Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Biology

L'isolement et la manipulation génétique des adultes pour les myocytes cardiaques imagerie confocale

doi: 10.3791/1433 Published: September 17, 2009

Summary

Myocytes cardiaques adultes sont des cellules primaires qui peuvent être isolés de coeurs d'animaux et cultivées pendant plusieurs jours. Durant cette période, la culture de transfert de gènes adénoviraux peut être utilisé pour exprimer les biocapteurs génétiquement codés (ADB) ou des protéines de fusion fluorescentes. Les deux approches permettent d'enquêtes cellulaires par microscopie confocale.

Abstract

Myocytes cardiaques isolés de cœur adulte sont largement acceptés comme un modèle, quelque part à mi-chemin entre les cellules musculaires embryonnaires et néonatales d'un côté et un cœur travaille sur l'autre. Ainsi, les cardiomyocytes servir de bons modèles pour la physiologie cellulaire cardiaque et la physiopathologie, des enquêtes pharmaceutique ainsi que pour l'exploration de modèles animaux transgéniques. Nous décrivons ici une méthode d'isoler les cellules du cœur. En outre, nous montrons comment une manipulation génétique sur les myocytes cardiaques peuvent être effectuées sans l'élevage d'un animal transgénique: C'est la combinaison de la culture à long terme (1 semaine) et le transfert de gènes adénoviraux. Ce dernier est décrit par la construction du virus de la transduction des cellules. Il peut être utilisé pour l'expression de biocapteurs génétiquement codés (ADB), protéines de fusion fluorescentes, mais aussi pour la protéine sur l'expression et la régulation négative, par exemple en utilisant l'ARNi. Ici, nous fournir un exemple pour l'expression d'une protéine de fusion coloration d'une structure subcellulaire (Golgi). L'expression des protéines peuvent être visualisées par l'imagerie confocale de z-piles pour une reconstruction 3D des structures subcellulaires. Le protocole comprend l'état de l'art dans la culture cellulaire, biologie moléculaire et de biophysique et fournit ainsi une méthode pour explorer de nouveaux horizons en cardiologie cellulaire.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Le plus toute la conception du protocole contenant quatre grandes étapes est représenté dans la figure 1. Toutes les étapes sont décrites en détail. L'isolement cellulaire, la transduction et la culture, suivie par imagerie confocale environ 24 heures plus tard, un est consécutive et obligatoire des délais. La construction du virus devrait être fait d'avance sur l'isolement cellulaire et est ensuite utilisée pour la transduction génétique.

1. Isolement des myocytes cardiaques adultes à partir de coeur de rat

  1. Des rats Wistar mâles adultes d'environ 250 g en poids (semaines 6-12 ans) sont anesthésiés par injection intrapéritonéale de 170 ul par l'anesthésie solution de 100 g de poids corporel
  2. En outre, une solution de citrate (2 ul / g de poids corporel) est injecté pour éviter la coagulation du sang pendant la chirurgie.
  3. Perfusion Langendorff Set-Up doit être préparé. Toutes les solutions doivent être saturée en oxygène.
  4. Quand le rat est anesthésié, l'animal est fixé sur une planche à la chirurgie et la partie supérieure du corps est désinfectée avec de l'éthanol à 70%.
  5. L'animal est tué en coupant à travers la carotide.
  6. Le thorax est ouverte à l'aide des ciseaux. Le cœur et l'aorte devrait désormais être accessible. Le Péricard est enlevé.
  7. Solution glacée A + (5 ml) est injectée dans les deux ventricules aide d'une aiguille de calibre 26 pour arrêter le coeur et laver le sang.
  8. L'aorte est saisi avec une pince et tronqué à l'arc aortique n'étaient tout simplement le premier branchement se produit.
  9. Le cœur est retiré de la poitrine et l'aorte est attaché à la canule de perfusion mis en place par une pince et une pince pour permettre rétrogrades Langendorff-perfusion. Soyez conscient de ne pas foraminées des valvules aortiques.
  10. Le cœur doit être fixée par une ligature autour de l'aorte / canule. Ouvrez les bateaux doivent également être ligaturées.
  11. Le cœur est rétrograde perfusés avec une solution saturée de l'oxygène-A + à température ambiante (23 ° C) pendant 10 min à une pression d'environ 70 mbar. Assurez-vous que les bulles d'air saisir l'aorte.
  12. La solution de perfusion est passé à une solution Libérase à une température de 37 ° C pendant environ 25 min à une vitesse de 4 ml / min au moyen d'une pompe péristaltique. A la fin de la perfusion du cœur devrait aspect marbré blanc. Le temps de digestion peuvent être adaptées à la situation de la condition / tissu.
  13. Le cœur est pris par la perfusion d'installation et placé dans une solution contenant une boîte de Petri à une température de 37 ° C. Navires restants et les oreillettes sont coupées. Les navires sont mis au rebut et les oreillettes - si nécessaire - sont traités différemment (ne faisant pas partie de ce protocole). Les ventricules sont divisés en environ 6 pièces.
  14. Les morceaux sont transférés dans un erlenmeyer de 100 ml contenant 20 ml de solution A à une température de 37 ° C et un peu agitée dans un bain d'eau à 37 ° C pendant 5 min. Enfin, le surnageant est éliminé.
  15. La procédure décrite ci-dessus est répétée une fois ou deux fois. Le surnageant devrait apparaître légèrement opaque.
  16. L'incrément de la concentration de calcium extracellulaire est initiée en ajoutant 20 ml de solution B 1 / 2 à 37 ° C pour les cellules et tissus restants un résidu de la solution A dans l'erlenmeyer. Ce chiffre est légèrement secoué dans un bain d'eau à 37 ° C pour 5 minutes supplémentaires. Par la suite le surnageant est éliminé.
  17. Ajouter encore 20 ml de solution B 1 / 2. (Le surnageant solution / doit maintenant contenir des cellules viables.) Une baisse des cellules est transférée à une boîte de Pétri sur un microscope inversé la culture cellulaire. Si les cellules montrent une forte activité spontanée (contractions), on doit attendre que les cellules viennent se reposer.
  18. Une fois de plus le surnageant est éliminé et 20 ml de solution B 1 / 2 sont ajoutés.
  19. La pointe d'une pipette Pasteur en plastique est coupé de telle façon que les pièces de tissu peut passer facilement lorsqu'il est agité par l'ouverture. Avec un traitement flammes arêtes vives sont adoucies (fondu).
  20. Maintenant, les morceaux de tissu sont légèrement et doucement trituré. Les morceaux de tissus devrait "tomber en morceaux" dans les cellules.
  21. La cellule contenant le surnageant est décanté et diluée avec une solution B pour atteindre la densité cellulaire désirée, qui dépend du type d'expériences et doit être déterminée empiriquement.

2. Construction d'un adénovirus pour la transduction protéine de fusion

Pour produire le système de transposition des adénovirus Ad-vecteur adénoviral de MP Biomédical est utilisé 1. Ce protocole commence avec le vecteur d'entrée disponibles et testés (pCR259) pour une protéine de fusion fluorescente ou GEB s 2.

  1. Un montant de 10 ng de l'mentionnés ci-dessus initiales pCR259 vecteur contenant le gène d'intérêt est transformé avec 100 pi HighQ-1-AD Transpose ™ 294 cellules compétentes.
  2. Ce mélange est incubé pendant 20 min sur la glace suivie d'un choc thermique de 45 s à 42 ° C et stockés sur la glace pendant 2 min de plus.
  3. Ajouter 900 & mu; L de milieu LB non sélectives et de croître à 37 ° C avec agitation douce pendant 4 heures.
  4. La plaque 50 pl, 100 pl et 200 pl sur les plaques contenant du milieu LB avec du chloramphénicol (Cm, 20 pg / ml), l'ampicilline (100 pg / ml), la tétracycline (15 pg / ml), X-Gal (280 pg / ml ) et IPTG (40 pg / ml). (Une coloration plus intense et plus rapide bleu est possible en utilisant le plus cher de teinture Bluo-Gal avec 300μg/ml. Cela devrait être utilisé en particulier lorsque vous n'êtes pas si familier à reconnaître et distinguer bleu / blanc colonies)
  5. Cultivez pendant 24 heures à 37 ° C. Laisser à 4 ° C jusqu'à une bonne identification des colonies bleues est possible. Quand il ya des problèmes de décider quelle colonie est vraiment blanche ramasser quelques-unes des colonies et de reproduire sur une autre plaque contenant les trois antibiotiques, X-Gal et IPTG et les laisser pousser pendant la nuit à 37 ° C.
    Remarque) Le HighQ-1-AD Transpose ™ 294 cellules contiennent deux plasmides importante: L'épine dorsale adénovirus (Ad-Transpose ™ 294) et un plasmide auxiliaire exprimant une transposase, qui médiatise l'insertion du gène d'intérêt dans ses sites cibles, situées dans le gène LacZ des 294 Transpose-AD plasmide.
  6. Pour identifier les colonies positives contenant le gène d'intérêt dans le squelette du virus effectuer des colonies par PCR comme décrit dans 2.7 à 2.9. Utilisez amorces vecteur flanquant le site de clonage multiple (avant 5 'CCCAGTCACGACGTTGTAAAACG 3', inverser 5 'GCGGATAACAATTTCACACAGG 3') et faire une colonie avec 100% des colonies blanches PCR et l'utilisation d'une colonie bleue comme un contrôle pour Transpose-AD 294 plasmides sans gène inséré d'intérêt. Colonies bleu va vous donner un court fragment de PCR (~ 200 bp), les colonies contenant votre gène d'intérêt montrent un produit de grandes PCR (selon la longueur de votre gène d'intérêt) et des colonies de deux fragments de colonies de cellules sont multiples et doivent être séparés si d'autres utilisés.
  7. Selon le tableau ci-dessous un mélange maître doit être préparé.
  8. Choisissez une seule colonie de 100% blanc avec une cure-dent à l'autoclave et d'abord faire une adaptation de cette colonie sur une plaque avec LB-Cm.
  9. Transfert de la colonie dans la PCR-mix. Il pirouette dans la PCR-mix 3-4 fois plus retirer le cure-dent avant qu'elle ne puisse s'imprégner un grand nombre de PCR-mix. Le PCR-protocole dépend de la kb de l'insert et la polymérase utilisée. La température de recuit des amorces est de 57 ° C et une utilisation de 35 cycles est recommandée.
  10. Croître au cours des cultures nuit (milieu LB avec CM) des clones positifs et d'isoler les plasmides avec un kit commercial disponible sans colonnes de centrifugation, parce que la force centrifuge perturbe le vecteur viral énorme.
  11. Transformez 0,5 ug de plasmides isolés dans 100 ul DH5a cellules compétentes. Incuber l'ADN des cellules sur la glace pendant 30 min. Choc thermique de 45 s à 42 ° C et mis sur la glace pendant 2 min.
  12. Ajouter 900 ul sélectives du milieu LB et de croître à 37 ° C avec agitation douce pendant 1 heure.
  13. Plaque 50 ul sur une plaque contenant du milieu LB avec CM, X-Gal et IPTG. Incuber à 37 ° C pendant 24 heures.
  14. Choisissez et reproduire jusqu'à 20% 100 colonies blanches sur séparée ampicilline, la tétracycline et chloramphénicol plaques contenant IPTG et X-Gal. Laissez-les grandir pendant la nuit à 37 ° C. Sélectionnez les colonies qui sont à 100%, blanc chloramphénicol résistants, l'ampicilline et la tétracycline sensibles.
  15. Colony-PCR (facultatif): clones positifs peuvent être testés à nouveau avec la colonie-PCR pour vérifier qu'ils contiennent de l'insert.
  16. Choisissez une seule colonie d'un recombinant positif et grandir dans 600 ml de milieu LB avec CM.
  17. Isoler le plasmide en utilisant un kit maxi plasmide.
  18. Digest 5 ug de plasmide avec Pac-je pendant deux heures à 37 ° C et arrêter la réaction à 65 ° C pendant 20 min.
  19. Concentrer le digérer tout dans un SpeedVac à température ambiante pendant 30 minutes pour un volume final de 10 ul ou utiliser une méthode d'extraction phénol-chloroforme.
  20. Décongelez un flacon de gelée QBI-cellules HEK 293 avec une agitation douce dans un bain d'eau à 37 ° C. Rincer l'extérieur du flacon avec 70% d'éthanol et procéder de façon aseptique dans une hotte stérile.
  21. Transfert des cellules à un tube de 15 ml stérile, ajouter goutte à goutte 10 ml de DMEM (10% de FCS), tout en agitant doucement et centrifuger 10 min à 250xg pour culotter les cellules.
  22. Rejeter le surnageant. Reprendre le culot dans 10 ml de DMEM (10% de FCS) par un léger pipetage de haut en bas.
  23. Semences dans un flacon de 75 cm2 et ajouter 10 ml de DMEM avec 10% de FCS dans les cellules. Incuber pendant la nuit à 37 ° C dans un 5% de CO 2 incubateur.
  24. Le lendemain de vérifier la densité cellulaire. QBI-cellules HEK 293 devrait être divisée à un ratio de 1:10 et 1:20.
  25. Retirez le support des cellules et trypsiniser avec 2 ml de trypsine pendant 1-3 min. Donner 10 ml de DMEM pour les cellules et centrifuger à 250xg pendant 10 min.
  26. Retirez soigneusement le moyen et donner 10 ml de milieu frais pour les cellules, resuspendre et compter les cellules.
  27. Assiette en un à six puits bien avec 2x10 5, 3x10 5 5, 5x10 5 et 6x10 5 cellules. Incuber le plat à 37 ° C dans un incubateur à CO 2-.
  28. Au lendemain de l'utilisation d'un puits avec 50% de confluence de transfecter avec le concentré digérer Pac-je. Nous avons une bonne expérience avec la transfection Lipofectamine 2000, mais également d'autres méthodes (telles que la transfection de phosphate de calcium) doit être adapté.
  29. Changer le support dans la même 3-4 h avant la transfection d'obtenir des cellules en croissance exponentielle au cours de la procédure.
  30. Mélanger 5 Lipofectamine ul avec 250 pi de DMEM et incuber à température ambiante pendant 5 min.
  31. Donner le mélange Lipofectamine-moyen de l'ADN (Pac je digère) et mélanger en tapant contre le tube de réaction, ne pas mélanger par pipetage. Incuber le mélange 20 min à température ambiante.
  32. Déposer le mélange de transfection des cellules et le rock de la plaque pour mélanger. Incuber à 37 ° C avec 5% de CO 2. Changer milieu après 4-5 heures.
  33. Deux jours après transfection prendre la moyenne des cellules et le donner dans un flacon de culture fraîche (75 cm 2).
  34. Trypsiniser les cellules avec 500 ul de trypsine pour 5 min. Donner 1 ml de DMEM pour les cellules, de prendre la totalité du mélange et le mettre, avec 17 ml de milieu frais (DMEM avec FCS) dans le flacon de culture. Cultiver des cellules à 37 ° C avec 5% de CO 2 jusqu'à ce que les effets cytopathiques (CPE) sont visibles. Voir Figure 2 pour apprendre CPE devrait ressembler.
  35. Recueillir les cellules avec le milieu dans un tube de 50 ml et congeler les cellules à -80 ° C. Cassez les cellules avec trois cycles gel / dégel (-80 ° C/37 · Bain d'eau C).
  36. Centrifuger 20 min à 8000xg et 4 ° C. Décanter le surnageant dans un plat de 100mm de diamètre et de jeter le culot. Utilisez un filtre stérile avec la taille des pores de 0.45μm filtrat le surnageant. Il s'agit du stock premier virus (passage 1).
  37. Utiliser 1 / 3 de ce stock à transduire une fiole avec 75cm 2 QBI-cellules HEK 293 avec 70% de confluence. Incuber à 37 ° C et 5% de CO 2 jusqu'à CPE s sont visibles.
  38. Si les cellules montrent CPE s les recueillir et d'extraire les virus comme auparavant. C'est le passage 2 du virus.
  39. Répétez les étapes 2,37 et 2,38 avec le passage du virus 2 et ainsi de suite jusqu'à ce que l'amplification du virus atteint un stock de virus suffisante. Le virus peut être concentrée avec des tubes de centrifugation spécifiques (Amicon Ultra-15 l'unité centrifuge filtre avec Ultracel-100 à partir de la membrane Millipore) et stockés pendant plusieurs mois à -80 ° C. Pour compter les particules infectieuses utiliser un test de la plaque.
  40. Utilisez 2 passage de virus ou supérieur à transduire les cellules et pour l'amplification du virus.

3. Culture de cellules primaires et de la transduction adénovirale

  1. Stérile lamelles rondes de 20 mm de diamètre sont placés dans la norme de 12 puits.
  2. Solution à 20 ul ECM est également répartie sur chaque lamelle. Les restes sont jetés. Pour le séchage permettent un minimum de 1 h à 37 ° C. Alternativement, le revêtement peut être séchées pendant la nuit (12 h) à température ambiante.
  3. Chaque puits est rempli avec une moyenne ml M199 avec des suppléments comprenant des antibiotiques et des ITS.
  4. Une suspension cellulaire (de l'étape 1.21) de 200 à 400 ul est ajouté à chaque puits. La culture des cellules se produit à 37 ° C dans un 5% de CO 2 incubateur.
  5. Les cellules sont autorisés à sédiments et après une moyenne h est changé.
  6. Immédiatement après le changement de support une quantité suffisante de solution contenant le virus (de passage 2 ou supérieur) est mélangé en secouant délicatement la plaque.
  7. Dans le cas d'un milieu de culture à long terme est changé tous les 2 jours.
  8. 24 heures après transfection d'expression GEB est détectable.

4. Imagerie confocale pour la 3D des structures subcellulaires et Ca 2 + de signalisation

Imagerie confocale peut être effectuée sur un microscope confocal. Toutefois, le calcium-imagerie expériences exigent une vitesse d'acquisition des taux de vidéo au moins (25-30 Hz). Cela limite les technologies utilisables pour soit scanners à faisceau multiple (par exemple Nipkow disque, a balayé le terrain ou d'un scanner réseau kilo-faisceau) ou le scanner très rapide du faisceau unique (par exemple scanner résonance ou acousto optiques déflecteur (AOD)-scanner). Pour un aperçu, voir Ref. 3. L'imagerie 3D-subcellulaire nécessite un Z-drive. Voici un scanner réseau kilo-poutre (VTinfinity, VisiTech Int., Sunderland, Royaume-Uni) est utilisé.

  1. Le microscope et le matériel périphérique doit être réglé dans un mode de fonctionnement. Surtout pour le laser cela peut nécessiter une période d'échauffement jusqu'à une puissance de sortie stable.
  2. Les cellules doivent être transférés à une chambre expérimentale (lamelle de transfert). Les lamelles avec les cellules sont transférées dans une chambre expérimentale. 1mL Tyrode solution (contenant 1,8 mM de calcium extracellulaire) est ensuite ajouté.
  3. La chambre expérimentale doit être placé sur la platine du microscope. Électrodes de stimulation, la perfusion d'installation et d'autres peripheappareils RAL, contrôle de température, par exemple, doivent être disposées en conséquence.
  4. Les cellules seront axées sur et sélectionnés en utilisant la lumière blanche et / ou l'éclairage à épifluorescence.
  5. Les paramètres d'acquisition tels que la puissance du laser, etc temps d'exposition ou d'un protocole expérimental complet doit être mis en place.
  6. Séries temporelles d'images et / ou Z-section peuvent être acquises.
  7. Sur les mesures mise en place plus avancée multimode peut être fait en utilisant l'électrophysiologie (patch-clamp) et / ou de manipulation optique, comme la redistribution de fluorescence après photobleach (PAF) ou de substances uncaging dont deux photolyse photon.
  8. L'analyse d'image, surtout en 3D de reconstruction est effectuée sur un logiciel d'analyse dédiés tels que Imaris (Bitplane AG, Zürich, Suisse), vitesse (Improvisation, Coventry, Royaume-Uni) ou le Navigateur Arivis (arivis GmbH, Rostock, Allemagne).

5. Les résultats représentatifs:

Les résultats définitifs du protocole sont des séquences d'images qui peuvent être utilisées pour extraire des données supplémentaires.

Un exemple est l'étude des structures subcellulaires et des organites. La figure 3 montre l'exemple de l'arrangement en 3 dimensions de l'appareil de Golgi. Contrairement à la microscopie électronique toutes les enquêtes peuvent être effectuées sur des cellules vivantes.

Figure 1
Figure 1: flux général des principales étapes expérimentales.

Figure 2
Figure 2: L'image de gauche représente les cellules HEK-Q en culture avec une confluence de 90-95% qui ne sont pas transduites. Effets Cytopatic après transduction virale sont présentés dans la partie droite. Cellules rondes et se détacher du fond de la plaque. Dans ces cellules le noyau occupe la majeure partie des cellules à la suite de la production de virus actif.

Figure 3
Figure 3: myocytes cardiaques de rat adulte transfectées avec une protéine de fusion YFP-cible l'appareil de Golgi. Myocytes cardiaques après transfert de gène adénoviraux (un jour dans la culture) expriment la protéine de fusion fluorescentes. Panel A représente une seule tranche confocale prises à partir d'un Z-stack. Dans le panel B de la même cellule est représentée après déconvolution utilisant une fonction de point de vue théorique réparties (FSP). Cette pile d'images de-floue est ensuite utilisée pour rendre la cellule et obtenir une reconstruction 3D du volume, comme indiqué dans le panneau C ou une reconstruction de surface 3D (D). La barre représente 10 um.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

La procédure décrite à l'isolement des cardiomyocytes de rat peut être adapté à d'autres espèces, par exemple la souris 4, si nécessaire. Un paramètre qui doit l'adaptation est le mélange d'enzymes pour la digestion (voir ci-dessous) et aussi la durée de la digestion. Soyez conscient que les cellules de certaines espèces (souris, par exemple) pourrait être plus fragiles que d'autres (chez le rat, par exemple).

Le choix de la collagénase est probablement l'étape la plus cruciale dans la procédure d'isolement. Nous choisissons Libérase Blendzyme parce qu'il est un mélange synthétique enzymatique avec pratiquement aucune des variations de lot à lot. La méthode classique est l'utilisation de la collagénase brute que l'on appelle extraite de Clostridium histolyticum, qui est aussi une méthode valable. Cependant, le lot à lot variations nécessitent l'optimisation de nouvelles pour chaque nouveau lot.

Outre les protéines de fusion fluorescentes et la transduction du GEB du transfert de gène adénoviral peut également être utilisé pour la surexpression de protéines fonctionnelles ou de leur régulation à la baisse (par exemple par RNAi 5). Cela est vrai parce que l'efficacité de transduction est élevé (> 95%) et reproductible.

Subscription Required. Please recommend JoVE to your librarian.

Acknowledgments

Ce travail a été soutenu par la National Science Foundation allemande (DFG) et par l'Institut fédéral pour l'évaluation des risques (BfR, Allemagne).

Materials

Name Company Catalog Number Comments
Anesthesia solution Serumwerk Bernburg GmbH (Ursotamin), Bayer Health Care (Rompun) Mixture of 1 ml Ursotamin (100 mg/ml Ketaminhydrochlorid) and 240 μl Rompun (2% Xylazinhydrochlorid)
Citrate solution 117,64 mg sodium citrate in 10 ml 0.9% NaCl solution
Solution A 134 mM NaCl, 4 mM KCl, 11 mM glucose, 1.2 mM MgSO4, 1.2 mM Na2HPO4, 10 mM HEPES, pH adjusted to 7.35 using 10 M NaOH, sterile filtered
Solution A+ Content of solution A plus 0.2 mM EGTA, pH adjusted to 7.35 using 10 M NaOH, sterile filtered
Liberase solution F. Hoffmann‐ La Roche Ltd. 11988476 001 500 μl stock solution in 15 ml solution A (stock solution:10 mg/ml Liberase Blendzyme 4 in aqua dest.)
Solution B Content of solution A plus 200 μM CaCl2 and 0.1% DNase solution
Solution B1/2 1:1 mixture of solution A and solution B
DNase solution Sigma-Aldrich D4527 Deoxyribonuclease I, Type 2 from bovine pancreas, 40 KU (15 mg) are dissolved in 5 ml of 10 mM Tris‐HCl buffer, adjusted to pH=7.35, additional content: 50 mM NaCl, 10 mM MgCl2, 1 mM dithi–rythritol; this solution is mixed with 5 ml glycerol
Extracellular matrix protein (ECM) solution Extracellular matrix protein (ECM) solution E1270 1 ml stock solution as purchased is diluted with 6 mLmedium M199
Culture medium M199 PAA Laboratories E15‐834 Medium M199 supplemented with 1 μl/ml ITS solution and 20 μl/ml penicillin‐streptomycin solution (5000 units/ml)
ITS solution 25 mg Insulin, 25 mg Transferrin and 50 μl Selenite stock solution are dissolved in 5 ml aqua dest. (stock solution: 0.5 mg/ml Sodiumselenite in aqua dest.). Add a few drops of 1 M HCl until one should get a clearsolution. Aliquots can be frozen.
Tyrode 135 mM NaCl, 5.4 mM KCl, 1.8 mM CaCl2, 2mM MgCl2, 10 mM glucose, 10 mM HEPES, pH adjusted to 7.35 using 10 M NaOH, sterile filtered
Master mix 5 μl 10×PCR‐Buffer, 5 μl MgCl2 (25 mM), 2 μl forward primer, 2 μl reverse primer, 1 μl dNTP´s (10 mM each), 33 μl H2O, 1 μl DMSO, 1 μl Taq‐DNA polymerase for each sample
LB‐Medium 10 g/l Tryptone, 5 g/l Yeast extract, 5 g/l NaCl (and 15 g/l Agar if used as solid medium), pH 7.0
Pac I New England Biolabs R0547L preparation: 50 μg DNA, 5 μl 10×buffer, 0.5 μl 100×BSA,0.75 μl Pac I, fill with H2O up to final volume of 50μl

DOWNLOAD MATERIALS LIST

References

  1. Kaestner, L., Ruppenthal, S., S, Molecular Imaging II. Licha, K., Lin, C. P. Vol. 7370, SPIE. Bellingham. 737008-737008 (2009).
  2. Viero, C., Kraushaar, U., Ruppenthal, S. In vivo imaging of Drosophila melanogaster pupae with mesoscopic fluorescence tomography. Cell Calcium. 43, (1), 59-59 (2008).
  3. Shorte, S. L., Frischknecht, F. Imaging Cellular and Molecular Biological Functions. Springer. Berlin Heidelberg. 289-289 (2007).
  4. Kaestner, L., Lipp, P. Optics in Life Science. Popp, J., von Bally, G. Vol. 6633, SPIE. Munich. 66330K-66330K (2007).
  5. Rinne, A., Littwitz, C., Bender, K. Adenovirus-mediated delivery of short hairpin RNA (shRNA) mediates efficient gene silencing in terminally differentiated cardiac myocytes. Methods Mol Biol. 515, 107-107 (2009).
L'isolement et la manipulation génétique des adultes pour les myocytes cardiaques imagerie confocale
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Kaestner, L., Scholz, A., Hammer, K., Vecerdea, A., Ruppenthal, S., Lipp, P. Isolation and Genetic Manipulation of Adult Cardiac Myocytes for Confocal Imaging. J. Vis. Exp. (31), e1433, doi:10.3791/1433 (2009).More

Kaestner, L., Scholz, A., Hammer, K., Vecerdea, A., Ruppenthal, S., Lipp, P. Isolation and Genetic Manipulation of Adult Cardiac Myocytes for Confocal Imaging. J. Vis. Exp. (31), e1433, doi:10.3791/1433 (2009).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter