Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version


Confocal इमेजिंग के लिए वयस्क कार्डिएक Myocytes के आनुवंशिक हेरफेर अलगाव

doi: 10.3791/1433 Published: September 17, 2009


वयस्क हृदय myocytes प्राथमिक कोशिकाओं है कि जानवरों के दिल से अलग किया जा सकता है और कई दिनों के लिए सभ्य हैं. इस संस्कृति की अवधि के भीतर adenoviral जीन स्थानांतरण आनुवंशिक एन्कोडेड (GEBs) biosensors या फ्लोरोसेंट संलयन प्रोटीन को व्यक्त करने के लिए इस्तेमाल किया जा सकता है. दोनों दृष्टिकोण confocal माइक्रोस्कोपी के माध्यम से सेलुलर जांच की अनुमति देते हैं.


कार्डिएक वयस्क दिल से पृथक myocytes कहीं मॉडल भ्रूण और नवजात की मांसपेशी कोशिकाओं के एक तरफ और दूसरे पर एक काम दिल के बीच आधे रास्ते के रूप में व्यापक रूप से स्वीकार किए जाते हैं. इस प्रकार, cardiomyocytes हृदय सेलुलर फिजियोलॉजी और pathophysiology के लिए अच्छा मॉडल के रूप में सेवा करते हैं, के रूप में अच्छी तरह के रूप में ट्रांसजेनिक पशु मॉडल का अन्वेषण के लिए दवा की जांच के लिए. यहाँ हम दिल से कोशिकाओं को अलग करने की एक विधि का वर्णन. इसके अलावा हम बताएंगे कि कैसे एक ट्रांसजेनिक पशु प्रजनन के बिना हृदय myocytes पर एक आनुवंशिक हेरफेर किया जा सकता है: यह दीर्घकालिक संस्कृति के संयोजन (1 सप्ताह) और adenoviral जीन स्थानांतरण. बाद एक वायरस के निर्माण से कोशिकाओं के पारगमन के लिए वर्णित है. यह आनुवंशिक एन्कोडेड (GEBs) biosensors, फ्लोरोसेंट संलयन प्रोटीन की अभिव्यक्ति के लिए इस्तेमाल किया जा सकता है, लेकिन यह भी अभिव्यक्ति से अधिक प्रोटीन के लिए और विनियमन, जैसे आरएनएआई का उपयोग कर नीचे. यहाँ हम एक subcellular संरचना (Golgi) धुंधला हो जाना एक संलयन प्रोटीन की अभिव्यक्ति के लिए एक उदाहरण प्रदान करते हैं. इस तरह के प्रोटीन अभिव्यक्ति Z-ढेर confocal इमेजिंग द्वारा कल्पना subcellular संरचनाओं के एक-3D पुनर्निर्माण के लिए किया जा सकता है. प्रोटोकॉल सेल संस्कृति, आण्विक जीव विज्ञान और बायोफिज़िक्स में राज्य के-the-कला शामिल हैं और इस तरह सेलुलर कार्डियोलॉजी में नए क्षितिज की तलाश के लिए एक दृष्टिकोण प्रदान करता है.


or Start trial to access full content. Learn more about your institution’s access to JoVE content here

चार प्रमुख चरणों वाले प्रोटोकॉल के सभी डिजाइन में चित्र 1 में दिखाया गया है. सभी चरणों का पूर्ण विस्तार में वर्णित हैं. सेल अलगाव, पारगमन है, और संस्कृति, 24 घंटे के बारे में confocal इमेजिंग द्वारा बाद बाद एक लगातार और अनिवार्य timescale है. वायरस पुराने सेल अलगाव के आगे किया जाना चाहिए और तो आनुवंशिक पारगमन के लिए इस्तेमाल किया.

1. चूहे दिल से वयस्क हृदय myocytes के अलगाव

  1. वयस्क पुरुष Wistar वजन में लगभग 250 ग्राम (6-12 पुराने सप्ताह) चूहों 100 छ bodyweight प्रति 170 μl संज्ञाहरण समाधान की intraperitoneal इंजेक्शन द्वारा anesthetised
  2. इसके अतिरिक्त, एक साइट्रेट समाधान (2 / μl जी शरीर के वजन) सर्जरी के दौरान रक्त की जमावट से बचने के लिए अंतःक्षिप्त है.
  3. Langendorff छिड़काव सेट अप के लिए तैयार किया जाना चाहिए. सभी समाधान ऑक्सीजन के साथ संतृप्त किया जाना चाहिए.
  4. जब चूहे anesthetised है, जानवर एक सर्जरी के बोर्ड पर तय हो गई है और शरीर का ऊपरी हिस्सा 70% इथेनॉल के साथ कीटाणुरहित है.
  5. जानवर मन्या के माध्यम से काटने के द्वारा मार डाला है.
  6. छाती कैंची का उपयोग करने के लिए खोला जाता है. दिल और महाधमनी अब सुलभ किया जाना चाहिए. pericard हटा दिया है.
  7. आइस - ठंड समाधान ए + (5 एमएल) दोनों एक 26 गेज सुई का उपयोग करने के लिए हृदय की गिरफ्तारी और बाहर रक्त धोने निलय में इंजेक्शन है.
  8. महाधमनी एक क्लैंप के साथ पकड़ा है और महाधमनी चाप में छोटा सिर्फ पहला होता है शाखाओं में बंटी थे.
  9. दिल सीने से निकाल दिया जाता है और महाधमनी संदंश द्वारा छिड़काव सेट अप और एक घोड़े का अंसबंध के प्रवेशनी से जुड़ी है प्रतिगामी Langendorff के छिड़काव की अनुमति है. महाधमनी वाल्व नहीं foraminate अवगत रहें.
  10. दिल महाधमनी / प्रवेशनी चारों ओर एक संयुक्ताक्षर द्वारा तय की जरूरत है. ओपन वाहिकाओं भी ligated हो की जरूरत है.
  11. दिल retrogradely ऑक्सीजन संतृप्त लगभग 70 mbar के दबाव पर 10 मिनट के लिए कमरे के तापमान पर (23 डिग्री सेल्सियस) + समाधान के साथ perfused है. सुनिश्चित करें कि कोई हवाई बुलबुले महाधमनी में प्रवेश.
  12. 37 के एक तापमान पर छिड़काव समाधान एक Liberase समाधान के लिए बंद है डिग्री सेल्सियस एक क्रमिक वृत्तों में सिकुड़नेवाला पंप के माध्यम से 4 मिलीग्राम / मिनट की दर पर लगभग 25 मिनट के लिए. छिड़काव के अंत में दिल मरमर सफेद दिखना चाहिए. पाचन समय हालत / स्थिति ऊतक करने के लिए अनुकूलित किया जा आवश्यकता हो सकती है.
  13. दिल छिड़काव सेट से लिया है और 37 डिग्री सेल्सियस के एक के तापमान पर एक पेट्री डिश से युक्त एक समाधान में रखा शेष वाहिकाओं और atria काट रहे हैं. जहाजों और त्याग कर रहे हैं और atria - अगर जरूरत है - अलग ढंग से व्यवहार कर रहे हैं (नहीं इस प्रोटोकॉल का हिस्सा). निलय लगभग 6 टुकड़ों में विभाजित कर रहे हैं.
  14. टुकड़े एक 100 मिलीलीटर Erlenmeyer 20 मिलीलीटर समाधान 37 डिग्री सेल्सियस और एक 5 मिनट के लिए 37 डिग्री सेल्सियस पानी के स्नान में थोड़ा उत्तेजित. के तापमान पर एक युक्त कुप्पी में स्थानांतरित कर रहे हैं अंत में सतह पर तैरनेवाला खारिज कर दिया है.
  15. ऊपर वर्णित की प्रक्रिया एक या दो बार दोहराया है. सतह पर तैरनेवाला थोड़ा अपारदर्शी दिखाई देनी चाहिए.
  16. कोशिकी कैल्शियम एकाग्रता की वेतन वृद्धि 37 पर समाधान 1 / 2 बी के 20 मिलीलीटर जोड़ने ° सी कोशिकाओं और ऊतकों के समाधान का एक अवशिष्ट शेष द्वारा शुरू की है Erlenmeyer फ्लास्क में एक . यह एक अतिरिक्त 5 मिनट के लिए एक 37 डिग्री सेल्सियस पानी के स्नान में थोड़ा हिल जाता है. इसके बाद सतह पर तैरनेवाला खारिज कर दिया है.
  17. आगे 20 मिलीलीटर समाधान 1 / 2 बी जोड़ें. (समाधान सतह पर तैरनेवाला / अब व्यवहार्य कोशिकाओं को शामिल करना चाहिए.) कक्षों की एक बूंद एक औंधा सेल संस्कृति माइक्रोस्कोप पर एक पेट्री डिश को सौंप दिया है. यदि कोशिकाओं को एक उच्च सहज (संकुचन) गतिविधि एक की जरूरत के लिए प्रतीक्षा जब तक कोशिकाओं को आराम आ दिखा.
  18. एक बार फिर सतह पर तैरनेवाला खारिज कर दिया है और समाधान 1 / 2 बी के 20 मिलीलीटर जोड़ रहे हैं.
  19. इस तरह से है कि ऊतक टुकड़े आसानी से गुजारें जब खोलने के माध्यम से उत्तेजित कर सकते हैं में एक प्लास्टिक पाश्चर पिपेट की नोक से कट जाता है. लौ उपचार के तेज किनारों के साथ (पिघल) नरम हैं.
  20. अब ऊतक टुकड़े थोड़ा और धीरे triturated. ऊतक टुकड़े कोशिकाओं में चाहिए "के अलावा गिर".
  21. सतह पर तैरनेवाला युक्त कक्ष decanted है और वांछित सेल घनत्व, जो प्रयोगों के प्रकार पर निर्भर करता है है और empirically निर्धारित किया जाना चाहिए तक पहुँचने के लिए समाधान बी के साथ पतला.

2. संलयन प्रोटीन पारगमन के लिए एक adenovirus का निर्माण

Adenoviruses उत्पादन TRANSPOSE विज्ञापन के सांसद Biomedicals से adenoviral वेक्टर सिस्टम प्रयोग किया जाता है 1 . इस प्रोटोकॉल एक फ्लोरोसेंट संलयन प्रोटीन या GEB एस 2 के लिए उपलब्ध है और परीक्षण प्रविष्टि वेक्टर (pCR259) के साथ शुरू होता है.

  1. उपर्युक्त प्रारंभिक pCR259 हित के जीन युक्त वेक्टर के 10 एनजी की राशि 100 μl TRANSPOSE HighQ-1-AD ™ 294 सक्षम कोशिकाओं के साथ बदल रहा है.
  2. इस मिश्रण बर्फ पर 20 मिनट 45 s के लिए एक 42 में गर्मी झटका ° सी द्वारा पीछा किया और एक अतिरिक्त 2 मिनट के लिए बर्फ पर संग्रहीत के लिए incubated है.
  3. 900 म्यू & जोड़ें4 घंटे के लिए कोमल आंदोलन के साथ unselective LB मध्यम और 37 से बढ़ने ° सी एल .
  4. प्लेट μl 50, 100 और Chloramphenicol (सेमी, 20 μg / मिलीलीटर), एम्पीसिलीन (100 μg / एमएल), टेट्रासाइक्लिन (15 μg / मिलीलीटर), एक्स - लड़की (280 μg / मिलीलीटर के साथ लेग मध्यम युक्त प्लेटों पर 200 μl μl ) और IPTG (40 μg / एमएल). (300μg/ml के साथ और अधिक महंगा Bluo लड़की डाई का उपयोग करके एक और अधिक तीव्र और तेजी से नीले रंग धुंधला हो जाना संभव है यह विशेष रूप से इस्तेमाल किया जाना चाहिए जब तुम इतने परिचित को पहचानने और नीले / सफेद कालोनियों में भेद नहीं कर रहे हैं)
  5. 37 पर 24 घंटे के लिए आगे बढ़ें डिग्री सेल्सियस 4 में छोड़ दो डिग्री सेल्सियस जब तक नीले कालोनियों की अच्छी पहचान संभव है. जब वहाँ समस्याओं के लिए तय जो कॉलोनी वास्तव में सफेद है कालोनियों के कुछ लेने के लिए और एक और तीन एंटीबायोटिक दवाओं युक्त थाली, एक्स - लड़की और IPTG पर और दोहराने उन्हें 37 पर रात खत्म हो जाना ° सी.
    ) टिप्पणी HighQ 1 TRANSPOSE-AD ™ 294 कोशिकाओं के दो महत्वपूर्ण प्लास्मिड होते हैं: adenovirus रीढ़ (TRANSPOSE - विज्ञापन ™ 294) और एक प्लाज्मिड सहायक एक transposase है, जो अपने लक्ष्य साइटों में हित के जीन की प्रविष्टि mediates व्यक्त स्थित है, TRANSPOSE - ई. 294 की LacZ जीन प्लाज्मिड में.
  6. सकारात्मक युक्त है वायरस रीढ़ की हड्डी में ब्याज की जीन के रूप में 2.7-2.9 में वर्णित कॉलोनी पीसीआर प्रदर्शन कालोनियों की पहचान करने के लिए. वेक्टर कई क्लोनिंग साइट (आगे 5 '3 CCCAGTCACGACGTTGTAAAACG, रिवर्स 5' 3 GCGGATAACAATTTCACACAGG) flanking प्राइमरों का उपयोग करें और 100% सफेद कालोनियों के साथ एक कॉलोनी पीसीआर बनाने के लिए और जीन डाला बिना TRANSPOSE-AD 294 plasmids के लिए एक नियंत्रण के रूप में एक नीले कॉलोनी उपयोग ब्याज की. ब्लू कालोनियों आप एक छोटी पीसीआर (~ 200bp) टुकड़ा, ब्याज की अपने जीन युक्त कालोनियों एक बड़े पीसीआर उत्पाद दिखाने (अपने हित के जीन की लंबाई पर निर्भर करता है) और दो टुकड़े कई सेल कालोनियों के साथ कालोनियों दे देंगे और अलग होना चाहिए अगर आगे से इस्तेमाल किया.
  7. एक मास्टर मिश्रण नीचे दी गई सारणी के अनुसार करने के लिए तैयार रहना चाहिए.
  8. एक autoclaved दंर्तखोदनी के साथ एक एकल 100% सफेद कॉलोनी उठाओ और पहले सेमी के साथ लेग प्लेट पर इस कॉलोनी के एक को दोहराने के.
  9. पीसीआर मिश्रण में कॉलोनी स्थानांतरण. यह पीसीआर मिश्रण में 3-4 बार की तुलना में दंर्तखोदनी हटाने से पहले यह पीसीआर मिश्रण का एक बहुत सोख सकता है आवर्तन. पीसीआर प्रोटोकॉल डालने और इस्तेमाल किया पोलीमरेज़ केबी पर निर्भर करता है. प्राइमरों की annealing तापमान 57 डिग्री सेल्सियस और 35 चक्र का उपयोग की सिफारिश की है.
  10. सकारात्मक क्लोन की रात संस्कृतियों (सेमी के साथ लेग मध्यम) बढ़ो और स्पिन स्तंभों के बिना एक वाणिज्यिक उपलब्ध किट के साथ अलग plasmids, क्योंकि केन्द्रापसारक बल विशाल वायरस सदिश बाधित.
  11. 100 μl DH5α सक्षम कोशिकाओं में पृथक plasmids के 0.5 μg रूपांतरण. 30 मिनट के लिए बर्फ पर कोशिकाओं के साथ डीएनए सेते हैं. हीट झटका 45 एस 42 में डिग्री सेल्सियस और 2 मिनट के लिए बर्फ पर सेट.
  12. 900 μl unselective LB मध्यम जोड़ें और 1 घंटे के लिए डिग्री सेल्सियस कोमल आंदोलन के साथ 37 से बढ़ने.
  13. एक सेमी, एक्स - लड़की और IPTG के साथ लेग मध्यम युक्त थाली पर 50 μl प्लेट. 24 घंटे के लिए 37 डिग्री सेल्सियस पर सेते हैं.
  14. उठाओ और 20 100% सफेद कालोनियों अलग एम्पीसिलीन, टेट्रासाइक्लिन और Chloramphenicol IPTG और एक्स - लड़की युक्त प्लेटों पर को दोहराने. उन्हें 37 पर रात खत्म हो जाना डिग्री सेल्सियस कालोनियों का चयन करें जो 100% सफेद, chloramphenicol प्रतिरोधी, एम्पीसिलीन और संवेदनशील tetracyclin.
  15. कालोनी-पीसीआर (वैकल्पिक): सकारात्मक क्लोन कॉलोनी-पीसीआर के साथ फिर से परीक्षण कर सकते हैं करने के लिए जाँच करें कि वे डालने होते.
  16. एक सकारात्मक पुनः संयोजक के एक एकल कॉलोनी उठाओ और सेमी के साथ 600 मिलीलीटर लेग मध्यम में बढ़ने.
  17. एक प्लाज्मिड मैक्सी किट का उपयोग प्लाज्मिड पृथक.
  18. डाइजेस्ट पीएसी के साथ मैं 5 प्लाज्मिड के 37 में दो घंटे के लिए μg डिग्री सेल्सियस और 65 पर प्रतिक्रिया को रोकने डिग्री सेल्सियस 20 मिनट के लिए.
  19. कमरे के तापमान पर 30 मिनट के लिए 10 μl के अंतिम मात्रा करने के लिए एक SpeedVac में पूरे पचाने में या ध्यान phenol के क्लोरोफॉर्म निष्कर्षण विधि का उपयोग.
  20. जमी QBI HEK एक 37 डिग्री सेल्सियस पानी के स्नान में कोमल आंदोलन के साथ 293 कोशिकाओं की एक शीशी पहले गला लें. 70% इथेनॉल के साथ शीशी के बाहर कुल्ला और एक बाँझ हुड में aseptically आगे बढ़ना.
  21. एक बाँझ 15 मिलीलीटर ट्यूब कोशिकाओं स्थानांतरण, dropwise 10 मिलीलीटर DMEM (10% FCS) जोड़ने और कोमल आंदोलनकारी जबकि 250xg पर गोली कोशिकाओं को 10 मिनट अपकेंद्रित्र.
  22. सतह पर तैरनेवाला त्यागें. 10 मिलीलीटर DMEM (10% FCS) में धीरे से ऊपर और नीचे pipetting द्वारा गोली Resuspend.
  23. एक 75 सेमी 2 फ्लास्क में बीज और 10% FCS के साथ 10 मिलीलीटर DMEM कोशिकाओं को जोड़ने. 37 पर रात खत्म सेते ° सी में एक 5% सीओ 2 इनक्यूबेटर.
  24. अगले दिन सेल घनत्व सत्यापित करें. QBI-HEK 293 कोशिकाओं को एक 1:10 करने के लिए 1:20 के अनुपात में विभाजित किया जाना चाहिए.
  25. कोशिकाओं से मध्यम निकालें और 1-3 मिनट के लिए 2 मिलीलीटर trypsin साथ trypsinize. कोशिकाओं और 10 मिनट के लिए अपकेंद्रित्र 250xg 10 मिलीलीटर DMEM दीजिए.
  26. ध्यान से निकालें और मध्यम कोशिकाओं को 10 मिलीलीटर ताजा मध्यम दे, resuspend और कोशिकाओं गिनती.
  27. प्लेट में 5 2x10 के साथ एक छह अच्छी तरह से अच्छी तरह से एक 5, 3x10 5, 4x10, 5x10 5 और 6x10 5 कोशिकाओं. 37 पर पकवान सेते ° सीओ 2-इनक्यूबेटर में सी.
  28. अगले दिन 50% के संगम के साथ एक अच्छी तरह का उपयोग करने के लिए ध्यान केंद्रित पीएसी मैं पचाने में के साथ transfect. हम Lipofectamine 2000 अभिकर्मक के साथ अच्छा अनुभव है, लेकिन भी अन्य तरीकों (जैसे कैल्शियम फॉस्फेट अभिकर्मक के रूप में) उपयुक्त होना चाहिए.
  29. अभिकर्मक से पहले अच्छी तरह से 3-4 घंटे में मध्यम बदलें घातीय वृद्धि में प्रक्रिया के दौरान कोशिकाओं.
  30. 250 μl DMEM और सेते के साथ कमरे के तापमान पर 5 मिनट के लिए 5 μl Lipofectamine मिक्स.
  31. डीएनए के लिए Lipofectamine - मध्यम मिश्रण दीजिए (पीएसी मैं पचाने में) और ट्यूब के खिलाफ प्रतिक्रिया दोहन द्वारा मिश्रण, pipetting द्वारा मिश्रण नहीं करते. कमरे के तापमान पर मिश्रण 20 मिनट सेते हैं.
  32. कोशिकाओं को ड्रॉप अभिकर्मक मिश्रण और मिश्रण करने के लिए थाली रॉक. 37 पर 5% के साथ डिग्री सेल्सियस सीओ 2 सेते हैं . 4-5 घंटे के बाद मध्यम बदलें.
  33. अभिकर्मक के बाद दो दिनों कोशिकाओं से मध्यम ले और यह एक ताजा संस्कृति फ्लास्क (75 2 सेमी) में दे.
  34. 5 मिनट के लिए 500 μl trypsin के साथ कोशिकाओं Trypsinize. 1 मिलीलीटर DMEM दो. कोशिकाओं को, पूरे मिश्रण ले और यह डाल, संस्कृति फ्लास्क में 17 मिलीलीटर ताजा मध्यम (FCS साथ DMEM) के साथ एक साथ. 37 में कोशिकाओं खेती डिग्री सेल्सियस 5% सीओ 2 के साथ जब तक cytopathic प्रभाव (CPE) दिखाई दे रहे हैं . चित्रा 2 देखें करने के लिए सीखना कैसे CPE की तरह दिखना चाहिए.
  35. एक 50 मिलीलीटर ट्यूब के माध्यम से कोशिकाओं को इकट्ठा और -80 पर कोशिकाओं स्थिर डिग्री सेल्सियस तीन / फ्रीज पिघलना चक्र (-80 C/37 ° ° C पानी के स्नान) के साथ कोशिकाओं को तोड़ो.
  36. 8000xg और 4 में 20 मिनट अपकेंद्रित्र ° सी. एक 100mm व्यास पकवान में सतह पर तैरनेवाला छानना और गोली त्यागें. छानना सतह पर तैरनेवाला 0.45μm रोमकूप आकार के साथ एक बाँझ फिल्टर का प्रयोग करें. यह पहली वायरस शेयर (1 बीतने) है.
  37. का प्रयोग करें 1 / इस स्टॉक के 3 QBI-HEK 70% संगम के साथ 293 कोशिकाओं के साथ एक 75cm 2 फ्लास्क transduce . 37 में सेते डिग्री सेल्सियस और 5% सीओ 2 जब तक CPE दिखाई दे रहे हैं.
  38. यदि कोशिकाओं बताते हैं CPE एस उन्हें लेने और वायरस को निकालने के रूप में पहले से किया. इस वायरस के दो मार्ग है.
  39. वायरस बीतने के साथ कदम 2.37 और 2.38 दोहराएँ 2 और जब तक इतने पर वायरस के प्रवर्धन पर्याप्त वायरस स्टॉक तक पहुँचता है. वायरस विशिष्ट centrifugation ट्यूब (Amicon अल्ट्रा 15 ultracel 100 Millipore से झिल्ली के साथ केन्द्रापसारक फिल्टर यूनिट) के साथ ध्यान केंद्रित किया जा सकता है और -80 डिग्री सेल्सियस पर कई महीनों के लिए भंडारित गिनती के लिए संक्रामक कणों एक पट्टिका परख का उपयोग करें.
  40. वायरस 2 बीतने या उच्चतर का उपयोग transduce कोशिकाओं और वायरस के आगे प्रवर्धन के लिए.

3. प्राथमिक सेल संस्कृति और adenoviral पारगमन

  1. बाँझ 20 मिमी व्यास के दौर कवर फिसल जाता है मानक 12-अच्छी तरह प्लेटें में रखा जाता है.
  2. 20 μl ECM समाधान प्रत्येक कवर पर्ची पर समान रूप से वितरित किया जाता है. अवशेष खारिज कर रहे हैं. सुखाने के लिए 37 में 1 घंटे की एक न्यूनतम की अनुमति ° सी. कोटिंग द्वारा वैकल्पिक रूप से रात खत्म कर सकते हैं कमरे के तापमान पर सूखे (12 घंटे).
  3. 1 मिलीलीटर M199 मध्यम के साथ एंटीबायोटिक दवाओं और इसके शामिल की खुराक के साथ हर अच्छी तरह से भर जाता है.
  4. 200 से 400 μl के एक सेल निलंबन (1.21 कदम से) एक अच्छी तरह से जोड़ा जाता है. कोशिकाओं के संवर्धन पर होता है 37 ° सी में एक 5% सीओ 2 इनक्यूबेटर.
  5. कक्ष तलछट के लिए अनुमति दी जाती है और 1 घंटे मध्यम के बाद बदल गया है.
  6. मध्यम बदलने के तुरंत बाद वायरस युक्त समाधान (2 बीतने या अधिक से) की एक पर्याप्त राशि धीरे थाली कमाल द्वारा मिलाया जाता है.
  7. एक दीर्घकालिक मध्यम संस्कृति के मामले में हर 2 दिन बदल जाता है.
  8. अभिकर्मक GEB अभिव्यक्ति के बाद 24 घंटे detectable है.

4. 3 डी subcellular संरचनाओं के लिए confocal इमेजिंग और सीए 2 + संकेतन

Confocal इमेजिंग किसी भी confocal खुर्दबीन पर किया जा सकता है. हालांकि, कैल्शियम इमेजिंग प्रयोगों कम से कम वीडियो की दर (25-30 हर्ट्ज) के अधिग्रहण की गति की आवश्यकता होती है. यह या तो बहु बीम (जैसे Nipkow डिस्क, क्षेत्र या किलो बीम सरणी स्कैनर बह) स्कैनर या बहुत तेजी से एक बीम स्कैनर (जैसे गुंजयमान स्कैनर या acousto ऑप्टिकल (AOD झुकानेवाला) स्कैनर) के लिए प्रयोग करने योग्य प्रौद्योगिकियों प्रतिबंधित. एक सिंहावलोकन के लिए रेफरी देखें. 3. 3 डी - subcellular इमेजिंग एक z ड्राइव की आवश्यकता है. यहाँ एक किलो बीम सरणी स्कैनर (VTinfinity, VISITECH int., सुंदरलैंड, ब्रिटेन) प्रयोग किया जाता है.

  1. खुर्दबीन और परिधीय उपकरण के लिए एक ऑपरेशन मोड में सेट किया जाना चाहिए. लेजर के लिए विशेष रूप से इस अवधि के ऊपर एक वार्मिंग की आवश्यकता है जब तक एक स्थिर उत्पादन शक्ति तक पहुँच जाता है हो सकता है.
  2. कक्ष एक प्रयोगात्मक कक्ष (हस्तांतरण कवर पर्ची) को हस्तांतरित किया जा जरूरत है. coverslips कोशिकाओं के साथ एक प्रयोगात्मक कक्ष में स्थानांतरित कर रहे हैं. 1ml Tyrode समाधान (1.8 मिमी कोशिकी कैल्शियम युक्त) तो जोड़ा जाता है.
  3. प्रायोगिक कक्ष खुर्दबीन मंच पर रखा जाना चाहिए. उत्तेजना इलेक्ट्रोड, छिड़काव, सेट अप और आगे peripheral उपकरणों, जैसे तापमान नियंत्रण, के अनुसार व्यवस्थित किया जा जरूरत है.
  4. कक्ष पर ध्यान केंद्रित किया जाएगा है और सफेद प्रकाश और / या epifluorescent रोशनी का उपयोग कर चयनित.
  5. लेजर बिजली, जोखिम समय आदि या एक पूरे प्रयोग प्रोटोकॉल जैसे मापदंडों अधिग्रहण करने के लिए सेट किया जा जरूरत है.
  6. समय श्रृंखला और / या z-अनुभाग छवियों को प्राप्त किया जा सकता है.
  7. सेट अप आगे उन्नत बहुपद्वति माप (पैच - दबाना) इलेक्ट्रोफिजियोलॉजी या / और photobleach (FRAP) के बाद प्रतिदीप्ति पुनर्वितरण या दो फोटॉन photolysis सहित पदार्थों के uncaging की तरह ऑप्टिकल हेरफेर का उपयोग किया जा सकता है.
  8. छवि विश्लेषण, विशेष रूप से 3 डी पुनर्निर्माण (Bitplane एजी, ज़्यूरिख़, स्विट्जरलैंड) Imaris, वेग (कामचलाऊ व्यवस्था, कोवेन्ट्रीय, ब्रिटेन) या Arivis ब्राउज़र (arivis GmbH, Rostock, जर्मनी) के रूप में समर्पित विश्लेषण सॉफ्टवेयर पर किया जाता है.

5. प्रतिनिधि परिणाम:

प्रोटोकॉल के अंतिम परिणामों छवि दृश्यों कि आगे डेटा निकालने के लिए इस्तेमाल किया जा सकता हैं.

एक उदाहरण subcellular संरचनाओं और organelles की जांच है. चित्रा 3 3 आयामी Golgi तंत्र की व्यवस्था का उदाहरण दर्शाया गया है. इलेक्ट्रॉन माइक्रोस्कोपी के विपरीत सभी जीवित कोशिकाओं पर जांच किया जा सकता है.

चित्रा 1
चित्रा 1: प्रमुख प्रयोगात्मक कदम के सामान्य प्रवाह.

चित्रा 2
चित्रा 2: बाईं छवि 90-95% confluency के साथ क्यू HEK संस्कृति में कोशिकाओं जो नहीं transduced हैं दर्शाया गया है . वायरल पारगमन के बाद Cytopatic प्रभाव सही भाग में दिखाए जाते हैं. कक्ष दौर और प्लेट के नीचे से अलग है. इन कोशिकाओं में नाभिक सक्रिय वायरस उत्पादन का एक परिणाम के रूप में कोशिकाओं का प्रमुख हिस्सा occupies.

चित्रा 3
चित्रा 3: वयस्क चूहे हृदय एक YFP-संलयन Golgi तंत्र को लक्षित प्रोटीन के साथ ट्रांसफ़ेक्ट myocyte. Adenoviral जीन स्थानांतरण (संस्कृति में एक दिन) के बाद कार्डियक myocytes फ्लोरोसेंट संलयन प्रोटीन व्यक्त करते हैं. कक्ष एक एकल confocal एक z ढेर से लिया टुकड़ा दर्शाया गया है. पैनल बी में एक ही सेल एक सैद्धांतिक बात फैल समारोह (पीएसएफ) का उपयोग deconvolution के बाद दिखाया गया है . यह de-धुंधला छवि ढेर बाद के लिए सेल सौंपनेवाला और एक 3 डी मात्रा पुनर्निर्माण पैनल सी या एक 3D सतह पुनर्निर्माण (डी) में दिखाया के रूप में प्रयोग किया जाता है. इस बार 10 सुक्ष्ममापी का प्रतिनिधित्व करता है.

Subscription Required. Please recommend JoVE to your librarian.


or Start trial to access full content. Learn more about your institution’s access to JoVE content here

अन्य प्रजातियों, 4 माउस जैसे चूहे cardiomyocytes के अलगाव के लिए वर्णित की प्रक्रिया अनुकूलित किया जा सकता है, यदि आवश्यक हो. एक पैरामीटर है कि अनुकूलन की जरूरत है पाचन के लिए एंजाइम मिश्रण (नीचे देखें) और भी पाचन की अवधि है. पता है कि कुछ प्रजातियों (जैसे माउस) की कोशिकाओं को और अधिक दूसरों (जैसे चूहा) की तुलना में कमजोर हो सकती है.

collagenase की पसंद शायद अलगाव की प्रक्रिया में सबसे महत्वपूर्ण कदम है. हम Liberase Blendzyme चुनते हैं क्योंकि यह वस्तुतः कोई बैच बैच रूपांतरों के साथ एक सिंथेटिक एंजाइमी मिश्रण है. पारंपरिक विधि तथाकथित कच्चे क्लोस्ट्रीडियम histolyticum, जो भी एक वैध तरीका है से निकाले collagenase का उपयोग है. हालांकि, बैच बैच विविधताओं प्रत्येक नए बैच के लिए नया अनुकूलन की आवश्यकता है.

फ्लोरोसेंट संलयन प्रोटीन और GEB पारगमन के अलावा adenoviral जीन स्थानांतरण भी कार्यात्मक प्रोटीन या उनके नीचे विनियमन (5 आरएनएआई द्वारा उदाहरण के लिए) से अधिक अभिव्यक्ति के लिए इस्तेमाल किया जा सकता है. यह सच धारण क्योंकि पारगमन दक्षता उच्च (> 95%) और प्रतिलिपि प्रस्तुत करने योग्य है.

Subscription Required. Please recommend JoVE to your librarian.


यह काम जर्मन राष्ट्रीय विज्ञान फाउंडेशन (DFG) और जोखिम मूल्यांकन के लिए संघीय संस्थान (BfR, जर्मनी) द्वारा समर्थित किया गया.


Name Company Catalog Number Comments
Anesthesia solution Serumwerk Bernburg GmbH (Ursotamin), Bayer Health Care (Rompun) Mixture of 1 ml Ursotamin (100 mg/ml Ketaminhydrochlorid) and 240 μl Rompun (2% Xylazinhydrochlorid)
Citrate solution 117,64 mg sodium citrate in 10 ml 0.9% NaCl solution
Solution A 134 mM NaCl, 4 mM KCl, 11 mM glucose, 1.2 mM MgSO4, 1.2 mM Na2HPO4, 10 mM HEPES, pH adjusted to 7.35 using 10 M NaOH, sterile filtered
Solution A+ Content of solution A plus 0.2 mM EGTA, pH adjusted to 7.35 using 10 M NaOH, sterile filtered
Liberase solution F. Hoffmann‐ La Roche Ltd. 11988476 001 500 μl stock solution in 15 ml solution A (stock solution:10 mg/ml Liberase Blendzyme 4 in aqua dest.)
Solution B Content of solution A plus 200 μM CaCl2 and 0.1% DNase solution
Solution B1/2 1:1 mixture of solution A and solution B
DNase solution Sigma-Aldrich D4527 Deoxyribonuclease I, Type 2 from bovine pancreas, 40 KU (15 mg) are dissolved in 5 ml of 10 mM Tris‐HCl buffer, adjusted to pH=7.35, additional content: 50 mM NaCl, 10 mM MgCl2, 1 mM dithi–rythritol; this solution is mixed with 5 ml glycerol
Extracellular matrix protein (ECM) solution Extracellular matrix protein (ECM) solution E1270 1 ml stock solution as purchased is diluted with 6 mLmedium M199
Culture medium M199 PAA Laboratories E15‐834 Medium M199 supplemented with 1 μl/ml ITS solution and 20 μl/ml penicillin‐streptomycin solution (5000 units/ml)
ITS solution 25 mg Insulin, 25 mg Transferrin and 50 μl Selenite stock solution are dissolved in 5 ml aqua dest. (stock solution: 0.5 mg/ml Sodiumselenite in aqua dest.). Add a few drops of 1 M HCl until one should get a clearsolution. Aliquots can be frozen.
Tyrode 135 mM NaCl, 5.4 mM KCl, 1.8 mM CaCl2, 2mM MgCl2, 10 mM glucose, 10 mM HEPES, pH adjusted to 7.35 using 10 M NaOH, sterile filtered
Master mix 5 μl 10×PCR‐Buffer, 5 μl MgCl2 (25 mM), 2 μl forward primer, 2 μl reverse primer, 1 μl dNTP´s (10 mM each), 33 μl H2O, 1 μl DMSO, 1 μl Taq‐DNA polymerase for each sample
LB‐Medium 10 g/l Tryptone, 5 g/l Yeast extract, 5 g/l NaCl (and 15 g/l Agar if used as solid medium), pH 7.0
Pac I New England Biolabs R0547L preparation: 50 μg DNA, 5 μl 10×buffer, 0.5 μl 100×BSA,0.75 μl Pac I, fill with H2O up to final volume of 50μl



  1. Kaestner, L., Ruppenthal, S., S, Molecular Imaging II. Licha, K., Lin, C. P. Vol. 7370, SPIE. Bellingham. 737008-737008 (2009).
  2. Viero, C., Kraushaar, U., Ruppenthal, S. In vivo imaging of Drosophila melanogaster pupae with mesoscopic fluorescence tomography. Cell Calcium. 43, (1), 59-59 (2008).
  3. Shorte, S. L., Frischknecht, F. Imaging Cellular and Molecular Biological Functions. Springer. Berlin Heidelberg. 289-289 (2007).
  4. Kaestner, L., Lipp, P. Optics in Life Science. Popp, J., von Bally, G. Vol. 6633, SPIE. Munich. 66330K-66330K (2007).
  5. Rinne, A., Littwitz, C., Bender, K. Adenovirus-mediated delivery of short hairpin RNA (shRNA) mediates efficient gene silencing in terminally differentiated cardiac myocytes. Methods Mol Biol. 515, 107-107 (2009).
Confocal इमेजिंग के लिए वयस्क कार्डिएक Myocytes के आनुवंशिक हेरफेर अलगाव
Play Video

Cite this Article

Kaestner, L., Scholz, A., Hammer, K., Vecerdea, A., Ruppenthal, S., Lipp, P. Isolation and Genetic Manipulation of Adult Cardiac Myocytes for Confocal Imaging. J. Vis. Exp. (31), e1433, doi:10.3791/1433 (2009).More

Kaestner, L., Scholz, A., Hammer, K., Vecerdea, A., Ruppenthal, S., Lipp, P. Isolation and Genetic Manipulation of Adult Cardiac Myocytes for Confocal Imaging. J. Vis. Exp. (31), e1433, doi:10.3791/1433 (2009).

Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter