Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Biology

العزلة والتلاعب الجيني لأمراض القلب للبالغين Myocytes التصوير متحد البؤر

doi: 10.3791/1433 Published: September 17, 2009

Summary

myocytes القلب للبالغين هي الخلايا الأولية التي يمكن أن تكون معزولة عن قلوب الحيوانات وتربيتها لعدة أيام. ويمكن خلال هذه الفترة يمكن استخدام الثقافة الفيروسة الغدانية نقل الجينات المشفرة للتعبير عن أجهزة الاستشعار وراثيا (GEBs) أو البروتينات الانصهار الفلورسنت. كلا النهجين تسمح التحقيقات الخلوية عن طريق الفحص المجهري متحد البؤر.

Abstract

مقبولة على نطاق واسع myocytes القلب المعزولة من قلوب الكبار كنموذج في مكان ما في منتصف الطريق بين الخلايا العضلية الجنينية والولدان على جانب واحد وقلب العمل من ناحية أخرى. وهكذا ، العضلية تكون بمثابة نماذج جيدة لفسيولوجيا القلب والفيزيولوجيا المرضية الخلوية ، لإجراء تحقيقات الصيدلانية وكذلك لاستكشاف النماذج الحيوانية المعدلة وراثيا. نحن هنا وصفا لطريقة عزل الخلايا من القلب. وعلاوة على ذلك أن نظهر كيف يمكن إجراء المعالجة الجينية على myocytes القلب دون تربية حيوان المعدلة وراثيا : هذا هو مزيج من الثقافة على المدى الطويل (1 أسبوع) والفيروسة الغدانية نقل الجينات. يتم وصف هذا الأخير واحد من بناء الفيروس إلى تنبيغ الخلايا. يمكن استخدامه للتعبير عن أجهزة الاستشعار المرمزة وراثيا (GEBs) ، والبروتينات الفلورية الانصهار ، ولكن أيضا للبروتين أكثر من التعبير والتنظيم لأسفل ، على سبيل المثال باستخدام رني. هنا نقدم مثالا للتعبير عن بروتين الانصهار تلطيخ بنية التحت خلوية (غولجي). يمكن لمثل بروتين تعبير يمكن تصور بواسطة التصوير مبائر من Z - كدسات لإعادة الإعمار 3D - الهياكل التحت خلوية. ويتضمن البروتوكول دولة من بين الفن في الثقافة الخلية والبيولوجيا الجزيئية والفيزياء الحيوية ، ويوفر بالتالي نهجا لاستكشاف آفاق جديدة في مجال أمراض القلب الخلوية.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

ويصور على كل تصميم محضرا يتضمن أربع خطوات رئيسية في الشكل 1. يتم وصف كل الخطوات بالتفصيل الكامل. عزل الخلايا ، تنبيغ والثقافة ، تليها التصوير مبائر حوالي 24 ساعة في وقت لاحق هو جدول زمني والإلزامي على التوالي. وينبغي أن يتم بناء الفيروس قبل عزل الخلايا ويستخدم ثم لتنبيغ الجينية.

1. عزلة myocytes القلب الكبار من قلب فأر

  1. الذكور البالغين فئران ويستار حوالي 250 غرام في الوزن (6-12 أسابيع من العمر) هي عن طريق الحقن داخل الصفاق anesthetised من 170 ميكرولتر حل التخدير في وزن 100 غ
  2. بالإضافة إلى ذلك ، يتم حقن محلول سترات (2 ميكرولتر / غرام من وزن الجسم) لتجنب تجلط الدم أثناء الجراحة.
  3. وينبغي إعداد Langendorff الإرواء تعيين الهاتفي. وينبغي أن تكون مشبعة كل الحلول مع الأكسجين.
  4. عند الفئران غير anesthetised ، يتم إصلاح هذا الحيوان على لوحة لعملية جراحية ، وتطهير الجزء العلوي من الجسم مع الايثانول 70 ٪.
  5. وقتل الحيوان من خلال قطع الشريان السباتي.
  6. يتم فتح الصدر باستخدام المقص. وينبغي على القلب والشريان الأورطي ويمكن الوصول. تتم إزالة بريكأرد.
  7. الجليد الباردة حل + (5 مل) يحقن في كلا البطينين باستخدام إبرة عيار 26 للقبض على القلب وتغسل الدم.
  8. وانتزع الأبهر مع المشبك واقتطاع في قوس الأبهر كانت مجرد المتفرعة الأول يحدث.
  9. تتم إزالة القلب من الصدر ، ويتم إرفاق الأبهر للقنية من نضح انشاء بواسطة ملقط والمشبك ألف إلى الوراء تسمح Langendorff - الارواء. أن تكون على علم بعدم foraminate صمامات الأبهر.
  10. قلب بحاجة إلى أن تكون ثابتة قبل ربطة حول الأبهر / قنية. سفن مفتوحة تحتاج أيضا إلى ligated.
  11. هو perfused retrogradely القلب مع الأكسجين محلول مشبع A + في درجة حرارة الغرفة (23 درجة مئوية) لمدة 10 دقيقة عند ضغط حوالي 70 ميليبار. تأكد من عدم دخول فقاعات الهواء الشريان الأورطي.
  12. تشغيل الحل نضح في التوصل إلى حل Liberase عند درجة حرارة 37 درجة مئوية لمدة 25 دقيقة تقريبا بمعدل 4 مل / دقيقة عن طريق مضخة تمعجية. في نهاية نضح ينبغي أن ننظر القلب رخامية بيضاء. ربما يكون الوقت الهضم تحتاج إلى أن تتكيف مع ظروف الحالة / الأنسجة.
  13. أخذ القلب من نضح انشاء وضعت في محلول يحتوي على طبق بيتري في درجة حرارة 37 درجة مئوية. يتم قطع السفن قبالة المتبقية والأذينين. يتم التخلص من السفن والأذين -- يعاملون بشكل مختلف (وليس جزءا من هذا البروتوكول) -- إذا لزم الأمر. وتنقسم البطينات إلى ما يقرب من 6 قطع.
  14. يتم نقل القطع في دورق مخروطي 100 مل تحتوي على 20 ألف حل مل عند درجة حرارة 37 درجة مئوية وتحريكها قليلا في حمام المياه 37 درجة مئوية لمدة 5 دقائق. أخيرا يتم تجاهل طاف.
  15. ويتكرر هذا الإجراء الموصوف أعلاه مرة أو مرتين. ينبغي أن طاف تظهر مبهمة بعض الشيء.
  16. وبدأت الزيادة في تركيز الكالسيوم خارج الخلية وذلك بإضافة 20 مل من محلول B 1 / 2 في 37 درجة مئوية إلى الخلايا والأنسجة المتبقية متبقية من التوصل إلى حل في دورق مخروطي. تهتز قليلا هذا في حمام مائي 37 ° C للحصول على 5 دقائق إضافية. بعد ذلك يتم تجاهل طاف.
  17. إضافة مزيد من حل 20 مل ب 1 / 2. (وينبغي أن طاف حل / تحتوي الآن خلايا قابلة للحياة.) يتم نقل قطرة من الخلايا لطبق بتري على مجهر مقلوب خلية ثقافة. إذا كانت الخلايا تظهر ارتفاع النشاط العفوي (تقلصات) يحتاج المرء الى الانتظار حتى تستقر الخلايا.
  18. مرة أخرى يتم تجاهل طاف ويتم إضافة 20 مل من محلول B 1 / 2.
  19. هو قطع رأس ماصة باستير البلاستيكية قبالة بطريقة القطع التي يمكن أن تمر بسهولة الأنسجة عند تحريكها من خلال فتح. مع العلاج لهب وخففت الحواف الحادة (ذاب).
  20. الآن قطعة نسيج قليلا ومسحوق بلطف. وينبغي قطع الأنسجة "ينهار" في الخلايا.
  21. ويصب في الخلية التي تحتوي طاف بي والمخففة مع الحل للوصول إلى كثافة الخلايا المطلوب ، والذي يعتمد على نوع من التجارب ، وينبغي أن تحدد تجريبيا.

2. تشييد اتش للانصهار بروتين تنبيغ

لإنتاج الفيروسات الغدية يستخدم تبديل - AD نظام ناقل من الفيروسة الغدانية Biomedicals النائب 1. هذا البروتوكول يبدأ مع دخول ناقلات المتاحة واختبار (pCR259) لبروتين فلوري أو الانصهار GEB 2 ثانية.

  1. يتم تحويل مبلغ 10 نانوغرام من ناقلات pCR259 الأولية المذكورة أعلاه تحتوي على الجينات في المصالح مع 100 ميكرولتر HighQ - 1 - AD تبديل ™ 294 الخلايا المختصة.
  2. وحضنت هذا الخليط لمدة 20 دقيقة على الجليد تليها صدمة الحرارة لمدة 45 ثانية في درجة حرارة 42 درجة مئوية وتخزينها على الجليد ل2 دقيقة إضافية.
  3. إضافة 900 و مو؛ لتر من غير انتقائية LB C - المتوسط ​​وتنمو بمعدل 37 درجة مع الإثارة لطيف لمدة 4 ساعات.
  4. لوحة 50 ميكرولتر ، 100 ميكرولتر وميكرولتر 200 على لوحات تحتوي على LB المتوسطة مع الكلورامفينيكول (سم ، 20 ميكروغرام / مل) ، أمبيسيلين (100 ميكروغرام / مل) ، التتراسيكلين (15 ميكروغرام / مل) ، X - غال (280 ميكروغرام / مل ) وIPTG (40 ميكروغرام / مل). (A تلطيخ أكثر كثافة والأزرق بشكل أسرع من الممكن باستخدام الصبغة أغلى Bluo غال مع 300μg/ml ، وينبغي استخدام هذا بصفة خاصة عندما كنت لم تكن مألوفة حتى في الاعتراف وتمييز أزرق / أبيض المستعمرات)
  5. تنمو لمدة 24 ساعة عند 37 درجة مئوية. إجازة في 4 درجات مئوية حتى تحديد جيد للمستعمرات الأزرق هو ممكن. عندما تكون هناك مشاكل لتقرر أي مستعمرة بيضاء حقا اختيار بعض من المستعمرات وتكرارها على آخر لوحة تحتوي على المضادات الحيوية الثلاثة ، X - غال وIPTG والسماح لهم تنمو في أكثر من ليلة 37 درجة مئوية.
    الملاحظة) وتبديل HighQ - 1 - AD 294 ™ الخلايا تحتوي على اثنين البلازميدات هامة : العمود الفقري واتش (تبديل ™ - AD 294) ومساعد البلازميد التي تعبر عن transposase الذي يتوسط غرز الجينات في المصالح في المواقع المستهدفة بها ، وتقع في جين LacZ من تبديل 294 - AD البلازميد.
  6. لتحديد المستعمرات الإيجابية التي تحتوي على الجين من الاهتمام في العمود الفقري فيروس أداء مستعمرة - PCR على النحو المبين في 2،7-2،9. الاشعال استخدام ناقلات تطوق موقع استنساخ متعددة (إلى الأمام 5 'CCCAGTCACGACGTTGTAAAACG 3' ، عكس 5 'GCGGATAACAATTTCACACAGG 3') ، وجعل PCR مستعمرة مع مستعمرات بيضاء 100 ٪ واستخدم أحد مستعمرة زرقاء كعنصر تحكم عن البلازميدات 294 - AD دون تبديل الجين إدراج من الفائدة. سوف تعطيك المستعمرات الزرقاء جزء PCR قصيرة (~ 200bp) ، التي تحتوي على الجين المستعمرات اهتمامك تظهر منتج PCR كبيرة (اعتمادا على طول الجين الخاص من الفائدة) والمستعمرات مع اثنين من الشظايا هي مستعمرات خلايا متعددة ويجب أن تكون مفصولة إذا استخدمت أخرى.
  7. وفقا للجدول أدناه مزيج الرئيسي يجب أن يكون مستعدا.
  8. اختيار مستعمرة واحدة بيضاء 100 ٪ مع المسواك وتعقيمها أولا إجراء نسخ من هذه المستعمرة على طبق - LB مع سم.
  9. نقل إلى مستعمرة PCR - المزيج. برم ذلك في مزيج PCR 3-4 مرات من إزالة مسواك قبل ان تتمكن من امتصاص الكثير من PCR - المزيج. وPCR - بروتوكول يعتمد على كيلو من إدراج وبوليميريز المستخدمة. درجة الحرارة الصلب من الاشعال هو 57 درجة مئوية ويوصى والاستخدام من 35 دورة.
  10. ينمو أكثر من الثقافات ليلة (LB المتوسطة مع سم) من الحيوانات المستنسخة الإيجابية وعزل البلازميدات مع حقيبة تجهيزات خاصة باحد المتاحة تجارية بدون أعمدة الدوران ، لأن قوة الطرد المركزي يعطل الفيروس ناقلات ضخمة.
  11. تحويل 0.5 ميكروغرام من البلازميدات معزولة في 100 ميكرولتر الخلايا المختصة DH5α. احتضان الحمض النووي للخلايا على الجليد لمدة 30 دقيقة. الصدمة الحرارية 45 ثانية في درجة حرارة 42 درجة مئوية وتعيين على الثلج لمدة 2 دقيقة.
  12. إضافة 900 ميكرولتر العشوائي LB المتوسطة وينمو بمعدل 37 درجة مئوية مع الإثارة لطيف لمدة 1 ساعة.
  13. لوحة 50 ميكرولتر على طبق يحتوي LB المتوسطة مع سم ، X غال وIPTG. احتضان عند 37 درجة مئوية لمدة 24 ساعة.
  14. انتقاء وتكرار ما يصل الى 20 ٪ 100 المستعمرات بيضاء على أمبيسيلين منفصلة ، التتراسيكلين والكلورامفينيكول لوحات تحتوي على IPTG والعاشر غال. تركها لتنمو في أكثر من ليلة 37 درجة مئوية. حدد المستعمرات التي هي 100 ٪ بيضاء ، ومقاومة الكلورامفينيكول ، وأمبيسلين tetracyclin الحساسة.
  15. مستعمرة - PCR (اختياري) : يمكن استنساخ اختبارها ايجابية مرة أخرى مع PCR - مستعمرة للتأكد من أنها تحتوي على إدراجه.
  16. اختيار مستعمرة واحدة من المؤتلف الإيجابية والنمو في 600 مل LB المتوسطة مع سم.
  17. عزل البلازميد باستخدام طقم ماكسي البلازميد.
  18. هضم 5 ميكروغرام من البلازميد مع أنني باك لمدة ساعتين عند 37 درجة مئوية ، ووقف رد الفعل عند 65 درجة مئوية لمدة 20 دقيقة.
  19. التركيز على هضم كامل في SpeedVac في درجة حرارة الغرفة لمدة 30 دقيقة لحجم النهائي من 10 ميكروليتر أو استخدام طريقة استخراج الفينول كلوروفورم.
  20. أذاب قارورة من الخلايا المجمدة 293 QBI كلوة الجنين البشري ، مع التحريض اللطيف في حمام ماء C ° 37. شطف خارج القنينة مع الايثانول 70 ٪ ، والشروع في جو معقم و مطهر غطاء العقيمة.
  21. نقل الخلايا إلى أنبوب معقم 15 مل ، 10 مل اضافة نقطه نقطه DMEM (+10 ٪ FCS) ، في حين تهييج لطيف وأجهزة الطرد المركزي في 10 دقيقة 250xg لخلايا بيليه.
  22. تجاهل طاف. Resuspend الكرية في DMEM مل 10 (+10 ٪ FCS) التي pipetting بلطف صعودا وهبوطا.
  23. البذور في قارورة 75 2 سم وإضافة 10 مل DMEM FCS مع 10 ٪ في الخلايا. احتضان أكثر من ليلة 37 درجة مئوية في حاضنة 5 ٪ CO 2.
  24. في اليوم التالي تحقق من كثافة الخلايا. وينبغي تقسيم QBI - 293 كلوة الجنين البشري في نسبة الخلايا 1:10 حتي 1:20.
  25. إزالة متوسطة من الخلايا ويعرض للتريبسين مع التربسين مل 2 للدقيقة 1-3. إعطاء 10 مل DMEM للخلايا وأجهزة الطرد المركزي في 250xg لمدة 10 دقيقة.
  26. إزالة بعناية والمتوسطة ومنح 10 مل متوسطة جديدة للخلايا ، وresuspend عدد الخلايا.
  27. في لوحة واحدة لمدة ستة جيدا جيدا مع 2x10 5 ، 5 3x10 5 ، 5 و 5x10 6x10 5 خلايا. احتضان طبق في 37 في CO 2 - حاضنة درجة مئوية.
  28. في اليوم التالي بشكل جيد مع استخدام 50 ٪ لالتقاء transfect مع هضم تتركز أنا باك. نحن لدينا تجربة جيدة مع ترنسفكأيشن Lipofectamine 2000 ، ولكن أيضا وسائل أخرى (مثل ترنسفكأيشن فوسفات الكالسيوم) ينبغي أن تكون مناسبة.
  29. تغيير المتوسطة في ح 3-4 جيدا قبل ترنسفكأيشن للحصول على الخلايا في النمو الهائل أثناء العملية.
  30. مزيج 5 Lipofectamine ميكرولتر مع 250 ميكرولتر DMEM ويحضن في درجة حرارة الغرفة لمدة 5 دقائق.
  31. تعطي خليط Lipofectamine المتوسطة على الحمض النووي (باك أنا هضم) ، ومزيج من خلال استغلال الانبوب ضد رد الفعل ، لا عن طريق خلط pipetting. احتضان الخليط 20 دقيقة في درجة حرارة الغرفة.
  32. انخفاض مزيج ترنسفكأيشن إلى الخلايا والصخور لوحة لالمزيج. احتضان عند 37 درجة مئوية مع نسبة 5 ٪ CO 2. تغيير متوسطة بعد 4-5 ساعات.
  33. بعد يومين من اتخاذ ترنسفكأيشن المتوسطة من الخلايا واعطائها الى قارورة الثقافة الطازجة (75 سم 2).
  34. يعرض للتريبسين الخلايا مع 500 ميكرولتر التربسين لمدة تصل إلى 5 دقائق. اعطاء 1 مل DMEM إلى الخلايا ، واتخاذ الخليط كله ووضعه ، جنبا إلى جنب مع 17 مل المتوسطة الطازجة (DMEM مع FCS) في قارورة الثقافة. زراعة الخلايا عند 37 درجة مئوية مع CO 2 حتى 5 ٪ آثار الاعتلال الخلوي (CPE) مرئية. انظر الشكل 2 لمعرفة كيفية CPE يجب أن تبدو.
  35. جمع الخلايا مع المتوسط ​​في أنبوب 50 مل وتجميد الخلايا في -80 درجة مئوية. كسر الخلايا مع دورات تجميد / الذوبان الثلاث (-80 درجة مئوية C/37 المياه حمام).
  36. أجهزة الطرد المركزي في 20 دقيقة و8000xg 4 درجات مئوية. صب وطاف في صحن قطره 100mm وتجاهل بيليه. استخدام مرشح العقيمة مع حجم المسام 0.45μm لرشاحة وطاف. وهذا هو أول فيروس الأسهم (ممر 1).
  37. استخدام 1 / 3 من هذا المخزون لتنبيغ a 75cm 2 قارورة مع الخلايا QBI - 293 كلوة الجنين البشري التقاء مع 70 ٪. احتضان عند 37 درجة مئوية و 5 ٪ CO 2 حتى CPE ق مرئية.
  38. إذا كانت الخلايا تظهر CPE ق جمعها واستخراج الفيروسات كما فعلت من قبل. هذا هو الممر 2 من الفيروس.
  39. وكرر الخطوات من 2،37 2،38 مع مرور الفيروس (2) وهلم جرا ، حتى التضخيم من الفيروسات الفيروس يصل مخزون كاف. ويمكن أن يتركز الفيروس مع أنابيب الطرد المركزي محددة (الترا Amicon - 15 وحدة تصفية الطرد المركزي مع ultracel 100 من الغشاء ميليبور) وتخزينها لعدة شهور في -80 درجة مئوية. لحساب الجسيمات المعدية استخدام فحص اللوحة.
  40. استخدام مرور الفيروس 2 أو أعلى لتنبيغ الخلايا والتضخيم لمزيد من الفيروس.

3. زراعة الخلايا الأولية وتنبيغ الفيروسة الغدانية

  1. توضع العقيمة زلات تغطية الجولة بقطر 20 ملم في لوحات 12 - جيدا القياسية.
  2. وتوزع بالتساوي حل ECM 20 ميكرولتر على كل زلة غطاء. يتم تجاهل ما زالت قائمة. لتجفيف تسمح بحد أدنى من 1 في 37 ساعة درجة مئوية بدلا من الطلاء المجفف التي يمكن أن أكثر من ليلة (12 ساعة) في درجة حرارة الغرفة.
  3. يتم تعبئة كل جيدا مع 1 مل متوسطة M199 مع ملاحق تشمل المضادات الحيوية وITS.
  4. يضاف تعليق خلية (من الخطوة 1.21) من 200-400 ميكرولتر إلى كل بئر. زراعة الخلايا يحدث عند 37 درجة مئوية في حاضنة 5 ٪ CO 2.
  5. ويسمح لخلايا الرواسب وبعد 1 تغير ح المتوسط.
  6. مباشرة بعد تغيير متوسطة مختلطة كمية كافية من محلول يحتوي على فيروس (من المقطع 2 أو أعلى) التي تعصف بلطف لوحة.
  7. في حالة متوسطة الأجل الطويل هو تغيير ثقافة كل أيام 2.
  8. بعد 24 ساعة من التعبير GEB ترنسفكأيشن قابلا للاكتشاف.

4. التصوير مبائر للهياكل 3D التحت خلوية وكا 2 + اشارة

لا يمكن أن يؤديها في أي مبائر التصوير مبائر المجهر. ومع ذلك ، الكالسيوم التصوير التجارب تتطلب سرعة الحصول على معدل لا يقل عن الفيديو (25-30 هرتز). هذه التقنيات يمكن استخدامها لتقييد إما الماسحات شعاع متعددة (على سبيل المثال Nipkow القرص ، اجتاحت الحقل أو كيلو الشعاع الماسح الصفيف) أو الماسح الضوئي بسرعة كبيرة شعاع واحد (مثل الماسح الضوئي أو صوتية مدوية البصرية منحرف (AOD) ، الماسح الضوئي). لمحة عامة انظر المرجع. 3. التصوير التحت خلوية 3D - Z - يتطلب محرك الأقراص. هنا يتم استخدام الماسح الضوئي صفيف كيلو شعاع (VTinfinity ، VisiTech كثافة العمليات. ، سندرلاند ، المملكة المتحدة).

  1. المجهر والمعدات الطرفية يجب أن يكون تعيين إلى وضع التشغيل. خاصة بالنسبة لليزر وهذا قد يتطلب فترة الاحماء حتى يتم التوصل الى انتاج الطاقة مستقرة.
  2. الخلايا تحتاج إلى نقلها إلى غرفة التجريبية (تغطية الانزلاق نقل). يتم نقل coverslips مع الخلايا إلى الغرفة التجريبية. ثم يتم إضافة 1mL Tyrode الحل (خارج الخلية التي تحتوي على الكالسيوم 1،8 مم).
  3. الغرفة التجريبية يحتاج إلى أن يوضع على المسرح المجهر. أقطاب التحفيز ، نضح وانشاء مزيد من peripheراؤول الأجهزة ، مثل التحكم في درجة الحرارة ، والحاجة ليتم ترتيبها وفقا لذلك.
  4. وسوف يتركز في الخلايا والتي اخترتها باستخدام الضوء الأبيض و / أو الإضاءة epifluorescent.
  5. المعلمات اقتناء مثل طاقة الليزر ، والتعرض الخ الوقت أو بروتوكول التجربة بأكملها يحتاج إلى الإعداد.
  6. يمكن الحصول على سلسلة زمنية و / أو Z - قسم الصور.
  7. يمكن على القياسات المتعدد انشاء المزيد من التقدم أن يتم ذلك باستخدام الكهربية (التصحيح ، المشبك) و / أو التلاعب البصرية مثل إعادة توزيع مضان بعد photobleach (FRAP) أو من المواد بما في ذلك uncaging التحلل الضوئي الفوتون اثنين.
  8. تحليل الصور ، وبخاصة يتم تنفيذ 3D - التعمير على برامج مخصصة لمثل تحليل Imaris (Bitplane AG ، زيوريخ ، سويسرا) ، والسرعة (الارتجال ، كوفنتري ، المملكة المتحدة) أو Arivis المستعرض (arivis محدودة ، روستوك ، ألمانيا).

5. ممثل النتائج :

النتائج النهائية للبروتوكول وتسلسل الصور التي يمكن استخدامها لاستخراج المزيد من البيانات.

مثال على ذلك هو التحقيق في هياكل العضيات التحت خلوية و. الشكل 3 يصور مثال على الترتيب 3 الأبعاد لجهاز جولجي. يمكن في المقابل أن المجهر الإلكتروني يتم تنفيذ جميع التحقيقات على الخلايا الحية.

الشكل 1
الشكل 1 : تدفق العامة لاتخاذ الخطوات التجريبية الرئيسية.

الشكل 2
الشكل 2 : صورة اليسار يصور الخلايا Q - كلوة الجنين البشري في الثقافة مع confluency 90-95 ٪ والتي لا transduced. وتظهر آثار Cytopatic بعد تنبيغ الفيروسية في الجزء الأيمن. محاصرة الخلايا وفصل من الجزء السفلي من اللوحة. في هذه الخلايا نواة تحتل جزءا كبيرا من الخلايا نتيجة لإنتاج فيروس نشط.

الشكل 3
الشكل 3 : الكبار العضلية القلبية الفئران transfected مع البروتين YFP الانصهار استهداف جهاز جولجي. myocytes القلب بعد نقل الجينات الفيروسة الغدانية (يوم واحد في الثقافة) تعبر عن انصهار بروتين فلوري. ويصور لوحة شريحة واحدة مأخوذة من مبائر ض المكدس. B في لوحة يصور نفس الخلية بعد انتشار استخدام deconvolution الناحية النظرية وظيفة (PSF). وتستخدم في وقت لاحق هذا المكدس الصورة دي واضحة لجعل الخلية والحصول على حجم اعادة الاعمار 3D كما هو موضح في C أو لوحة للتعمير سطح 3D (D). شريط يمثل 10 ميكرومتر.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

ويمكن تكييف الإجراء الموضح لعزل الخلايا العضلية الفئران على الأنواع الأخرى ، مثل الماوس 4 ، إذا لزم الأمر. معلمة احتياجات التكيف التي هي مزيج انزيم لهضم (أنظر أدناه) ، وكذلك مدة الهضم. أن ندرك أن بعض أنواع خلايا (مثل الماوس) قد يكون أكثر هشاشة من غيرها (مثل الفئران).

اختيار كولاجيناز هو على الأرجح أهم خطوة حاسمة في إجراء العزل. نختار Blendzyme Liberase لأنها مزيج مع وجود اختلافات تركيبية الأنزيمية تقريبا دفعة إلى دفعة لا. الأسلوب التقليدي هو استخدام ما يسمى كولاجيناز الخام المستخرج من نسج كلوستريديوم ، الذي هو أيضا وسيلة صالحة. ومع ذلك ، دفعة إلى دفعة جديدة الاختلافات تتطلب الأمثل لكل دفعة جديدة.

يمكن بصرف النظر عن البروتينات الفلورية والانصهار تنبيغ GEB أيضا نقل الجينات الفيروسة الغدانية أن تستخدم للتعبير عن أكثر من البروتينات وظيفية أو تنظيمها باستمرار (على سبيل المثال بواسطة رني 5). هذا صحيح لأن التنبيغ كفاءة عالية (> 95 ٪) ، واستنساخه.

Subscription Required. Please recommend JoVE to your librarian.

Acknowledgments

وأيد هذا العمل من قبل مؤسسة العلوم الوطنية الألمانية (DFG) والمعهد الاتحادي لتقييم المخاطر (BFR ، ألمانيا).

Materials

Name Company Catalog Number Comments
Anesthesia solution Serumwerk Bernburg GmbH (Ursotamin), Bayer Health Care (Rompun) Mixture of 1 ml Ursotamin (100 mg/ml Ketaminhydrochlorid) and 240 μl Rompun (2% Xylazinhydrochlorid)
Citrate solution 117,64 mg sodium citrate in 10 ml 0.9% NaCl solution
Solution A 134 mM NaCl, 4 mM KCl, 11 mM glucose, 1.2 mM MgSO4, 1.2 mM Na2HPO4, 10 mM HEPES, pH adjusted to 7.35 using 10 M NaOH, sterile filtered
Solution A+ Content of solution A plus 0.2 mM EGTA, pH adjusted to 7.35 using 10 M NaOH, sterile filtered
Liberase solution F. Hoffmann‐ La Roche Ltd. 11988476 001 500 μl stock solution in 15 ml solution A (stock solution:10 mg/ml Liberase Blendzyme 4 in aqua dest.)
Solution B Content of solution A plus 200 μM CaCl2 and 0.1% DNase solution
Solution B1/2 1:1 mixture of solution A and solution B
DNase solution Sigma-Aldrich D4527 Deoxyribonuclease I, Type 2 from bovine pancreas, 40 KU (15 mg) are dissolved in 5 ml of 10 mM Tris‐HCl buffer, adjusted to pH=7.35, additional content: 50 mM NaCl, 10 mM MgCl2, 1 mM dithi–rythritol; this solution is mixed with 5 ml glycerol
Extracellular matrix protein (ECM) solution Extracellular matrix protein (ECM) solution E1270 1 ml stock solution as purchased is diluted with 6 mLmedium M199
Culture medium M199 PAA Laboratories E15‐834 Medium M199 supplemented with 1 μl/ml ITS solution and 20 μl/ml penicillin‐streptomycin solution (5000 units/ml)
ITS solution 25 mg Insulin, 25 mg Transferrin and 50 μl Selenite stock solution are dissolved in 5 ml aqua dest. (stock solution: 0.5 mg/ml Sodiumselenite in aqua dest.). Add a few drops of 1 M HCl until one should get a clearsolution. Aliquots can be frozen.
Tyrode 135 mM NaCl, 5.4 mM KCl, 1.8 mM CaCl2, 2mM MgCl2, 10 mM glucose, 10 mM HEPES, pH adjusted to 7.35 using 10 M NaOH, sterile filtered
Master mix 5 μl 10×PCR‐Buffer, 5 μl MgCl2 (25 mM), 2 μl forward primer, 2 μl reverse primer, 1 μl dNTP´s (10 mM each), 33 μl H2O, 1 μl DMSO, 1 μl Taq‐DNA polymerase for each sample
LB‐Medium 10 g/l Tryptone, 5 g/l Yeast extract, 5 g/l NaCl (and 15 g/l Agar if used as solid medium), pH 7.0
Pac I New England Biolabs R0547L preparation: 50 μg DNA, 5 μl 10×buffer, 0.5 μl 100×BSA,0.75 μl Pac I, fill with H2O up to final volume of 50μl

DOWNLOAD MATERIALS LIST

References

  1. Kaestner, L., Ruppenthal, S., S, Molecular Imaging II. Licha, K., Lin, C. P. Vol. 7370, SPIE. Bellingham. 737008-737008 (2009).
  2. Viero, C., Kraushaar, U., Ruppenthal, S. In vivo imaging of Drosophila melanogaster pupae with mesoscopic fluorescence tomography. Cell Calcium. 43, (1), 59-59 (2008).
  3. Shorte, S. L., Frischknecht, F. Imaging Cellular and Molecular Biological Functions. Springer. Berlin Heidelberg. 289-289 (2007).
  4. Kaestner, L., Lipp, P. Optics in Life Science. Popp, J., von Bally, G. Vol. 6633, SPIE. Munich. 66330K-66330K (2007).
  5. Rinne, A., Littwitz, C., Bender, K. Adenovirus-mediated delivery of short hairpin RNA (shRNA) mediates efficient gene silencing in terminally differentiated cardiac myocytes. Methods Mol Biol. 515, 107-107 (2009).
العزلة والتلاعب الجيني لأمراض القلب للبالغين Myocytes التصوير متحد البؤر
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Kaestner, L., Scholz, A., Hammer, K., Vecerdea, A., Ruppenthal, S., Lipp, P. Isolation and Genetic Manipulation of Adult Cardiac Myocytes for Confocal Imaging. J. Vis. Exp. (31), e1433, doi:10.3791/1433 (2009).More

Kaestner, L., Scholz, A., Hammer, K., Vecerdea, A., Ruppenthal, S., Lipp, P. Isolation and Genetic Manipulation of Adult Cardiac Myocytes for Confocal Imaging. J. Vis. Exp. (31), e1433, doi:10.3791/1433 (2009).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter