the mtDNA genome of S. frugiperda was further confirmed with the sequencing results in 429 samples. Moreover, NAD6-I and NAD6-D types were both present in individuals with COI-RS, while only NAD6-D type was detected in the COI-CS individuals. Interestingly, the two microsatellite types suggested a possible geographic distribution: the western migratory route (Yunan and Chongqing) was comprised exclusively of NAD6-I type, while both NAD6-I and NAD6-D types were identified in the predicted eastern migration trajectories (Hainan, Guangxi, Shandong, etc.). These results suggested that NAD6-D and NAD6-I types may be useful in distinguishing between populations, analyzing the evolutionary mechanism of mtDNA microsatellite polymorphism, inferring the migratory route of S. frugiperda in China, and developing precise and integrated control strategies for S. frugiperda.

Two Microsatellite Types Within NAD6 Gene Help to Distinguish Populations and Infer the Migratory Route of the Invasive Fall Armyworm, Spodoptera frugiperda, (Lepidoptera, Noctuidae) in China.

Article	Year
High Value Utilization of an Avermectin Fermentation Byproduct: Novel B2a Derivatives as Pesticide Candidates. Journal of agricultural and food chemistry\| PubMed ID: 35584200	2022
First Report of on Bunge in China. Plant disease\| PubMed ID: 35722916	2022
Two Microsatellite Types Within NAD6 Gene Help to Distinguish Populations and Infer the Migratory Route of the Invasive Fall Armyworm, Spodoptera frugiperda, (Lepidoptera, Noctuidae) in Chin... Journal of economic entomology\| PubMed ID: 35899806	2022

Wenxiu Guo

Biography

JoVE Journal Publications

Other Publications