Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Biology

Isolatie en genetische manipulatie van Adult hartspiercellen voor confocale Imaging

doi: 10.3791/1433 Published: September 17, 2009

Summary

Volwassen hartspiercellen zijn primaire cellen die kunnen worden geïsoleerd uit dierlijke harten en gekweekt voor meerdere dagen. Binnen deze cultuur periode adenovirale gentransfer kan gebruikt worden om genetisch gecodeerd biosensoren (GEBS) of TL-fusie-eiwitten uit te drukken. Beide benaderingen laten cellulaire onderzoeken door middel van confocale microscopie.

Abstract

Cardiale myocyten geïsoleerd uit volwassen hart is algemeen aanvaard als een model ergens halverwege tussen embryonale en neonatale spiercellen aan de ene kant en een werkend hart op de andere. Dus, cardiomyocyten dienen als goede modellen voor cardiale cellulaire fysiologie en pathofysiologie, voor farmaceutische onderzoek en voor de exploratie van transgene diermodellen. Hier beschrijven we een methode voor het isoleren van de cellen van het hart. Verder hebben we laten zien hoe een genetische manipulatie op de cardiale myocyten kan worden uitgevoerd zonder dat het fokken van een transgeen dier: Dit is de combinatie van lange termijn cultuur (1 week) en adenovirale gentransfer. Dit laatste is beschreven van de bouw van het virus naar de transductie van de cellen. Het kan worden gebruikt voor de expressie van genetisch gecodeerde biosensoren (GEBS), TL-fusie-eiwitten, maar ook voor eiwit overexpressie en neer regelgeving, bijvoorbeeld met behulp van RNAi. Hier hebben we een voorbeeld voor de expressie van een fusie-eiwit vlekken een subcellulaire structuur (Golgi). Dergelijk eiwit expressie kan gevisualiseerd worden door confocale beeldvorming van z-stacks voor een 3D-reconstructie van subcellulaire structuren. Het protocol bestaat uit state-of-the-art in celkweek, moleculaire biologie en biofysica en dus biedt een aanpak voor het verkennen van nieuwe horizonten in de cellulaire cardiologie.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Het over alle ontwerp van het protocol met de vier grote stappen is afgebeeld in figuur 1. Alle stappen zijn beschreven in vol detail. Celisolatie, transductie en cultuur, gevolgd door confocale beelden ongeveer 24 uur later is een aaneengesloten en verplichte tijdpad. Het virus bouw moet vóór het celisolatie worden gedaan en wordt vervolgens gebruikt voor de genetische transductie.

1. Isolatie van volwassen hartspiercellen van ratten hart

  1. Volwassen mannelijke Wistar ratten ongeveer 250 gram in gewicht (6-12 weken oud) worden onder narcose door intraperitoneale injectie van 170 ul anesthesie oplossing per 100 g lichaamsgewicht
  2. Daarnaast wordt een citraatoplossing (2 pl / g lichaamsgewicht) geïnjecteerd om bloedstolling te voorkomen tijdens de operatie.
  3. Langendorff Perfusie Set-Up moet worden voorbereid. Alle oplossingen dienen te worden verzadigd met zuurstof.
  4. Als de rat onder narcose is, is het dier bevestigd op een operatie boord en het bovenste deel van het lichaam is gedesinfecteerd met 70% ethanol.
  5. Het dier wordt gedood door dwars door de halsslagader.
  6. De thorax wordt geopend met een schaar. Het hart en de aorta moet nu toegankelijk zijn. Het pericard wordt verwijderd.
  7. Ijskoude oplossing A + (5 ml) geïnjecteerd in beide hartkamers met behulp van een 26-gauge naald naar het hart arrestatie en uitspoelen bloed.
  8. De aorta is gegrepen met een klem en afgebroken bij de aortaboog waren gewoon de eerste vertakking optreedt.
  9. Het hart is verwijderd uit de borst en de aorta is bevestigd aan de canule van een perfusie set-up door de pincet en een klem voor retrograde Langendorff-perfusie mogelijk te maken. Wees je bewust niet aan de aorta kleppen foraminate.
  10. Het hart moet worden vastgesteld door een ligatuur rond de aorta / canule. Open schepen moeten ook worden geligeerd.
  11. Het hart is retrogradely geperfuseerd met zuurstof verzadigde oplossing A + bij kamertemperatuur (23 ° C) gedurende 10 min bij een druk van ongeveer 70 mbar. Zorg dat er geen luchtbellen in te voeren van de aorta.
  12. De perfusie-oplossing is overgeschakeld naar een Liberase oplossing bij een temperatuur van 37 ° C gedurende ongeveer 25 minuten met een snelheid van 4 ml / min door middel van een peristaltische pomp. Aan het eind van de perfusie het hart moeten kijken gemarmerd wit. De spijsvertering tijd moet mogelijk worden aangepast aan de situatie / weefsel conditie.
  13. Het hart is genomen uit de perfusie set-up en in een petrischaal met oplossing A bij een temperatuur van 37 ° C. De resterende schepen en atria worden afgesneden. De schepen worden verwijderd en de atria - indien nodig - verschillend worden behandeld (geen deel uit van dit protocol). De ventrikels zijn verdeeld in ongeveer 6 stukken.
  14. De stukken worden overgebracht in een 100 ml erlenmeyer met 20 ml oplossing A bij een temperatuur van 37 ° C en licht geagiteerd in een 37 ° C waterbad gedurende 5 minuten. Tenslotte wordt de supernatant wordt verwijderd.
  15. De hierboven beschreven procedure is een of twee keer herhaald. Het supernatant zou moeten verschijnen enigszins troebel.
  16. De toename van de extracellulaire calciumconcentratie wordt geïnitieerd door toevoeging van 20 ml van oplossing B 1 / 2 bij 37 ° C om de cellen en weefsels nog een residu van oplossing A in de kolf. Dit is iets geschud in een 37 ° C waterbad voor nog eens 5 minuten. Vervolgens wordt het supernatans verwijderd.
  17. Voeg nog eens 20 ml oplossing B 1 / 2. (De oplossing / supernatant bevat nu levensvatbare cellen.) Een druppel van de cellen wordt overgebracht naar een petrischaaltje op een omgekeerde celcultuur microscoop. Als de cellen vertonen een hoge spontane activiteit (contracties) moet men wachten tot cellen tot rust komen.
  18. Eens te meer het supernatans verwijderd en 20 ml van oplossing B 1 / 2 zijn toegevoegd.
  19. De tip van een plastic Pasteur pipet wordt afgesneden op een zodanige wijze, dat het weefsel stukken makkelijk kunnen passeren wanneer opgewonden door de opening. Met de vlam behandeling scherpe randen zijn zacht (gesmolten).
  20. Nu het weefsel stukken zijn licht en voorzichtig getritureerd. Het weefsel stukken moeten "uit elkaar vallen" in de cellen.
  21. De cel met supernatant wordt gedecanteerd en verdund met oplossing B om de gewenste cel dichtheid, die afhankelijk is van de aard van de experimenten en moet empirisch worden bepaald bereiken.

2. Bouw van een adenovirus voor het fusie-eiwit transductie

Voor de productie van adenovirussen de Transpose-Ad adenovirale vector System van MP Biomedicals wordt gebruikt 1. Dit protocol begint met de beschikbare en geteste entry vector (pCR259) voor een fluorescerend eiwit of GEB s 2.

  1. Een bedrag van 10 ng van de hierboven genoemde eerste pCR259 vector die het gen van belang is getransformeerd met 100 ul HighQ-1 Transpose-AD ™ 294 competente cellen.
  2. Dit mengsel wordt gedurende 20 minuten op het ijs, gevolgd door een heat shock voor 45 s bij 42 ° C en opgeslagen op ijs voor een extra 2 minuten.
  3. Voeg 900 & mu; L van de niet-selectieve LB-medium en groeien bij 37 ° C onder zacht schudden gedurende 4 uur.
  4. Plaat 50 ul, 100 en 200 ul ul op platen met LB-medium met chlooramfenicol (Cm, 20 ug / ml), ampicilline (100 ug / ml), tetracycline (15 ug / ml), X-Gal (280 ug / ml ) en IPTG (40 ug / ml). (Een meer intense en sneller blauwe kleuring is mogelijk door het gebruik van de duurdere kleurstof Bluo-Gal met 300μg/ml. Dit moet gebruikt worden in het bijzonder wanneer je niet zo bekend in het herkennen en onderscheidende blauw / witte kolonies)
  5. Groeien voor 24 uur bij 37 ° C. Laat bij 4 ° C tot een goede identificatie van de blauwe kolonies is mogelijk. Wanneer er problemen zijn om te beslissen welke kolonie is echt wit kiezen een deel van de kolonies en repliceren op een ander bord met de drie antibiotica, X-Gal en IPTG en laat ze over 's nachts groeien bij 37 ° C.
    Opmerking) De HighQ-1 Transpose-AD ™ 294 cellen bevatten twee belangrijke plasmiden: Het adenovirus backbone (Transpose-Ad ™ 294) en een helper plasmide dat een transposase, die de insertie van het gen van interesse bemiddelt in zijn doel sites, gelegen in het lacZ-gen van de Transpose-AD 294 plasmide.
  6. Het identificeren van de positieve kolonies die het gen van interesse in het virus backbone voeren kolonie-PCR, zoals beschreven in 2,7-2,9. Gebruik vector primers aan weerszijden van de multiple cloning site (forward 5 'CCCAGTCACGACGTTGTAAAACG 3', reverse 5 'GCGGATAACAATTTCACACAGG 3') en maak een kolonie PCR met 100% witte kolonies en het gebruik van een blauwe kolonie als een controle voor Transpose-AD 294 plasmiden zonder ingebrachte gen van belang. Blauwe kolonies geeft je een korte PCR-fragment (~ 200bp), kolonies met uw gen van belang vertonen een grote PCR-product (afhankelijk van de lengte van uw gen van belang) en de kolonies met twee fragmenten zijn meerdere cel kolonies en moeten worden gescheiden indien verder gebruikt.
  7. Volgens de onderstaande tabel een master mix moet worden voorbereid.
  8. Kies een single 100% wit kolonie met een autoclaaf tandenstoker en eerste een kopie van deze kolonie maken op een LB-plaat met Cm.
  9. Breng de kolonie in de PCR-mix. Twirl in de PCR-mix 3-4 keer dan verwijdert u de tandenstoker voordat het kon een groot deel van de PCR-mix genieten. De PCR-protocol is afhankelijk van het kb van het donormateriaal en de gebruikte polymerase. De annealing temperatuur van de primers is 57 ° C en een gebruik van 35 cycli is aan te bevelen.
  10. Grow 's nachts culturen (LB-medium met Cm) van de positieve klonen en isoleren van de plasmiden met een commercieel verkrijgbare kit zonder spin-kolommen, omdat de middelpuntvliedende kracht verstoort de enorme virus vector.
  11. Transformeren 0,5 ug van de geïsoleerde plasmiden in 100 ul DH5a competente cellen. Incubeer de DNA met cellen op ijs gedurende 30 minuten. Heat shock 45 seconden bij 42 ° C en zet op ijs gedurende 2 minuten.
  12. Voeg 900 ul niet-selectieve LB-medium en groeien bij 37 ° C onder zacht schudden gedurende 1 uur.
  13. Plaat 50 ui op een bord met LB-medium met Cm, X-Gal en IPTG. Incubeer bij 37 ° C gedurende 24 uur.
  14. Pick en repliceren tot 20 100% witte kolonies op aparte ampicilline, tetracycline en chlooramfenicol platen met IPTG en X-Gal. Laat ze 's nachts groeien bij 37 ° C. Selecteer de kolonies die 100% wit, chlooramfenicol bestendig, ampicilline en tetracycline gevoelig.
  15. Kolonie-PCR (optioneel): positieve klonen kan weer worden getest met kolonie-PCR om te controleren of ze de insert bevatten.
  16. Kies een kolonie van een positieve recombinant en groeien in 600 ml LB-medium met Cm.
  17. Isoleer het plasmide met behulp van een plasmide maxi kit.
  18. Digest 5 ug van plasmide met Pac ik gedurende twee uur bij 37 ° C en de reactie te stoppen bij 65 ° C gedurende 20 minuten.
  19. Concentreer je het hele verteren in een SpeedVac bij kamertemperatuur gedurende 30 minuten tot een eindvolume van 10 ul of gebruik een fenol-chloroform extractie methode.
  20. Dooi een flacon van bevroren QBI-HEK 293 cellen met zacht schudden in een 37 ° C waterbad. Spoel de buitenzijde van de flacon met 70% ethanol en ga aseptisch in een steriele kap.
  21. Overdracht cellen om een ​​steriele 15 ml buis, voeg druppelsgewijs 10 ml DMEM (+10% FCS), terwijl zacht roeren en centrifugeer 10 min bij 250xg om pellet de cellen.
  22. Gooi supernatant. Resuspendeer de pellet in 10 ml DMEM (+10% FCS) door zachtjes en neer te pipetteren.
  23. Zaad in een 75 cm 2 erlenmeyer en voeg 10 ml DMEM met 10% FCS naar de cellen. Incubeer overnacht bij 37 ° C in een 5% CO 2 incubator.
  24. De volgende dag gaan de cel dichtheid. QBI-HEK 293 cellen moeten worden gesplitst in een verhouding tussen 1u10-01u20.
  25. Verwijder het medium van de cellen en trypsinize met 2 ml trypsine voor 1-3 minuten. Geef 10 ml DMEM naar de cellen en centrifugeer bij 250xg gedurende 10 minuten.
  26. Verwijder zorgvuldig het medium en geef 10 ml vers medium aan de cellen, resuspenderen en tellen van de cellen.
  27. Plaat in een zes-well een goed met 2x10 5, 3x10 5 5, 5 en 5x10 6x10 5 cellen. Incubeer de schotel op 37 ° C in een CO 2-incubator.
  28. Bij de volgende dag gebruik maken van een goed met 50% confluentie te transfecteren met de geconcentreerde Pac ik verteren. Wij hebben goede ervaringen met Lipofectamine 2000 transfectie, maar ook andere methoden (zoals calciumfosfaat transfectie) moet geschikt zijn.
  29. Verandering het medium in de goed 3-4 uur voor transfectie om de cellen te krijgen in een exponentiële groei tijdens de procedure.
  30. Mix 5 pi Lipofectamine met 250 ul DMEM en incubeer bij kamertemperatuur gedurende 5 minuten.
  31. Geef de Lipofectamine-Medium mengsel aan het DNA (I Pac verteren) en meng door te tikken tegen de reageerbuis, niet mengen met pipetteren. Incubeer dit mengsel 20 minuten bij kamertemperatuur.
  32. Laat de transfectie mengsel aan de cellen en rock de plaat om te mengen. Incubeer bij 37 ° C met 5% CO 2. Verandering medium na 4-5 uur.
  33. Twee dagen na transfectie neemt het medium van de cellen en geven het in een frisse cultuur kolf (75 cm 2).
  34. Trypsinize de cellen met 500 pi trypsine voor maximaal 5 minuten. Geef 1 ml DMEM naar de cellen, neem de hele mengsel en zet het, samen met 17 ml vers medium (DMEM met FCS) in de cultuur kolf. Cultiveren van de cellen bij 37 ° C met 5% CO 2 tot cytopathische effecten (CPE) zijn zichtbaar. Zie figuur 2 om te leren hoe CPE eruit moet zien.
  35. Verzamel de cellen met het medium in een 50 ml buis en bevriezen de cellen bij -80 ° C. Breek de cellen met drie vries / dooi cycli (-80 ° C/37 ° C waterbad).
  36. Centrifugeer 20 min bij 8000xg en 4 ° C. Schenk de bovenstaande vloeistof in een 100 mm-diameter schotel en gooi de pellet. Gebruik een steriele filter met 0.45μm poriegrootte om filtraat het supernatant. Dit is het eerste virus voorraad (passage 1).
  37. Gebruik 1 / 3 van dit bestand naar een 75cm 2 fles transduceren met QBI-HEK 293 cellen met 70% confluentie. Incubeer bij 37 ° C en 5% CO 2 tot CPE s zichtbaar zijn.
  38. Als de cellen vertonen CPE s verzamel ze en pak de virussen zoals voorheen. Dit is 2 passage van het virus.
  39. Herhaal stap 2.37 en 2.38 met het virus doorgang 2 en zo verder tot de versterking van de virussen bereikt een voldoende virus voorraad. Het virus kan worden toegespitst, waarbij specifieke centrifugatie buizen (Amicon Ultra-15 Centrifugaal filter unit met ultracel-100 membraan van Millipore) en opgeslagen voor enkele maanden bij -80 ° C. Om de telling van de infectieuze deeltjes gebruik maken van een plaque assay.
  40. Gebruik virus passage 2 of hoger om cellen te transduceren en voor de verdere versterking van het virus.

3. Primaire celcultuur en adenovirale transductie

  1. Steriele ronde dekglaasjes van 20 mm diameter geplaatst worden in standaard 12-well platen.
  2. 20 ui ECM-oplossing is gelijk verdeeld op elke dekglas. Resten zijn verwijderd. Voor het drogen van een minimum van 1 uur mogelijk bij 37 ° C. Als alternatief kan de coating kan door gedroogd boven 's nachts (12 uur) bij kamertemperatuur.
  3. Elk putje wordt gevuld met 1 ml Medium M199 met supplementen, bestaande uit antibiotica en ITS.
  4. Een celsuspensie (van stap 1.21) van 200 tot 400 ui wordt toegevoegd aan elke well. Kweken van de cellen treedt op bij 37 ° C in een 5% CO 2 incubator.
  5. Cellen zijn toegestaan ​​om sediment en na een uur medium is veranderd.
  6. Onmiddellijk na het veranderen van het medium een ​​voldoende hoeveelheid virus bevattende oplossing (vanaf passage 2 of hoger) wordt gemengd door voorzichtig het schommelen van de plaat.
  7. In het geval van een lange termijn kweekmedium wordt elke 2 dagen.
  8. 24 uur na transfectie GEB uitdrukking is aantoonbaar.

4. Confocale beeldvorming voor 3D subcellulaire structuren en Ca 2 + Signaling

Confocale beeldvorming kan worden uitgevoerd op elke confocale microscoop. Echter, calcium-imaging experimenten vereisen een overname snelheid van ten minste video te beoordelen (25-30 Hz). Dit beperkt bruikbare technologieën om een ​​multi-beam scanners (bijvoorbeeld Nipkow-schijf, veegde het veld of kilo-beam-array scanner) of de zeer snelle single beam scanner (bijv. resonante scanner of acousto optische deflector (AOD)-scanner). Zie voor een overzicht Ref. 3. De 3D-subcellulaire beeldvorming is een z-drive. Hier een kilo-beam serie scanner (VTinfinity, VisiTech Int., Sunderland, Verenigd Koninkrijk) wordt gebruikt.

  1. De microscoop en randapparatuur moet worden ingesteld naar een modus. Speciaal voor de laser dit kan een warming-up periode tot een stabiele vermogen is bereikt.
  2. Cellen moeten worden overgedragen aan een experimentele ruimte (cover-slip overdracht). De dekglaasjes met cellen worden overgebracht naar een experimentele kamer. 1 ml Tyrode oplossing (bevattende 1,8 mM extracellulair calcium) wordt vervolgens toegevoegd.
  3. De experimentele kamer moet worden geplaatst op de microscoop podium. Stimulatie elektroden, perfusie set-up en verdere peripheral, bijv. temperatuur, moeten dienovereenkomstig worden geregeld.
  4. Cellen zullen worden gericht op en geselecteerd met behulp van wit licht en / of epifluorescerende verlichting.
  5. Acquisitie parameters zoals laservermogen, belichtingstijd etc. of een hele experiment protocol om te set-up.
  6. Tijdreeksen en / of Z-sectie beelden kunnen worden verkregen.
  7. Op de set-up verder gevorderd multimode metingen kunnen worden gedaan met behulp van elektrofysiologie (patch-clamp) en / of optische manipulatie zoals fluorescentie herverdeling na photobleach (FRAP) of uncaging van stoffen, waaronder twee foton fotolyse.
  8. Beeldanalyse, in het bijzonder 3D-reconstructie is uitgevoerd op speciale analyse software zoals Imaris (Bitplane AG, Zürich, Zwitserland), snelheid (Improvisatie, Coventry, Verenigd Koninkrijk) of Arivis Browser (arivis GmbH, Rostock, Duitsland).

5. Representatieve resultaten:

De eindresultaten van het protocol zijn imago sequenties die gebruikt kunnen worden om verdere gegevens te extraheren.

Een voorbeeld hiervan is het onderzoek van subcellulaire structuren en organellen. Figuur 3 geeft het voorbeeld van de 3-dimensionale rangschikking van het Golgi-apparaat. In tegenstelling tot elektronenmicroscopie alle onderzoeken kunnen worden uitgevoerd op levende cellen.

Figuur 1
Figuur 1: Algemeen stroom van de grote experimentele stappen.

Figuur 2
Figuur 2: De linker afbeelding toont de Q-HEK cellen in cultuur met 90-95% confluentie die niet getransduceerd. Cytopatic effecten na virale transductie worden getoond in het rechter deel. Cellen ronden en los te maken van de onderzijde van de plaat. In deze cellen de kern beslaat het grootste deel van de cellen als gevolg van een actief virus productie.

Figuur 3
Figuur 3: volwassen ratten cardiale myocyte getransfecteerd met een YFP-fusie-eiwit gericht op het Golgi-apparaat. Cardiale myocyten na adenovirale gentransfer (een dag in de cultuur) te drukken de tl-fusie-eiwit. Paneel A toont een confocale plak genomen van een z-stack. In paneel B dezelfde cel wordt afgebeeld na het deconvolutie met behulp van een theoretisch punt spreiding functie (PSF). Deze de-wazig beeld stack wordt vervolgens gebruikt om de cel te maken en een 3D-volume reconstructie te krijgen zoals getoond in paneel C of een 3D-oppervlak reconstructie (D). De bar is 10 micrometer.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

De procedure beschreven voor het isoleren van de cardiomyocyten van de rat kan worden aangepast aan andere soorten, zoals de muis 4, indien nodig. Een parameter die aanpassing nodig heeft, is het enzym mix voor de spijsvertering (zie hieronder) en ook de duur van de spijsvertering. Wees ervan bewust dat de cellen van sommige soorten (bijvoorbeeld een muis) zou kunnen worden kwetsbaarder zijn dan andere (bv. rat).

De keuze van collagenase is waarschijnlijk de meest cruciale stap in de isolatie procedure. We kiezen Liberase Blendzyme want het is een synthetisch enzymatische mix met vrijwel geen batch-to-batch variaties. De conventionele methode is het gebruik van zogenaamde ruwe collagenase uit Clostridium histolyticum, die ook een geldige methode. Echter, batch-to-batch variaties vereisen nieuwe optimaliseren voor elke nieuwe batch.

Behalve van de tl-fusie-eiwitten en de GEB transductie de adenovirale gentransfer kan ook gebruikt worden voor meer dan de expressie van functionele eiwitten of hun naar beneden regelgeving (bijvoorbeeld door RNAi 5). Dit geldt omdat de transductie-efficiëntie is hoog (> 95%) en reproduceerbaar.

Subscription Required. Please recommend JoVE to your librarian.

Acknowledgments

Dit werk werd ondersteund door de Duitse National Science Foundation (DFG) en door de Federale Institute for Risk Assessment (BfR, Duitsland).

Materials

Name Company Catalog Number Comments
Anesthesia solution Serumwerk Bernburg GmbH (Ursotamin), Bayer Health Care (Rompun) Mixture of 1 ml Ursotamin (100 mg/ml Ketaminhydrochlorid) and 240 μl Rompun (2% Xylazinhydrochlorid)
Citrate solution 117,64 mg sodium citrate in 10 ml 0.9% NaCl solution
Solution A 134 mM NaCl, 4 mM KCl, 11 mM glucose, 1.2 mM MgSO4, 1.2 mM Na2HPO4, 10 mM HEPES, pH adjusted to 7.35 using 10 M NaOH, sterile filtered
Solution A+ Content of solution A plus 0.2 mM EGTA, pH adjusted to 7.35 using 10 M NaOH, sterile filtered
Liberase solution F. Hoffmann‐ La Roche Ltd. 11988476 001 500 μl stock solution in 15 ml solution A (stock solution:10 mg/ml Liberase Blendzyme 4 in aqua dest.)
Solution B Content of solution A plus 200 μM CaCl2 and 0.1% DNase solution
Solution B1/2 1:1 mixture of solution A and solution B
DNase solution Sigma-Aldrich D4527 Deoxyribonuclease I, Type 2 from bovine pancreas, 40 KU (15 mg) are dissolved in 5 ml of 10 mM Tris‐HCl buffer, adjusted to pH=7.35, additional content: 50 mM NaCl, 10 mM MgCl2, 1 mM dithi–rythritol; this solution is mixed with 5 ml glycerol
Extracellular matrix protein (ECM) solution Extracellular matrix protein (ECM) solution E1270 1 ml stock solution as purchased is diluted with 6 mLmedium M199
Culture medium M199 PAA Laboratories E15‐834 Medium M199 supplemented with 1 μl/ml ITS solution and 20 μl/ml penicillin‐streptomycin solution (5000 units/ml)
ITS solution 25 mg Insulin, 25 mg Transferrin and 50 μl Selenite stock solution are dissolved in 5 ml aqua dest. (stock solution: 0.5 mg/ml Sodiumselenite in aqua dest.). Add a few drops of 1 M HCl until one should get a clearsolution. Aliquots can be frozen.
Tyrode 135 mM NaCl, 5.4 mM KCl, 1.8 mM CaCl2, 2mM MgCl2, 10 mM glucose, 10 mM HEPES, pH adjusted to 7.35 using 10 M NaOH, sterile filtered
Master mix 5 μl 10×PCR‐Buffer, 5 μl MgCl2 (25 mM), 2 μl forward primer, 2 μl reverse primer, 1 μl dNTP´s (10 mM each), 33 μl H2O, 1 μl DMSO, 1 μl Taq‐DNA polymerase for each sample
LB‐Medium 10 g/l Tryptone, 5 g/l Yeast extract, 5 g/l NaCl (and 15 g/l Agar if used as solid medium), pH 7.0
Pac I New England Biolabs R0547L preparation: 50 μg DNA, 5 μl 10×buffer, 0.5 μl 100×BSA,0.75 μl Pac I, fill with H2O up to final volume of 50μl

DOWNLOAD MATERIALS LIST

References

  1. Kaestner, L., Ruppenthal, S., S, Molecular Imaging II. Licha, K., Lin, C. P. Vol. 7370, SPIE. Bellingham. 737008-737008 (2009).
  2. Viero, C., Kraushaar, U., Ruppenthal, S. In vivo imaging of Drosophila melanogaster pupae with mesoscopic fluorescence tomography. Cell Calcium. 43, (1), 59-59 (2008).
  3. Shorte, S. L., Frischknecht, F. Imaging Cellular and Molecular Biological Functions. Springer. Berlin Heidelberg. 289-289 (2007).
  4. Kaestner, L., Lipp, P. Optics in Life Science. Popp, J., von Bally, G. Vol. 6633, SPIE. Munich. 66330K-66330K (2007).
  5. Rinne, A., Littwitz, C., Bender, K. Adenovirus-mediated delivery of short hairpin RNA (shRNA) mediates efficient gene silencing in terminally differentiated cardiac myocytes. Methods Mol Biol. 515, 107-107 (2009).
Isolatie en genetische manipulatie van Adult hartspiercellen voor confocale Imaging
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Kaestner, L., Scholz, A., Hammer, K., Vecerdea, A., Ruppenthal, S., Lipp, P. Isolation and Genetic Manipulation of Adult Cardiac Myocytes for Confocal Imaging. J. Vis. Exp. (31), e1433, doi:10.3791/1433 (2009).More

Kaestner, L., Scholz, A., Hammer, K., Vecerdea, A., Ruppenthal, S., Lipp, P. Isolation and Genetic Manipulation of Adult Cardiac Myocytes for Confocal Imaging. J. Vis. Exp. (31), e1433, doi:10.3791/1433 (2009).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter