Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Biology

Isolation und genetische Manipulation von Adult Herzmuskelzellen für konfokale Imaging

doi: 10.3791/1433 Published: September 17, 2009

Summary

Adult Herzmuskelzellen sind primäre Zellen, die aus tierischen Herzen isoliert und kultiviert für mehrere Tage. Innerhalb dieses Zeitraums Kultur adenoviralen Gentransfer können verwendet werden, um genetisch kodierte Biosensoren (GEBS) oder fluoreszierende Fusionsproteine ​​zu exprimieren. Beide Ansätze erlauben zellulären Untersuchungen mittels der konfokalen Mikroskopie.

Abstract

Herzmuskelzellen aus adulten Herzen isoliert werden weithin als ein Modell irgendwo auf halbem Weg zwischen embryonalen und neonatalen Muskelzellen auf der einen Seite und ein funktionierendes Herz auf der anderen akzeptiert. So dienen Kardiomyozyten als gute Modelle für kardiale zelluläre Physiologie und Pathophysiologie, für pharmazeutische Untersuchungen sowie für die Erforschung von transgenen Tiermodellen. Hier beschreiben wir eine Methode zur Isolierung von Zellen aus dem Herzen. Darüber hinaus zeigen wir, wie eine genetische Manipulation an Herzmuskelzellen ohne Zucht eines transgenen Tieres durchgeführt werden können: Dies ist die Kombination von langfristigen Kultur (1 Woche) und adenoviralen Gentransfer. Letzteres ist von der Konstruktion des Virus auf die Transduktion der Zellen beschrieben. Es kann für den Ausdruck von genetisch kodierten Biosensoren (GEBS), fluoreszierende Fusionsproteine ​​verwendet werden, sondern auch für die Protein-Überexpression und Down-Regulation, z. B. mittels RNAi. Hier bieten wir ein Beispiel für den Ausdruck eines Fusionsproteins Färbung eine subzelluläre Struktur (Golgi). Solche Protein-Expression kann durch konfokale Bildgebung von z-Stapeln visualisiert für eine 3D-Rekonstruktion von subzellulären Strukturen. Das Protokoll umfasst state-of-the-art in der Zellkultur, Molekularbiologie und Biophysik und bietet somit einen Ansatz zur Erforschung neuer Horizonte in der Zell-Kardiologie.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Die über alle Design des Protokolls enthält vier große Schritte ist in Abbildung 1 dargestellt. Alle Schritte werden ausführlich beschrieben. Zellisolierung, Transduktion und Kultur, durch konfokale Bildgebung etwa 24 Stunden später gefolgt ist ein konsekutiver und obligatorische Zeitskala. Das Virus Konstruktion sollte vor der Zelle isoliert durchgeführt werden und wird dann für die genetische Transduktion eingesetzt.

1. Isolation von adulten Herzmuskelzellen aus Ratten-Herzen

  1. Erwachsene männliche Wistar-Ratten ca. 250 g Gewicht (6-12 Wochen alt) sind betäubt durch intraperitoneale Injektion von 170 ul Anästhesie-Lösung pro 100 g Körpergewicht
  2. Zusätzlich wird ein Citrat-Lösung (2 ul / g Körpergewicht) injiziert, um die Blutgerinnung während der Operation zu vermeiden.
  3. Langendorff Perfusion Set-Up sollte vorbereitet werden. Alle Lösungen sollten mit Sauerstoff gesättigt werden.
  4. Wenn die Ratte betäubt ist, wird das Tier auf eine Operation Board befestigt und der obere Teil des Körpers ist mit 70% Ethanol desinfiziert.
  5. Das Tier ist durch Durchtrennen der Halsschlagader getötet.
  6. Der Thorax geöffnet wird mit einer Schere. Das Herz und die Aorta sollte nun zugänglich sein. Der Herzbeutel entfernt.
  7. Ice-kalte Lösung A + (5 ml) wird in beiden Herzkammern mit einer 26-Gauge-Nadel in das Herz Verhaftung und waschen das Blut injiziert.
  8. Die Aorta ist mit einer Klammer gepackt und verkürzte in der Aortenbogen nur waren die ersten Verzweigung auftritt.
  9. Das Herz ist aus der Brust entfernt und die Aorta an der Kanüle einer Perfusion Set-up mit einer Pinzette und einer Schelle befestigt retrograde Langendorff-Perfusion erlauben. Seien Sie sich bewusst nicht auf die Aortenklappen foraminate.
  10. Das Herz muss durch eine Ligatur um die Aorta / Kanüle befestigt werden. Öffnen Schiffe müssen auch ligiert werden.
  11. Das Herz ist retrograd mit Sauerstoff gesättigte Lösung A + bei Raumtemperatur (23 ° C) für 10 min bei einem Druck von etwa 70 mbar perfundiert. Achten Sie darauf, keine Luftblasen in die Aorta.
  12. Die Perfusionslösung wird eine Liberase Lösung bei einer Temperatur von 37 ° C schaltet für ca. 25 min mit einer Rate von 4 ml / min durch eine Schlauchpumpe. Am Ende der Perfusion des Herzens aussehen sollte marmoriert weiß. Die Verdauung etwas Zeit brauche, um auf die Situation / Gewebe Zustand angepasst werden.
  13. Das Herz ist von der Durchblutung Set-up genommen und in eine Petrischale mit Lösung A bei einer Temperatur von 37 ° C. Verbleibenden Schiffe und Atrien sind abgeschnitten. Die Schiffe werden verworfen und die Vorhöfe - falls benötigt - anders (nicht Bestandteil dieses Protokolls) behandelt. Die Kammern sind in etwa 6 Stücke geteilt.
  14. Die Stücke werden in einen 100 ml Erlenmeyerkolben mit 20 ml Lösung A bei einer Temperatur von 37 ° C und leicht in einem 37 ° C Wasserbad für 5 min geschüttelt. Übertragen Schließlich wird der Überstand verworfen.
  15. Das oben beschriebene Verfahren ist ein-oder zweimal wiederholt. Der Überstand sollte erscheinen etwas undurchsichtig.
  16. Der Zuwachs der extrazellulären Calcium-Konzentration wird durch Zugabe von 20 ml Lösung B 1 / 2 bei 37 ° C zu den Zellen und Gewebe bleiben ein Rest der Lösung initiiert A in den Erlenmeyerkolben. Das ist etwas in einem 37 ° C Wasserbad für weitere 5 min geschüttelt. Anschließend wird der Überstand wird verworfen.
  17. Fügen Sie weitere 20 ml Lösung B 1 / 2. (Die Lösung / Überstand sollte nun lebensfähigen Zellen.) Ein Tropfen der Zellen in einer Petrischale befindet sich auf einer invertierten Zellkultur Mikroskop übertragen. Wenn die Zellen zeigen eine hohe spontane Aktivität (Wehen), muss man warten, bis die Zellen zur Ruhe kommen.
  18. Einmal mehr wird der Überstand verworfen und 20 ml Lösung B 1 / 2 hinzugefügt werden.
  19. Die Spitze eines Kunststoff-Pasteurpipette ausgeschaltet ist in einer Weise, dass die Gewebestücke kann leicht passieren, wenn durch die Öffnung bewegt geschnitten. Mit Beflammung scharfen Kanten sind weich (geschmolzen).
  20. Nun ist die Gewebestücke sind leicht und sanft verrieben. Die Gewebestücke sollten "zerfallen" in die Zellen.
  21. Die Zelle mit Überstand wird dekantiert und verdünnt mit Lösung B, um die gewünschte Zelldichte, die sich auf die Art von Experimenten hängt und sollten empirisch ermittelt werden erreichen.

2. Bau eines Adenovirus für Fusionsprotein Transduktion

Zur Herstellung von Adenoviren der Transpose-Ad adenoviralen Vektor-System von MP Biomedicals wird 1 verwendet. Dieses Protokoll beginnt mit den verfügbaren und getestet Eintrag Vektor (pCR259) für ein fluoreszierendes Fusionsprotein oder GEB s 2.

  1. Eine Menge von 10 ng der oben erwähnten ersten pCR259 Vektor mit dem Gen von Interesse wird mit 100 ul HighQ-1 Transpose-AD ™ 294 kompetente Zellen transformiert.
  2. Diese Mischung wird für 20 min auf Eis durch einen Hitzeschock für 45 s bei 42 ° C gefolgt und auf Eis gelagert für weitere 2 min inkubiert.
  3. Add 900 & mu; L unselektive LB-Medium wachsen und bei 37 ° C unter leichtem Rühren für 4 Stunden.
  4. Tafel 50 ul, 100 ul und 200 ul auf Platten mit LB-Medium mit Chloramphenicol (Cm, 20 pg / ml), Ampicillin (100 pg / ml), Tetracyclin (15 ug / ml), X-Gal (280 pg / ml ) und IPTG (40 ug / ml). (Eine intensivere und schnellere Blau-Färbung wird durch die Verwendung der teureren Farbstoff Bluo-Gal mit 300μg/ml möglich. Diese sollen insbesondere verwendet werden, wenn Sie nicht so vertraut sind bei der Erkennung und Unterscheidung blau / weiße Kolonien)
  5. Wachsen Sie für 24 Stunden bei 37 ° C. Lassen Sie bei 4 ° C bis gute Identifizierung des blauen Kolonien möglich ist. Wenn es Probleme gibt, zu entscheiden, welche Kolonie wirklich weiß ist holen einige der Kolonien und auf einer anderen Platte mit den drei Antibiotika, X-Gal und IPTG replizieren und ließ sie über Nacht wachsen bei 37 ° C.
    Anm.) Die HighQ-1 Transpose-AD ™ 294 Zellen enthalten zwei wichtige Plasmide: Das Adenovirus-Backbone (Transpose-Ad ™ 294) und ein Helfer-Plasmid Ausdruck einer Transposase, die das Einfügen des Gens von Interesse vermittelt in seinen Zielorten, befindet in der LacZ-Gen des Transpose-AD 294-Plasmid.
  6. Zur Identifizierung positive Kolonien, die das Gen von Interesse in der Virus-Backbone durchzuführen Kolonie-PCR als in 2,7-2,9 beschrieben. Verwenden Sie Vektor-Primer flankieren die multiple Klonierungsstelle (forward 5 'CCCAGTCACGACGTTGTAAAACG 3', reverse 5 'GCGGATAACAATTTCACACAGG 3') und eine Kolonie-PCR mit 100% weißen Kolonien und die Nutzung einer blauen Kolonie als Kontrolle für Transpose-AD 294 Plasmiden ohne eingefügte Gen von Interesse. Blaue Kolonien geben Ihnen einen kurzen PCR-Fragment (~ 200 bp), Kolonien mit Ihrem Gen von Interesse zeigen eine große PCR-Produkt (abhängig von der Länge Ihres Gen von Interesse) und Kolonien mit zwei Fragmente sind mehrere Zellkolonien und müssen getrennt werden wenn weiter verwendet.
  7. Nach der unten stehenden Tabelle einen Master-Mix muss vorbereitet werden.
  8. Wählen Sie einen einzigen 100% weiß Kolonie mit einer autoklaviert Zahnstocher und zunächst eine Replikation dieser Kolonie auf einer LB-Platte mit Cm.
  9. Übertragen Sie die Kolonie in den PCR-Mix. Twirl es in den PCR-Mix 3-4 mal als entfernen Sie die Zahnstocher, bevor es eine Menge der PCR-Mix könnte einweichen. Die PCR-Protokoll hängt von der kb des Einsatzes und der verwendeten Polymerase. Die Annealingtemperatur der Primer ist 57 ° C und einem Einsatz von 35 Zyklen empfohlen.
  10. Wachsen Sie über Nacht Kulturen (LB-Medium mit Cm) der positiven Klone und Isolierung der Plasmide mit einem kommerziell erhältlichen Kit ohne Spin-Säulen, da die Zentrifugalkraft stört die große Virus-Vektor.
  11. Transform 0,5 ug der isolierten Plasmide in 100 ul DH5a kompetenten Zellen. Inkubieren DNA mit Zellen auf Eis für 30 min. Heat shock 45 s bei 42 ° C und setzen auf Eis für 2 min.
  12. Add 900 ul unselektive LB-Medium wachsen und bei 37 ° C unter leichtem Schütteln für 1 Stunde.
  13. Tafel 50 ul auf einem Teller mit LB-Medium mit Cm, X-Gal und IPTG. Bei 37 ° C für 24 Stunden.
  14. Pick and replizieren bis zu 20 100% weiße Kolonien auf separaten Ampicillin, Tetracyclin und Chloramphenicol-Platten mit IPTG und X-Gal. Lassen Sie sie über Nacht wachsen bei 37 ° C. Wählen Kolonien, die 100% weiß, Chloramphenicol resistent, Ampicillin und Tetracyclin empfindlich sind.
  15. Colony-PCR (optional): positive Klone können wieder mit Kolonie-PCR getestet werden, um zu überprüfen, dass sie das Insert enthalten.
  16. Wählen Sie eine einzelne Kolonie von einer positiven rekombinanten und wachsen in 600 ml LB-Medium mit Cm.
  17. Isolieren Sie die Plasmid mit einem Plasmid Maxi Kit.
  18. Digest 5 ug Plasmid mit Pac I für zwei Stunden bei 37 ° C und Stop der Reaktion bei 65 ° C für 20 min.
  19. Konzentrieren Sie sich das ganze zu verdauen in einem SpeedVac bei Raumtemperatur für 30 min auf ein Endvolumen von 10 ul oder verwenden Sie eine Phenol-Chloroform-Extraktions-Verfahren.
  20. Tauwetter ein Fläschchen eingefroren QBI-HEK 293-Zellen unter leichtem Schütteln in einem 37 ° C Wasserbad. Spülen Sie die Außenseite der Flasche mit 70% Ethanol und fahren aseptisch in ein steriles Kapuze.
  21. Transfer-Zellen in ein steriles 15 ml Tube, tropfenweise 10 ml DMEM (+10% FCS), während sanfte Rühren und Zentrifuge 10 min bei 250xg die Zellen zu pelletieren.
  22. Überstand. Das Pellet in 10 ml DMEM (+10% FCS) durch vorsichtiges Auf-und Abpipettieren.
  23. Seed in einem 75 cm 2 einwiegen und 10 ml DMEM mit 10% FCS zu den Zellen. Inkubation über Nacht bei 37 ° C in einer 5% CO 2-Inkubator.
  24. Am nächsten Tag prüfen die Zelldichte. QBI-HEK 293-Zellen sollte bei einer 1.10 bis 1.20 Verhältnis aufgeteilt werden.
  25. Entfernen Sie das Medium von den Zellen und trypsinize mit 2 ml Trypsin für 1-3 min. Geben Sie 10 ml DMEM auf die Zellen und Zentrifuge bei 250xg für 10 min.
  26. Entfernen Sie vorsichtig das Medium und geben 10 ml frisches Medium zu den Zellen, resuspendieren und zählen Sie die Zellen.
  27. Plate in einem Sechs-gut man gut mit 2x10 5, 3x10 5 5, 5x10 5 und 6x10 5 Zellen. Inkubieren Sie die Schale bei 37 ° C in einem CO 2-Inkubator.
  28. Am folgenden Tag mit einem gut 50% Konfluenz mit der konzentrierten Pac I verdauen transfizieren. Wir haben gute Erfahrungen mit Lipofectamine 2000 Transfektion, aber auch andere Methoden (z. B. Calciumphosphat-Transfektion) geeignet sein sollte.
  29. Ändern Sie das Medium, in dem auch 3-4 h vor der Transfektion in die Zellen in ein exponentielles Wachstum zu bekommen während des Verfahrens.
  30. Mix 5 ul Lipofectamine mit 250 ul DMEM und Inkubieren bei Raumtemperatur für 5 min.
  31. Geben Sie dem Lipofectamine-Medium-Gemisch auf die DNA (Pac I Digest) und mischen durch Klopfen gegen das Reaktionsrohr, nicht Vermischung durch Pipettieren. Inkubieren Sie die Mischung 20 min bei Raumtemperatur.
  32. Löschen Sie die Transfektion Mischung auf die Zellen-und Rock-Platte zu mischen. Bei 37 ° C mit 5% CO 2. Ändern Medium nach 4-5 Stunden.
  33. Zwei Tage nach der Transfektion nehmen das Medium von den Zellen und geben Sie es in eine frische Kulturflasche (75 cm 2).
  34. Trypsinize die Zellen mit 500 ul Trypsin für bis zu 5 min. Geben Sie 1 ml DMEM auf die Zellen, nehmen Sie die gesamte Mischung und legen Sie sie zusammen mit 17 ml frisches Medium (DMEM mit FCS) in die Kulturflasche. Kultivieren Sie die Zellen bei 37 ° C mit 5% CO 2 bis zytopathischen Effekte (CPE) sichtbar sind. Siehe Abbildung 2 zu lernen, wie CPE aussehen sollte.
  35. Sammeln Sie die Zellen mit dem Medium in einer 50 ml Tube und Einfrieren der Zellen bei -80 ° C. Break the Zellen mit drei Gefrier / Tau-Zyklen (-80 ° C/37 ° C im Wasserbad).
  36. Zentrifuge 20 min bei 8000xg und 4 ° C. Den Überstand in ein 100mm-Durchmesser Teller und entsorgen Sie die Pellets. Verwenden Sie eine sterile Filter mit 0.45 Porengröße Filtrat der Überstand. Dies ist der erste Virus, Lager (Passage 1).
  37. Verwenden Sie 1 / 3 dieser Aktie zu einer 75 cm 2-Kolben mit QBI-HEK 293-Zellen mit 70% Konfluenz transduzieren. Bei 37 ° C und 5% CO 2 bis CPE s sichtbar sind.
  38. Wenn die Zellen zeigen CPE s sammeln und extrahieren Sie die Viren als getan. Dies ist Durchgang 2 des Virus.
  39. Wiederholen Sie die Schritte 2,37 und 2,38 mit Viruspassage 2 und so weiter, bis die Verstärkung der Viren erreicht eine ausreichende Virus Lager. Das Virus kann mit speziellen Zentrifugenröhrchen (Amicon Ultra-15 Kreiselpumpen Filtereinheit mit Ultracel-100-Membran von Millipore) konzentriert und gespeichert werden für mehrere Monate bei -80 ° C. Zum Zählen der infektiösen Partikel mit einem Plaque-Assay.
  40. Verwenden Sie Viruspassage 2 oder höher, um Zellen zu transduzieren und zur weiteren Verstärkung des Virus.

3. Primäre Zellkultur und adenovirale Transduktion

  1. Sterile runde Deckgläschen von 20 mm Durchmesser sind in Standard-12-well Platten.
  2. 20 pl ECM-Lösung ist gleichmäßig auf beiden Deckgläschen verteilt. Bleibt, werden verworfen. Zum Trocknen kann ein Minimum von 1 h bei 37 ° C. Alternativ kann die Beschichtung durch über Nacht getrocknet (12 h) bei Raumtemperatur.
  3. Jedes der gut ist mit 1 ml Medium M199 mit Ergänzungen aus Antibiotika und ITS gefüllt.
  4. Eine Zellsuspension (aus Schritt 1,21) von 200 bis 400 ul wird in jede Vertiefung gegeben. Die Kultivierung der Zellen erfolgt bei 37 ° C in einer 5% CO 2-Inkubator.
  5. Die Zellen werden in das Sediment erlaubt und nach 1 h Medium gewechselt.
  6. Unmittelbar nach dem Wechsel des Mediums eine ausreichende Menge an Virus haltigen Lösung (von Durchgang 2 oder höher) wird durch vorsichtiges Schwenken der Platte gemischt.
  7. Im Falle einer langfristigen Kulturmedium wird alle 2 Tage gewechselt.
  8. 24 Stunden nach der Transfektion GEB Ausdruck ist nachweisbar.

4. Konfokale Bildgebung für 3D subzellulären Strukturen und Ca 2 + Signaling

Konfokale Bildgebung kann auf jedem konfokalen Mikroskop durchgeführt werden. Allerdings erfordern Kalzium-Imaging-Experimenten eine Akquisition Geschwindigkeit von mindestens video Rate (25-30 Hz). Dies schränkt nutzbare Technologien entweder Multi Beam-Scanner (zB Nipkow-Scheibe, fegte Feld oder Kilo-beam-Array-Scanner) oder die sehr schnelle Einstrahl-Scanner (zB Resonanz-Scanner oder akusto optischen Deflektor (AOD)-Scanner). Für einen Überblick vgl. Rz. 3. Die 3D-Bildgebung subzellulären erfordert eine z-Antrieb. Hier ein Kilo-beam-Array-Scanner (VTinfinity, Visitech Int., Sunderland, UK) verwendet wird.

  1. Das Mikroskop und periphere Geräte muss in einer Betriebsart eingestellt werden. Speziell für den Laser kann dies erfordern eine Aufwärmphase, bis eine stabile Ausgangsleistung erreicht ist.
  2. Zellen benötigen, um eine experimentelle Kammer (Deckglas-Transfer) übertragen werden. Die Deckgläser mit Zellen sind eine experimentelle Kammer übertragen. 1 ml Tyrode-Lösung (mit 1,8 mM extrazellulärem Calcium) wird dann zugegeben.
  3. Die experimentelle Kammer muss auf dem Mikroskoptisch platziert werden. Stimulation Elektroden, Perfusion Set-up und weitere Periral-Geräte, zB die Temperierung, müssen entsprechend angeordnet werden.
  4. Die Zellen werden bei konzentriert und ausgewählt werden mit weißem Licht und / oder epifluoreszenten Beleuchtung.
  5. Acquisition Parameter wie Laserleistung, Belichtungszeit etc. oder eine ganze Experiment Protokoll muss eingerichtet werden.
  6. Zeitreihe und / oder Z-Abschnitt Bilder können erworben werden.
  7. Auf dem Set-up weiter fortgeschritten Multimode-Messungen kann mit Elektrophysiologie (Patch-Clamp) und / oder optische Manipulation wie Fluoreszenz Umverteilung nach photobleach (FRAP) oder Freisetzung von Substanzen, darunter Zwei-Photonen-Photolyse werden.
  8. Bildanalyse, insbesondere 3D-Rekonstruktion ist auf dedizierten Analyse-Software wie Imaris (Bitplane AG, Zürich, Schweiz), Geschwindigkeit (Improvisation, Coventry, UK) oder Arivis Browser (arivis GmbH, Rostock, Deutschland) durchgeführt.

5. Repräsentative Ergebnisse:

Die Endergebnisse des Protokolls sind Bildsequenzen, die verwendet werden, um weitere Daten zu extrahieren können.

Ein Beispiel ist die Untersuchung der subzellulären Strukturen und Organellen. Abbildung 3 zeigt das Beispiel der 3-dimensionalen Anordnung der Golgi-Apparat. Im Gegensatz zur Elektronenmikroskopie alle Untersuchungen können an lebenden Zellen durchgeführt werden.

Abbildung 1
Abbildung 1: Allgemeiner Ablauf der wichtigsten experimentellen Schritte.

Abbildung 2
Abbildung 2: Das linke Bild zeigt die Q-HEK-Zellen in Kultur mit 90-95% Konfluenz, die nicht transduziert werden. Cytopatic Wirkungen nach viralen Transduktion sind im rechten Teil dargestellt. Cells runden und lösen Sie aus der unteren Seite der Platte. In diesen Zellen der Kern nimmt den größten Teil der Zellen als Folge der aktiven Virus-Produktion.

Abbildung 3
Abbildung 3: Adult Ratte Herzmuskelzellen mit einem YFP-Fusionsprotein gezielt den Golgi-Apparat transfiziert. Herzmuskelzellen nach adenoviralen Gentransfer (1 Tag in Kultur) drücken die fluoreszierende Fusionsprotein. Panel A zeigt einen einzigen konfokalen Scheibe aus einem z-Stack genommen. In Panel B dieselbe Zelle wird nach Dekonvolution mit Hilfe eines theoretischen Point Spread Function (PSF) dargestellt. Diese de-unscharfes Bild Stapel wird anschließend verwendet, um die Zelle zu machen und sich ein 3D-Volumen Wiederaufbau als in Panel C oder eine 3D-Oberfläche Wiederaufbau (D) gezeigt. Die Bar ist 10 pm.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Das Verfahren zur Isolierung von Ratten-Kardiomyozyten beschrieben, kann auf andere Arten, wie zB Maus 4 angepasst werden, falls erforderlich. Ein Parameter, der Anpassung muss, ist die Enzym-Mix für die Verdauung (siehe unten) und auch die Dauer der Verdauung. Seien Sie sich bewusst, dass die Zellen einiger Arten (zB Maus) könnte noch zerbrechlicher als andere (zB Ratten).

Die Wahl der Kollagenase ist wahrscheinlich der wichtigste Schritt in der Isolierung. Wir wählen Liberase Blendzyme, weil es ein synthetisches enzymatische Mix mit praktisch keine Charge zu Charge Schwankungen unterliegt. Die konventionelle Methode ist der Einsatz von so genannten rohen Kollagenase aus Clostridium histolyticum, die auch eine gültige Methode extrahiert. Allerdings erfordern von Charge zu Charge Schwankungen neue Optimierung für jede neue.

Abgesehen von der fluoreszierenden Fusionsproteine ​​und die Konzernleitung Transduktion des adenoviralen Gentransfer können auch über Expression von funktionellen Proteinen oder deren Down-Regulation (zB durch RNAi 5) verwendet werden. Dies gilt, weil Transduktionseffizienz ist hoch (> 95%) und reproduzierbar.

Subscription Required. Please recommend JoVE to your librarian.

Acknowledgments

Diese Arbeit wurde von der Deutschen Forschungsgemeinschaft (DFG) und des Bundesinstituts für Risikobewertung (BfR, Deutschland) unterstützt.

Materials

Name Company Catalog Number Comments
Anesthesia solution Serumwerk Bernburg GmbH (Ursotamin), Bayer Health Care (Rompun) Mixture of 1 ml Ursotamin (100 mg/ml Ketaminhydrochlorid) and 240 μl Rompun (2% Xylazinhydrochlorid)
Citrate solution 117,64 mg sodium citrate in 10 ml 0.9% NaCl solution
Solution A 134 mM NaCl, 4 mM KCl, 11 mM glucose, 1.2 mM MgSO4, 1.2 mM Na2HPO4, 10 mM HEPES, pH adjusted to 7.35 using 10 M NaOH, sterile filtered
Solution A+ Content of solution A plus 0.2 mM EGTA, pH adjusted to 7.35 using 10 M NaOH, sterile filtered
Liberase solution F. Hoffmann‐ La Roche Ltd. 11988476 001 500 μl stock solution in 15 ml solution A (stock solution:10 mg/ml Liberase Blendzyme 4 in aqua dest.)
Solution B Content of solution A plus 200 μM CaCl2 and 0.1% DNase solution
Solution B1/2 1:1 mixture of solution A and solution B
DNase solution Sigma-Aldrich D4527 Deoxyribonuclease I, Type 2 from bovine pancreas, 40 KU (15 mg) are dissolved in 5 ml of 10 mM Tris‐HCl buffer, adjusted to pH=7.35, additional content: 50 mM NaCl, 10 mM MgCl2, 1 mM dithi–rythritol; this solution is mixed with 5 ml glycerol
Extracellular matrix protein (ECM) solution Extracellular matrix protein (ECM) solution E1270 1 ml stock solution as purchased is diluted with 6 mLmedium M199
Culture medium M199 PAA Laboratories E15‐834 Medium M199 supplemented with 1 μl/ml ITS solution and 20 μl/ml penicillin‐streptomycin solution (5000 units/ml)
ITS solution 25 mg Insulin, 25 mg Transferrin and 50 μl Selenite stock solution are dissolved in 5 ml aqua dest. (stock solution: 0.5 mg/ml Sodiumselenite in aqua dest.). Add a few drops of 1 M HCl until one should get a clearsolution. Aliquots can be frozen.
Tyrode 135 mM NaCl, 5.4 mM KCl, 1.8 mM CaCl2, 2mM MgCl2, 10 mM glucose, 10 mM HEPES, pH adjusted to 7.35 using 10 M NaOH, sterile filtered
Master mix 5 μl 10×PCR‐Buffer, 5 μl MgCl2 (25 mM), 2 μl forward primer, 2 μl reverse primer, 1 μl dNTP´s (10 mM each), 33 μl H2O, 1 μl DMSO, 1 μl Taq‐DNA polymerase for each sample
LB‐Medium 10 g/l Tryptone, 5 g/l Yeast extract, 5 g/l NaCl (and 15 g/l Agar if used as solid medium), pH 7.0
Pac I New England Biolabs R0547L preparation: 50 μg DNA, 5 μl 10×buffer, 0.5 μl 100×BSA,0.75 μl Pac I, fill with H2O up to final volume of 50μl

DOWNLOAD MATERIALS LIST

References

  1. Kaestner, L., Ruppenthal, S., S, Molecular Imaging II. Licha, K., Lin, C. P. Vol. 7370, SPIE. Bellingham. 737008-737008 (2009).
  2. Viero, C., Kraushaar, U., Ruppenthal, S. In vivo imaging of Drosophila melanogaster pupae with mesoscopic fluorescence tomography. Cell Calcium. 43, (1), 59-59 (2008).
  3. Shorte, S. L., Frischknecht, F. Imaging Cellular and Molecular Biological Functions. Springer. Berlin Heidelberg. 289-289 (2007).
  4. Kaestner, L., Lipp, P. Optics in Life Science. Popp, J., von Bally, G. Vol. 6633, SPIE. Munich. 66330K-66330K (2007).
  5. Rinne, A., Littwitz, C., Bender, K. Adenovirus-mediated delivery of short hairpin RNA (shRNA) mediates efficient gene silencing in terminally differentiated cardiac myocytes. Methods Mol Biol. 515, 107-107 (2009).
Isolation und genetische Manipulation von Adult Herzmuskelzellen für konfokale Imaging
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Kaestner, L., Scholz, A., Hammer, K., Vecerdea, A., Ruppenthal, S., Lipp, P. Isolation and Genetic Manipulation of Adult Cardiac Myocytes for Confocal Imaging. J. Vis. Exp. (31), e1433, doi:10.3791/1433 (2009).More

Kaestner, L., Scholz, A., Hammer, K., Vecerdea, A., Ruppenthal, S., Lipp, P. Isolation and Genetic Manipulation of Adult Cardiac Myocytes for Confocal Imaging. J. Vis. Exp. (31), e1433, doi:10.3791/1433 (2009).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter