Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Biology

L'isolamento e la manipolazione genetica di adulti miociti cardiaci per confocale Imaging

doi: 10.3791/1433 Published: September 17, 2009

Summary

Adulti miociti cardiaci sono cellule primarie che possono essere isolati da cuori animali e coltivate per diversi giorni. In questo periodo la cultura trasferimento genico adenovirali possono essere usate per esprimere biosensori geneticamente codificato (GEBS) o proteine ​​di fusione fluorescenti. Entrambi gli approcci consentono indagini cellulari mediante microscopia confocale.

Abstract

Miociti cardiaci isolati da cuori adulti sono ampiamente accettate come un modello da qualche parte a metà strada tra le cellule muscolari embrionali e neonatale da un lato e un cuore lavoro, dall'altro. Così, cardiomiociti servire come buoni modelli per cardiache fisiologia e fisiopatologia cellulare, per le indagini farmaceutica e per l'esplorazione di modelli animali transgenici. Qui si descrive un metodo per isolare le cellule del cuore. Inoltre si mostra come una manipolazione genetica su miociti cardiaci possono essere eseguiti senza allevare un animale transgenico: Questa è la combinazione della cultura a lungo termine (1 settimana) e il trasferimento di geni adenovirali. Che quest'ultima sia descritto dalla costruzione del virus per la trasduzione delle cellule. Può essere utilizzato per l'espressione di biosensori geneticamente codificato (GEBS), proteine ​​di fusione fluorescenti, ma anche per le proteine ​​oltre espressione e giù per regolamento, ad esempio utilizzando RNAi. Qui abbiamo un esempio per l'espressione di una proteina di fusione colorazione una struttura subcellulare (Golgi). Espressione di tali proteine ​​possono essere visualizzate da imaging confocale di z-stack per una ricostruzione 3D di strutture subcellulari. Il protocollo comprende state-of-the-art in coltura cellulare, biologia molecolare e di biofisica e fornisce quindi un metodo per esplorare nuovi orizzonti in cardiologia cellulare.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Gli oltre ogni disegno del protocollo contenente quattro fasi principali è rappresentato in figura 1. Tutte le fasi sono descritte in dettaglio. Isolamento delle cellule, la trasduzione e la cultura, seguita da confocale circa 24 ore è poi un consecutivi e obbligatoria tempi. La costruzione del virus dovrebbe essere fatto in anticipo l'isolamento delle cellule e viene quindi utilizzato per la trasduzione genetica.

1. Isolamento dei miociti cardiaci da adulti cuore di ratto

  1. Adulto ratti maschi Wistar circa 250 g di peso (6-12 settimane di età) sono anestetizzati mediante iniezione intraperitoneale di 170 ul di soluzione anestesia per 100 g di peso corporeo
  2. Inoltre, una soluzione di citrato (2 microlitri / g di peso corporeo) viene iniettato per evitare la coagulazione del sangue durante l'intervento.
  3. Perfusione Langendorff set-up deve essere preparato. Tutte le soluzioni devono essere saturata con l'ossigeno.
  4. Quando il ratto è anestetizzati, l'animale è fissato su una tavola di chirurgia e la parte superiore del corpo è disinfettata con il 70% di etanolo.
  5. L'animale viene ucciso con il taglio della carotide.
  6. Il torace è aperto con le forbici. Il cuore e l'aorta dovrebbe essere accessibile. Il pericard viene rimosso.
  7. Ghiacciata soluzione A + (5 ml) viene iniettato in entrambi i ventricoli con una 26-gauge per arrestare il cuore e lavare via il sangue.
  8. L'aorta viene afferrato con una pinza e troncato l'arco aortico proprio sono stati i primi ramificazione si verifica.
  9. Il cuore viene rimossa dal petto e l'aorta è collegato alla cannula di perfusione set-up da pinze e un morsetto per consentire retrograda Langendorff-perfusione. Siate consapevoli di non foraminate le valvole aortica.
  10. Il cuore deve essere stabilito da una legatura attorno alla aorta / cannula. Serbatoi aperti anche bisogno di essere legato.
  11. Il cuore è retrogrado perfusi con una soluzione satura di ossigeno-A + a temperatura ambiente (23 ° C) per 10 min a una pressione di circa 70 mbar. Assicurarsi che non bolle d'aria entrare l'aorta.
  12. La soluzione di perfusione è passati a una soluzione Liberase ad una temperatura di 37 ° C per circa 25 minuti ad una velocità di 4 ml / min per mezzo di una pompa peristaltica. Al termine della perfusione del cuore dovrebbe apparire in marmo bianco. Il tempo di digestione può essere necessario adattare alla situazione / condizione dei tessuti.
  13. Il cuore è preso dalla perfusione set-up e posto in una soluzione contenente una capsula di Petri ad una temperatura di 37 ° C. Navi che restano e atri vengono tagliate. I vasi vengono scartati e gli atri - se necessario - sono trattate in modo diverso (non fa parte di questo protocollo). I ventricoli sono divisi in circa 6 pezzi.
  14. I pezzi vengono trasferiti in un pallone di Erlenmeyer da 100 ml contenente 20 ml di soluzione A ad una temperatura di 37 ° C e un po 'agitato in un bagno d'acqua a 37 ° C per 5 min. Infine, il supernatante viene scartato.
  15. La procedura sopra descritta viene ripetuta una o due volte. Il supernatante dovrebbe apparire leggermente opaco.
  16. L'incremento della concentrazione di calcio extracellulare è iniziata con l'aggiunta di 20 ml di soluzione B 1 / 2 a 37 ° C per le cellule e tessuti rimanendo un residuo di soluzione A nella beuta. Questo è un po 'scosso in un bagno d'acqua a 37 ° C per altri 5 min. Successivamente il supernatante viene scartato.
  17. Aggiungere altri 20 ml di soluzione B 1 / 2. (La soluzione surnatante / ora dovrebbe contenere cellule vitali.) Una goccia di cellule è trasferito in una capsula di Petri su un microscopio invertito colture cellulari. Se le cellule mostrano una elevata attività spontanea (contrazioni) bisogna aspettare le cellule vengono a riposo.
  18. Ancora una volta il supernatante viene scartato e 20 ml di soluzione B 1 / 2 sono aggiunti.
  19. La punta di una pipetta Pasteur di plastica è tagliata in modo tale che i pezzi di tessuto può passare facilmente quando agita attraverso l'apertura. Con il trattamento fiamma spigoli vivi sono ammorbidite (fuso).
  20. Ora i pezzi di tessuto sono leggermente e delicatamente triturato. I pezzi di tessuto dovrebbe "cadere a pezzi" nelle cellule.
  21. La cella contenente surnatante viene decantato e diluita con soluzione B per raggiungere la densità cellulare desiderato, che dipende dal tipo di esperimenti e devono essere determinati empiricamente.

2. Costruzione di un adenovirus per la trasduzione proteina di fusione

Per produrre la trasposizione adenovirus-Ad sistema vettore adenovirale da MP Biomedicals viene utilizzato 1. Questo protocollo inizia con il vettore d'ingresso disponibili e testato (pCR259) per una proteina di fusione fluorescente o GEB 2 s.

  1. Un importo di 10 ng del citato iniziale pCR259 vettore contenente il gene di interesse si trasforma con 100 ul HighQ-1 Trasposizione-AD ™ 294 cellule competenti.
  2. Questa miscela è incubata per 20 min in ghiaccio seguito da uno shock termico per 45 s a 42 ° C e conservati in ghiaccio per altri 2 minuti.
  3. Aggiungere 900 & mu; L di non selettivo LB-media e di crescere a 37 ° C con agitazione per 4 ore.
  4. Tavola 50 microlitri, 100 ul e 200 ul su piastre contenenti LB-media con cloramfenicolo (Cm, 20 mg / ml), Ampicillina (100 mg / ml), tetraciclina (15 mg / ml), X-Gal (280 mg / ml ) e IPTG (40 mg / ml). (Una colorazione più intensa e veloce blu è possibile utilizzando il colorante più costosi Bluo-Gal con 300μg/ml. Questo deve essere usato in particolare quando non sono così familiari nel riconoscere e distinguere blu / bianco colonie)
  5. Crescere per 24 ore a 37 ° C. Lasciare a 4 ° C fino a quando l'identificazione di buone colonie blu è possibile. Quando ci sono problemi per decidere quale colonia è veramente bianco raccogliere alcune delle colonie e replicare su un altro piatto che contiene i tre antibiotici, X-Gal e IPTG e lasciarli crescere durante la notte a 37 ° C.
    Nota) La HighQ-1 Trasposizione-AD ™ 294 cellule contengono due plasmidi importanti: La spina dorsale adenovirus (Transpose-Ad ™ 294) e un aiutante plasmide che esprime un trasposasi, che media l'inserimento del gene di interesse nei suoi siti bersaglio, che si trova nel gene LacZ del Transpose-AD 294 plasmide.
  6. Per identificare le colonie positivo contenente il gene di interesse nella spina dorsale virus eseguire colonia-PCR come descritto nella 2,7-2,9. Usa primer vettore che fiancheggiano il sito più clonazione (avanti 5 'CCCAGTCACGACGTTGTAAAACG 3', invertire 5 'GCGGATAACAATTTCACACAGG 3') e fare una colonia PCR con il 100% colonie bianche e utilizzare una colonia blu come controllo per la trasposizione-AD 294 plasmidi senza gene inserito di interesse. Colonie blu vi darà un breve frammento di PCR (~ 200bp), colonie contenente il gene di interesse mostrano un grande prodotto di PCR (a seconda della lunghezza del gene di interesse) e le colonie con due frammenti sono colonie di cellule multiple e devono essere separati se ulteriormente utilizzati.
  7. Secondo la tabella riportata di seguito una master mix deve essere preparato.
  8. Scegli una singola colonia 100% bianco con un stuzzicadenti in autoclave e prima una replica di questa colonia su un piatto con LB-Cm.
  9. Trasferire la colonia nelle PCR-mix. Volteggiare nella PCR-mix di 3-4 volte rispetto togliere lo stuzzicadenti prima che potesse assorbire un sacco di PCR-mix. La PCR-protocollo dipende dal kb dell'inserto e della polimerasi utilizzate. La temperatura di annealing del primer è di 57 ° C ed un utilizzo di 35 cicli è raccomandato.
  10. Crescere nel culture notte (LB-medio con Cm) dei cloni positivi e isolare i plasmidi con un kit disponibile in commercio senza colonne di rotazione, perché la forza centrifuga interrompe il vettore enorme virus.
  11. Trasforma 0,5 mcg di plasmidi isolati in 100 ul cellule DH5α competenti. Incubare le cellule con DNA in ghiaccio per 30 min. Shock termico 45 s a 42 ° C e impostare in ghiaccio per 2 minuti.
  12. Aggiungere 900 microlitri non selettivo LB-media e di crescere a 37 ° C con agitazione per 1 ora.
  13. Tavola 50 microlitri su un piatto contenente LB-media con Cm, X-Gal e IPTG. Incubare a 37 ° C per 24 ore.
  14. Raccogliere e replicare fino a 20 100 colonie% bianco separati ampicillina, tetracicline e cloramfenicolo piastre contenenti IPTG e X-Gal. Lasciateli crescere durante la notte a 37 ° C. Selezionare le colonie che sono 100% bianco, resistente cloramfenicolo, ampicillina e tetraciclina sensibile.
  15. Colony-PCR (opzionale): cloni positivi possono essere testati di nuovo con colonia-PCR per verificare che essi contengono l'inserto.
  16. Scegli una singola colonia di un ricombinante positivo e crescere in 600 ml di LB-media con Cm.
  17. Isolare il plasmide utilizzando un kit plasmide maxi.
  18. Digest 5 microgrammi di plasmide con Pac io per due ore a 37 ° C e fermare la reazione a 65 ° C per 20 min.
  19. Concentrare l'digerire tutto in una SpeedVac a temperatura ambiente per 30 minuti ad un volume finale di 10 microlitri o utilizzare un fenolo-cloroformio metodo di estrazione.
  20. Scongelare una fiala di surgelati QBI-HEK 293 cellule con agitazione in un bagno d'acqua a 37 ° C. Lavare la parte esterna del flaconcino con 70% di etanolo e procedere in modo asettico in una cappa sterile.
  21. Trasferire le cellule ad un tubo sterile 15 ml, aggiungere goccia a goccia 10 ml DMEM (+10% FCS), mentre agita dolce e centrifugare 10 min a 250xg per agglomerare le cellule.
  22. Gettare il surnatante. Risospendere il pellet in 10 ml di DMEM (+10% FCS) pipettando gentilmente su e giù.
  23. Seme in un centimetro 75 2 pallone e aggiungere 10 ml di DMEM con 10% FCS per le cellule. Incubare per una notte a 37 ° C in un 5% di CO 2 incubatore.
  24. Il giorno successivo verificare la densità cellulare. QBI HEK-293 cellule dovrebbe essere diviso in un rapporto 1:10-1:20.
  25. Rimuovere il supporto dalle cellule e trypsinize con 2 ml di tripsina per almeno 1-3. Dare 10 ml DMEM alle cellule e centrifugare a 250xg per 10 minuti.
  26. Rimuovere accuratamente il mezzo e dare 10 ml di terreno fresco per le cellule, risospendere e contare le cellule.
  27. Piastra in sei ben bene con uno 2x10 5, 3x10 5 5, 5 e 5x10 6x10 5 celle. Incubare il piatto a 37 ° C in CO 2-incubatore.
  28. Al giorno successivo utilizzare un bene con 50% di confluenza di trasfezione con il concentrato Pac io digerisco. Abbiamo una buona esperienza con Lipofectamine 2000 transfezione, ma anche altri metodi (come la transfezione fosfato di calcio) dovrebbe essere adatto.
  29. Modificare le medie h ben 3-4 prima di trasfezione per le cellule in crescita esponenziale nel corso della procedura.
  30. Mescolare 5 Lipofectamine microlitri con 250 microlitri DMEM e incubare a temperatura ambiente per 5 min.
  31. Dare il Lipofectamine-Media Miscela al DNA (Pac I digerire) e mescolare toccando contro il tubo di reazione, non mescolare pipettando. Incubare la miscela 20 minuti a temperatura ambiente.
  32. Caduta la miscela di trasfezione per le cellule e rock la piastra per mescolare. Incubare a 37 ° C con 5% di CO 2. Cambia media dopo 4-5 ore.
  33. Due giorni dopo la transfezione prendere il medium dalle cellule e dare in un pallone coltura fresca (75 cm 2).
  34. Trypsinize le cellule con 500 microlitri tripsina per un massimo di 5 minuti. 1 ml di DMEM dare alle cellule, prendere l'impasto e metterla tutta, insieme con 17 ml di mezzo fresco (DMEM con FCS) nel pallone cultura. Coltivare le cellule a 37 ° C con 5% di CO 2 fino a effetto citopatico (CPE) sono visibili. Vedere la Figura 2 per imparare come CPE dovrebbe essere simile.
  35. Raccogliere le cellule con il mezzo in un tubo da 50 ml e congelare le cellule a -80 ° C. Rompere le cellule con tre cicli gelo / disgelo (-80 ° C/37 ° C acqua bagno).
  36. Centrifugare 20 min a 8000xg e 4 ° C. Decantare il supernatante in un 100mm, diametro del disco e scartare il pellet. Utilizzare un filtro sterile con 0.45μm dimensione dei pori per filtrare il supernatante. Questo è lo stock primo virus (passaggio 1).
  37. Usare 1 / 3 di questo stock di trasdurre uno 75 centimetri 2 pallone con QBI HEK-293 cellule con il 70% confluenza. Incubare a 37 ° C e 5% di CO 2 fino a CPE s sono visibili.
  38. Se le cellule mostrano CPE s li raccolgono e estrarre il virus come fatto prima. Questo è il passaggio 2 del virus.
  39. Ripetere i passaggi 2,37 e 2,38 con il passaggio del virus 2 e così via fino a quando l'amplificazione del virus raggiunge una scorta sufficiente virus. Il virus può essere concentrato con centrifugazione tubi specifici (Amicon Ultra-15 unità centrifughe filtro con ultracel-100 da membrana Millipore) e conservati per diversi mesi a -80 ° C. Per contare le particelle infettive utilizzare un test targa.
  40. Utilizzare il passaggio del virus 2 o superiore per trasdurre cellule e per l'amplificazione del virus.

3. Colture cellulari primarie e trasduzione adenovirali

  1. Sterile scivola coperchio rotondo del diametro di 20 mm sono poste in standard di 12 pozzetti.
  2. 20 ul di soluzione ECM è ugualmente distribuiti su ciascun vetrino. Resti vengono scartati. Per l'asciugatura permettono un minimo di 1 ora a 37 ° C. In alternativa al rivestimento in grado di secca durante la notte (12 ore) a temperatura ambiente.
  3. Ogni bene è riempito con 1 ml di mezzo M199 con integratori che comprende antibiotici e ITS.
  4. Una sospensione cellulare (dal punto 1.21) tra 200 e 400 microlitri si aggiunge a ciascun pozzetto. Coltura delle cellule avviene a 37 ° C in un 5% di CO 2 incubatore.
  5. Le cellule sono autorizzati a sedimenti e dopo 1 h di media è cambiato.
  6. Immediatamente dopo aver cambiato il medium una adeguata quantità di soluzione contenente virus (passaggio da 2 o superiore) viene mescolato con delicatezza la piastra a dondolo.
  7. In caso di medio lungo termine cultura viene cambiata ogni 2 giorni.
  8. 24 ore dopo la trasfezione espressione GEB è ​​rilevabile.

4. L'imaging confocale per il 3D delle strutture subcellulari e Ca 2 + di segnalazione

Confocale può essere eseguito su qualsiasi microscopio confocale. Tuttavia, il calcio-imaging esperimenti richiedono una velocità di acquisizione di almeno il video tasso (25-30 Hz). Questo limita tecnologie utilizzabili a uno scanner a raggi multipli (es. disco Nipkow, spazzato campo o chilo-beam scanner array) o lo scanner molto veloce fascio singolo (ad esempio scanner di risonanza o deflettore acusto ottico (AOD)-scanner). Per una panoramica vedi rif. 3. Il 3D-subcellulare immagini richiede un z-drive. Ecco un chilo-fascio scanner array (VTinfinity, VisiTech Int.., Sunderland, UK) è usato.

  1. Il microscopio e periferiche deve essere impostato in una modalità di funzionamento. Soprattutto per il laser questo può richiedere un periodo di riscaldamento fino a una potenza di uscita stabile è raggiunto.
  2. Cellule devono essere trasferiti in una camera sperimentale (copertura antiscivolo di trasferimento). I coprioggetti con le cellule vengono trasferiti ad una camera sperimentale. 1 ml di soluzione Tyrode (contenente 1,8 mM di calcio extracellulare) viene poi aggiunto.
  3. La camera sperimentale ha bisogno di essere immessi sul palco microscopio. Stimolazione elettrodi, perfusione set-up e altre periphedispositivi naturali, il controllo della temperatura per esempio, devono essere organizzati di conseguenza.
  4. Le cellule saranno concentrati a e selezionati con la luce bianca e / o illuminazione epifluorescente.
  5. Parametri di acquisizione come la potenza del laser, il tempo di esposizione ecc o un protocollo intero esperimento ha bisogno di essere messa a punto.
  6. Immagini serie temporali e / o Z-sezione può essere acquisita.
  7. Sulle misurazioni di set-up più avanzata multimodale può essere fatto utilizzando elettrofisiologia (patch-clamp) e / o manipolazione ottica come redistribuzione a fluorescenza, dopo photobleach (FRAP) o uncaging di sostanze tra cui due fotolisi fotone.
  8. Analisi delle immagini, soprattutto 3D ricostruzione viene eseguita su un software di analisi dedicato, come Imaris (Bitplane AG, Zurigo, Svizzera), velocità (improvvisazione, Coventry, UK) o Browser Arivis (arivis GmbH, Rostock, Germania).

5. Rappresentante dei risultati:

I risultati finali del protocollo sono sequenze di immagini che possono essere utilizzati per estrarre ulteriori dati.

Un esempio è l'indagine delle strutture subcellulari e organelli. La Figura 3 mostra l'esempio del 3-dimensionale disposizione dell'apparato di Golgi. A differenza di microscopia elettronica tutte le indagini possono essere eseguite su cellule viventi.

Figura 1
Figura 1: flusso generale delle fasi principali sperimentale.

Figura 2
Figura 2: L'immagine a sinistra raffigura il Q-HEK cellule in coltura con il 90-95% confluenza che non sono trasdotte. Effetti Cytopatic dopo trasduzione virale sono riportati nella parte destra. Cellule rotonde e staccarsi dal fondo della piastra. In queste cellule il nucleo occupa la maggior parte delle cellule a causa della produzione di virus attivi.

Figura 3
Figura 3: ratto adulto miociti cardiaci transfettate con un YFP-proteina di fusione intese a promuovere l'apparato di Golgi. Miociti cardiaci dopo il trasferimento genico adenovirali (un giorno nella cultura) esprimono la proteina fluorescente fusione. Un pannello raffigura una sola fetta confocale preso da un z-stack. Nel pannello B stessa cella è rappresentata dopo deconvoluzione utilizzando una teorica funzione di diffusione del punto (PSF). Questa de-offuscata serie di immagini viene successivamente utilizzato per rendere il cellulare e ottenere una ricostruzione 3D del volume, come mostrato nel pannello C o una ricostruzione di superfici 3D (D). La barra rappresenta 10 micron.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

La procedura descritta per l'isolamento dei cardiomiociti di ratto può essere adattato ad altre specie, ad esempio, il mouse 4, se necessario. Un parametro che ha bisogno di adattamento è il mix di enzimi per la digestione (vedi sotto) e anche la durata della digestione. Essere consapevoli del fatto che le cellule di alcune specie (topo per esempio) potrebbe essere più fragile di altri (ad esempio, ratto).

La scelta di collagenasi è probabilmente il passo più importante nella procedura di isolamento. Abbiamo scelto Liberase Blendzyme perché è un mix di sintesi enzimatica con virtualmente nessun lotto a lotto variazioni. Il metodo convenzionale è l'uso dei cosiddetti collagenasi greggio estratto da Clostridium histolyticum, che è anche un metodo valido. Tuttavia, da lotto a lotto variazioni richiedono ottimizzazione nuovo per ogni nuovo lotto.

A parte le proteine ​​di fusione fluorescenti e la trasduzione del Direttorio del trasferimento genico adenovirali possono essere utilizzati anche per l'espressione delle proteine ​​più funzionale o la loro regolamentazione in basso (per esempio, RNAi 5). Questo è vero perché l'efficienza di trasduzione è alta (> 95%) e riproducibili.

Subscription Required. Please recommend JoVE to your librarian.

Acknowledgments

Questo lavoro è stato sostenuto dal National Science Foundation tedesco (DFG) e dall'Istituto federale per la valutazione dei rischi (BfR, Germania).

Materials

Name Company Catalog Number Comments
Anesthesia solution Serumwerk Bernburg GmbH (Ursotamin), Bayer Health Care (Rompun) Mixture of 1 ml Ursotamin (100 mg/ml Ketaminhydrochlorid) and 240 μl Rompun (2% Xylazinhydrochlorid)
Citrate solution 117,64 mg sodium citrate in 10 ml 0.9% NaCl solution
Solution A 134 mM NaCl, 4 mM KCl, 11 mM glucose, 1.2 mM MgSO4, 1.2 mM Na2HPO4, 10 mM HEPES, pH adjusted to 7.35 using 10 M NaOH, sterile filtered
Solution A+ Content of solution A plus 0.2 mM EGTA, pH adjusted to 7.35 using 10 M NaOH, sterile filtered
Liberase solution F. Hoffmann‐ La Roche Ltd. 11988476 001 500 μl stock solution in 15 ml solution A (stock solution:10 mg/ml Liberase Blendzyme 4 in aqua dest.)
Solution B Content of solution A plus 200 μM CaCl2 and 0.1% DNase solution
Solution B1/2 1:1 mixture of solution A and solution B
DNase solution Sigma-Aldrich D4527 Deoxyribonuclease I, Type 2 from bovine pancreas, 40 KU (15 mg) are dissolved in 5 ml of 10 mM Tris‐HCl buffer, adjusted to pH=7.35, additional content: 50 mM NaCl, 10 mM MgCl2, 1 mM dithi–rythritol; this solution is mixed with 5 ml glycerol
Extracellular matrix protein (ECM) solution Extracellular matrix protein (ECM) solution E1270 1 ml stock solution as purchased is diluted with 6 mLmedium M199
Culture medium M199 PAA Laboratories E15‐834 Medium M199 supplemented with 1 μl/ml ITS solution and 20 μl/ml penicillin‐streptomycin solution (5000 units/ml)
ITS solution 25 mg Insulin, 25 mg Transferrin and 50 μl Selenite stock solution are dissolved in 5 ml aqua dest. (stock solution: 0.5 mg/ml Sodiumselenite in aqua dest.). Add a few drops of 1 M HCl until one should get a clearsolution. Aliquots can be frozen.
Tyrode 135 mM NaCl, 5.4 mM KCl, 1.8 mM CaCl2, 2mM MgCl2, 10 mM glucose, 10 mM HEPES, pH adjusted to 7.35 using 10 M NaOH, sterile filtered
Master mix 5 μl 10×PCR‐Buffer, 5 μl MgCl2 (25 mM), 2 μl forward primer, 2 μl reverse primer, 1 μl dNTP´s (10 mM each), 33 μl H2O, 1 μl DMSO, 1 μl Taq‐DNA polymerase for each sample
LB‐Medium 10 g/l Tryptone, 5 g/l Yeast extract, 5 g/l NaCl (and 15 g/l Agar if used as solid medium), pH 7.0
Pac I New England Biolabs R0547L preparation: 50 μg DNA, 5 μl 10×buffer, 0.5 μl 100×BSA,0.75 μl Pac I, fill with H2O up to final volume of 50μl

DOWNLOAD MATERIALS LIST

References

  1. Kaestner, L., Ruppenthal, S., S, Molecular Imaging II. Licha, K., Lin, C. P. Vol. 7370, SPIE. Bellingham. 737008-737008 (2009).
  2. Viero, C., Kraushaar, U., Ruppenthal, S. In vivo imaging of Drosophila melanogaster pupae with mesoscopic fluorescence tomography. Cell Calcium. 43, (1), 59-59 (2008).
  3. Shorte, S. L., Frischknecht, F. Imaging Cellular and Molecular Biological Functions. Springer. Berlin Heidelberg. 289-289 (2007).
  4. Kaestner, L., Lipp, P. Optics in Life Science. Popp, J., von Bally, G. Vol. 6633, SPIE. Munich. 66330K-66330K (2007).
  5. Rinne, A., Littwitz, C., Bender, K. Adenovirus-mediated delivery of short hairpin RNA (shRNA) mediates efficient gene silencing in terminally differentiated cardiac myocytes. Methods Mol Biol. 515, 107-107 (2009).
L'isolamento e la manipolazione genetica di adulti miociti cardiaci per confocale Imaging
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Kaestner, L., Scholz, A., Hammer, K., Vecerdea, A., Ruppenthal, S., Lipp, P. Isolation and Genetic Manipulation of Adult Cardiac Myocytes for Confocal Imaging. J. Vis. Exp. (31), e1433, doi:10.3791/1433 (2009).More

Kaestner, L., Scholz, A., Hammer, K., Vecerdea, A., Ruppenthal, S., Lipp, P. Isolation and Genetic Manipulation of Adult Cardiac Myocytes for Confocal Imaging. J. Vis. Exp. (31), e1433, doi:10.3791/1433 (2009).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter