Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Biology

Isolamento e manipulação genética de adultos miócitos cardíacos for Imaging Confocal

doi: 10.3791/1433 Published: September 17, 2009

Summary

Adulto miócitos cardíacos são células primárias que podem ser isoladas de corações de animais e cultivados por vários dias. Dentro deste período a cultura de transferência de gene adenoviral podem ser usadas para expressar biossensores geneticamente codificado (GEBS) ou proteínas de fusão fluorescente. Ambas as abordagens permitem investigações celular por meio de microscopia confocal.

Abstract

Miócitos cardíacos isolados de corações adultos são amplamente aceitos como um modelo em algum lugar a meio caminho entre as células musculares embrionárias e neonatal de um lado e um coração trabalho, por outro. Assim, cardiomiócitos servir como bons modelos para a fisiologia celular cardíaca e fisiopatologia, para as investigações farmacêuticos, bem como para a exploração de modelos animais transgênicos. Aqui nós descrevemos um método de isolar as células do coração. Além disso, mostramos como uma manipulação genética em miócitos cardíacos pode ser realizada sem criação de um animal transgênico: Esta é a combinação da cultura a longo prazo (uma semana) e transferência de genes adenovirais. O último é descrito a partir da construção do vírus para a transdução das células. Ele pode ser usado para a expressão de biossensores geneticamente codificado (GEBS), proteínas de fusão fluorescentes, mas também para a proteína mais expressão e regulação, por exemplo, usando RNAi. Aqui nós fornecemos um exemplo para a expressão de uma proteína de fusão coloração de uma estrutura subcelular (Golgi). Expressão da proteína como pode ser visualizado por imagem confocal de z-pilhas para uma reconstrução 3D de estruturas celulares. O protocolo compreende o estado-da-arte em cultura de células, biologia molecular e biofísica e, portanto, oferece uma abordagem para explorar novos horizontes em cardiologia celular.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Os mais de todo o design do protocolo contendo quatro etapas principais é ilustrada na Figura 1. Todas as etapas são descritas em pormenor. Isolamento de células transdução, e da cultura, seguido por imagem confocal cerca de 24 horas depois é uma escala de tempo consecutivos e obrigatórios. A construção de vírus deve ser feito antes do isolamento de células e é então utilizado para a transdução genética.

1. Isolamento de miócitos cardíacos adultos de coração de rato

  1. Ratos Wistar machos adultos, aproximadamente 250 g de peso (6-12 semanas de idade) estão anestesiados por injeção intraperitoneal de 170 mL de solução anestesia por 100 g de peso corporal
  2. Além disso, uma solução de citrato (2 mL / g peso corporal) é injetado para evitar a coagulação do sangue durante a cirurgia.
  3. Langendorff Perfusão Set-Up deve estar preparado. Todas as soluções devem ser saturada com oxigênio.
  4. Quando o rato é anestesiados, o animal é fixado em uma placa de cirurgia e na parte superior do corpo é desinfetada com álcool 70%.
  5. O animal é morto cortando a carótida.
  6. O tórax é aberto com uma tesoura. O coração ea aorta agora deve ser acessível. O Pericard é removido.
  7. Gelada solução A + (5 ml) é injetado em ambos os ventrículos utilizando uma agulha de 26 gauge para prender o coração e lavar o sangue.
  8. A aorta é agarrado com uma pinça e truncado no arco aórtico foram apenas a ramificação ocorre pela primeira vez.
  9. O coração é removido do peito e da aorta é acoplada a uma cânula de perfusão set-up por fórceps e uma braçadeira para permitir a perfusão retrógrada Langendorff. Esteja ciente de que não foraminate as válvulas da aorta.
  10. O coração precisa ser corrigido por uma ligadura ao redor da aorta / cânula. Vasos abertos também precisa ser ligada.
  11. O coração é retrogradamente perfundidos com oxigênio saturado de solução A + à temperatura ambiente (23 ° C) por 10 min a uma pressão de cerca de 70 mbar. Verifique se não há bolhas de ar entrar na aorta.
  12. A solução de perfusão é ligado a uma solução Liberase a uma temperatura de 37 ° C por aproximadamente 25 min a uma taxa de 4 ml / min por meio de uma bomba peristáltica. No final da perfusão do coração deve olhar em mármore branco. O tempo de digestão pode ter de ser adaptados à condição situação / tecido.
  13. O coração é retirado da perfusão set-up e colocado em uma solução contendo uma placa de Petri a uma temperatura de 37 ° C. Restantes navios e átrios são cortadas. Os vasos são descartados e os átrios - se necessário - são tratados de forma diferente (não faz parte desse protocolo). Os ventrículos são divididos em cerca de 6 peças.
  14. As peças são transferidas para um Erlenmeyer de 100 ml contendo 20 ml de solução A, a uma temperatura de 37 ° C e um pouco agitada em banho-maria a 37 ° C por 5 min. Finalmente, o sobrenadante é descartado.
  15. O procedimento descrito acima é repetido uma ou duas vezes. O sobrenadante deve aparecer ligeiramente opaca.
  16. O incremento da concentração de cálcio extracelular é iniciada pela adição de 20 ml de solução B 1 / 2 a 37 ° C para as células e tecido remanescente residual de uma solução A no Erlenmeyer. Isso é um pouco abalada em um banho de água 37 ° C para um adicional de 5 min. Posteriormente, o sobrenadante é descartado.
  17. Adicionar mais 20 ml de solução B 02/01. (O sobrenadante solução / agora deve conter células viáveis.) A queda das células é transferido para uma placa de Petri em um microscópio invertido de cultura de células. Se as células apresentam uma alta atividade espontânea (contrações) é preciso esperar até que as células vêm para descansar.
  18. Mais uma vez o sobrenadante é descartado e 20 ml de solução B 02/01 são adicionados.
  19. A ponta de uma pipeta Pasteur de plástico é cortado de tal forma que as peças de tecido pode passar facilmente quando agitado pela abertura. Com o tratamento chama arestas são suavizadas (derretida).
  20. Agora as peças de tecido são ligeiramente e triturado. As peças de tecido devem "desmoronar" nas células.
  21. A célula que contém o sobrenadante é decantado e diluído com solução B para atingir a densidade de célula desejada, o que depende do tipo de experiências e deve ser determinada empiricamente.

2. Construção de um adenovírus para a transdução de proteína de fusão

Para produzir o adenovírus Transpose-Ad Sistema vetor adenoviral de Biomedicals MP é utilizado 1. Este protocolo inicia-se com o vetor de entrada disponíveis e testadas (pCR259) para uma proteína de fusão fluorescentes ou 2 s GEB.

  1. Um montante de 10 ng dos acima mencionados pCR259 vetor inicial contendo o gene de interesse é transformada com 100 l HighQ-1-AD Transpose ™ 294 células competentes.
  2. Esta mistura é incubada por 20 min no gelo seguido por um choque térmico durante 45 s em 42 ° C e armazenadas em gelo por um adicional de 2 min.
  3. Adicionar 900 & mu; L de seletivo C LB médio e crescer a 37 ° com agitação suave por 4 horas.
  4. ML placa 50, 100 ml e 200 mL em placas contendo LB médio com cloranfenicol (Cm, 20 mcg / ml), Ampicilina (100 mg / ml), tetraciclina (15 mcg / ml), X-Gal (280 mg / ml ) e IPTG (40 mcg / ml). (A coloração mais intensa e mais rápida azul é possível usando o corante mais caro Bluo-Gal com 300μg/ml. Isso deve ser usado em particular quando você não está tão familiar em reconhecer e distinguir azul / branco colônias)
  5. Crescer durante 24 horas a 37 ° C. Deixe a 4 ° C até a identificação de boas colônias azuis é possível. Quando há problemas para decidir qual é verdadeiramente colônia branca escolher algumas das colônias e replicar em outro prato contendo os três antibióticos, X-Gal e IPTG e deixá-los crescer durante a noite a 37 ° C.
    Observação) O HighQ-1-AD Transpose ™ 294 células contêm dois plasmídeos importantes: A espinha dorsal adenovírus (Transposição-Ad ™ 294) e um ajudante plasmídeo expressando uma transposase, que media a inserção do gene de interesse em sites de seu alvo, localizado no gene LacZ dos 294 Transpose-AD plasmídeo.
  6. Para identificar as colônias positivas contendo o gene de interesse em realizar a espinha dorsal do vírus colônia-PCR, conforme descrito no 2,7-2,9. Use primers do vetor que flanqueiam o sítio múltiplo de clonagem (forward 5 'CCCAGTCACGACGTTGTAAAACG 3', inverta 5 'GCGGATAACAATTTCACACAGG 3') e fazer uma colônia PCR com 100% de colônias brancas e usar uma colônia de azul como um controle para plasmídeos 294 Transpose-AD sem gene inserido de interesse. Colônias azuis lhe dará um fragmento de PCR de curta duração (~ 200bp), colônias contendo o gene de interesse mostrar um produto PCR de grande porte (dependendo do comprimento de seu gene de interesse) e as colônias com dois fragmentos são colônias de células múltiplas e têm de ser separados se ainda mais utilizado.
  7. Acordo com a tabela abaixo de um mix mestre precisa ser preparado.
  8. Escolha uma colônia de 100% só branca com um palito de dentes autoclavados e primeiro fazer uma replica dessa colônia em uma placa de LB com Cm.
  9. Transferência da colônia para a PCR-mix. Twirl-lo no PCR-mix 3-4 vezes do que retire o palito antes que pudesse absorver um monte de PCR-mix. A PCR-protocolo depende do kb da inserção e da polimerase usada. A temperatura de anelamento dos primers é de 57 ° C e um uso de 35 ciclos é recomendado.
  10. Crescer ao longo culturas noite (LB médio com Cm) dos clones positivos e isolar os plasmídeos com um kit comercial disponível sem colunas de rotação, porque a força centrífuga perturba o vetor do vírus enorme.
  11. Transformar a 0,5 mg de plasmídeos isolados em 100 l DH5α células competentes. Incubar DNA com as células no gelo por 30 min. De choque térmico 45 s a 42 ° C e definir em gelo por 2 min.
  12. Adicionar 900 mL seletivo LB médio e crescer a 37 ° C com agitação suave durante 1 hora.
  13. Placa de 50 ul em uma placa contendo LB médio com Cm, X-Gal e IPTG. Incubar a 37 ° C por 24 horas.
  14. Escolha e replicar até 20% de 100 colônias brancas em separado Ampicilina, Tetraciclina e cloranfenicol placas contendo IPTG e X-Gal. Deixá-los crescer durante a noite a 37 ° C. Selecionar as colônias que são 100% branco, cloranfenicol resistente, ampicilina e tetraciclina sensíveis.
  15. Colônia-PCR (opcional): clones positivos podem ser testados novamente com colônia-PCR para verificar se eles contêm a inserção.
  16. Escolha uma única colônia de um recombinante positiva e crescer em 600 ml de LB médio com Cm.
  17. Isolar o plasmídeo usando um kit maxi plasmídeo.
  18. Digest mg 5 de plasmídeo com Pac I por duas horas a 37 ° C e parar a reacção a 65 ° C por 20 min.
  19. Concentrar a digerir toda em um SpeedVac em temperatura ambiente por 30 min para um volume final de 10 ml ou usar um método de extração fenol-clorofórmio.
  20. Descongelar um frasco de congelados QBI-HEK 293 células com agitação suave em um banho de água 37 ° C. Lavar o exterior do frasco com etanol 70% e proceder de forma asséptica em uma capa estéril.
  21. Transferência de células para um tubo estéril ml 15, adicionar gota a gota 10 ml DMEM (+10% FCS), enquanto agitar suave e centrifugar 10 min a 250xg para agregar as células.
  22. Elimine o sobrenadante. Ressuspender o sedimento em 10 ml DMEM (+10% FCS) suavemente pipetando para cima e para baixo.
  23. Semente em um frasco de 75 cm 2 e adicione 10 ml DMEM com SFB 10% para as células. Incubar durante uma noite a 37 ° C em 5% incubadora de CO 2.
  24. No dia seguinte, verificar a densidade das células. QBI-HEK 293 células devem ser divididas na proporção 1:10 - 01:20.
  25. Remova o meio das células e trypsinize com 2 ml de tripsina para min 1-3. Dê 10 ml DMEM para as células e centrifugar a 250xg por 10 min.
  26. Retire cuidadosamente a médio e dar 10 ml de meio fresco para as células, ressuspender e contagem das células.
  27. Placa em um de seis, bem, bem com 2x10 5, 3x10 5 5, 5x10 5 e 6x10 5 células. Incubar o prato a 37 ° C em uma incubadora de CO 2.
  28. No dia seguinte, use um poço com confluência de 50% a transfecção com o concentrado Pac eu digerir. Temos uma boa experiência com transfecção 2000 Lipofectamine, mas também outros métodos (tais como a transfecção de fosfato de cálcio) deve ser adequado.
  29. Mudar o meio em 3-4 h bem antes de transfecção para obter as células em crescimento exponencial durante o procedimento.
  30. Misturar 5 Lipofectamine mL com 250 mL DMEM e incubar em temperatura ambiente por 5 min.
  31. Dar a Mistura Lipofectamine-Medium ao DNA (Pac I digest) e misturar batendo contra o tubo de reação, não misturando por pipetagem. Incubar a mistura de 20 min em temperatura ambiente.
  32. Queda da mistura de transfecção para as células e rock a placa para misturar. Incubar a 37 ° C com 5% de CO 2. Alterar meio após 4-5 horas.
  33. Dois dias depois de tomar o meio de transfecção das células e dá-lo em uma garrafa de cultura fresco (75 cm 2).
  34. Trypsinize as células com 500 mL de tripsina para até 5 min. Dê 1 ml DMEM para as células, ter toda a mistura e coloque-o, juntamente com 17 ml de meio fresco (DMEM com FCS) para o balão cultura. Cultivar as células a 37 ° C com 5% de CO 2 até efeito citopático (CPE) são visíveis. Veja a Figura 2 para aprender CPE deve ser parecida.
  35. Coletar as células com o meio em um tubo de 50 ml e congelar as células a -80 ° C. Quebrar as células com três congelamento / descongelamento (-80 ° C/37 · Banho de água C).
  36. Centrifugar 20 minutos a 8000xg e 4 ° C. Decantar o sobrenadante em um prato 100 milímetros de diâmetro e descartar o pellet. Use um filtro estéril com poros de 0,45 filtrado o sobrenadante. Este é o primeiro vírus de ações (passagem 1).
  37. Use 1 / 3 deste estoque para transduzir um balão 2 75 centímetros com células HEK-293 QBI com confluência de 70%. Incubar a 37 ° C e 5% de CO 2 até CPE s são visíveis.
  38. Se as células mostram CPE s coletá-los e extrair o vírus como feito antes. Esta é a passagem 2 do vírus.
  39. Repita os passos de 2,37 e 2,38 com a passagem do vírus 2 e assim por diante até a amplificação do vírus atinge um estoque suficiente de vírus. O vírus pode ser concentrado, com tubos de centrifugação específicas (Amicon Ultra-15 unidade centrífuga filtro com ultracel-100 a partir de membrana Millipore) e armazenado por vários meses a -80 ° C. Para contar as partículas infecciosas use um ensaio de placa.
  40. Use a passagem do vírus 2 ou superior a transdução de células e para a amplificação do vírus.

3. Cultura de células primárias e transdução adenoviral

  1. Estéril lamínulas redondas de 20 mm de diâmetro são colocados no padrão de 12-lamelas.
  2. 20 mL de solução ECM é distribuída igualmente em cada lamínula. Restos são descartados. Para secagem de permitir um mínimo de 1 hora a 37 ° C. Em alternativa, o revestimento pode por secas durante a noite (12 h) em temperatura ambiente.
  3. Cada poço é preenchido com 1 ml Médio M199 com suplementos compreendendo antibióticos e ITS.
  4. A suspensão de células (do passo 1.21) de 200 a 400 mL é adicionado a cada poço. Cultivo das células ocorre a 37 ° C em 5% incubadora de CO 2.
  5. Células estão autorizados a sedimentos e após 1 h médio é alterada.
  6. Imediatamente depois de mudar o meio de uma quantidade adequada de solução contendo o vírus (de passagem 2 ou superior) é misturado-o suavemente a placa.
  7. No caso de um meio de cultura de longo prazo é trocada a cada 2 dias.
  8. 24 horas após transfecção expressão GEB é detectável.

4. Imagem confocal para 3D estruturas subcelulares e Ca 2 + Sinalização

Imagem confocal pode ser feita em qualquer microscópio confocal. No entanto, o cálcio imagem experimentos requerem uma velocidade de aquisição de pelo menos a taxa de vídeo (25-30 Hz). Isto restringe tecnologias utilizáveis ​​para qualquer scanners de feixe multi (por exemplo disco de Nipkow, varreu campo ou kilo-feixe scanner array) ou o scanner de feixe único muito rápidas (scanner de ressonância por exemplo, ou acústico óptico deflector (AOD), scanner). Para uma visão geral ver ref. 3. A imagem 3D-subcelulares requer um z-drive. Aqui, um scanner série kilo-feixe (VTinfinity, VisiTech Int., Sunderland, Reino Unido) é usado.

  1. O microscópio e equipamento periférico deve ser definido em um modo de operação. Especialmente para o laser isso pode exigir um período de aquecimento até uma potência de saída estável é alcançado.
  2. Células precisam ser transferidos para uma câmara experimental (tampa de deslizamento de transferência). As lamelas com células são transferidas para uma câmara experimental. 1mL solução Tyrode (contendo 1,8 mM de cálcio extracelular) é então adicionado.
  3. A câmara experimental precisa ser colocado no palco microscópio. Eletrodos de estimulação, a perfusão set-up e ainda mais periféricaral dispositivos, controle de temperatura, por exemplo, precisam ser organizados em conformidade.
  4. Células será focada em e selecionado usando luz branca e / ou iluminação de epifluorescência.
  5. Parâmetros de aquisição, tais como potência do laser, etc tempo de exposição ou um protocolo de experimento inteiro precisa ser set-up.
  6. Imagens de séries temporais e / ou Z-seção podem ser adquiridos.
  7. Nas medições set-up mais avançada multimodo pode ser feito usando eletrofisiologia (patch-clamp) e / ou manipulação ópticos como a redistribuição de fluorescência após photobleach (FRAP) ou uncaging de substâncias, incluindo dois fotólise fóton.
  8. Análise de imagem, especialmente a reconstrução 3D é realizada no software de análise dedicada, como Imaris (Bitplane AG, Zürich, Suíça), velocidade (Improvisação, Coventry, Reino Unido) ou Navegador Arivis (arivis GmbH, Rostock, Alemanha).

5. Resultados representativos:

Os resultados finais do protocolo são as seqüências de imagens que podem ser usadas para extrair mais dados.

Um exemplo é a investigação de estruturas celulares e organelas. A Figura 3 mostra o exemplo da disposição 3-dimensional do aparelho de Golgi. Em contraste com microscopia eletrônica de todas as investigações podem ser realizadas em células vivas.

Figura 1
Figura 1: Fluxo Geral dos principais passos experimentais.

Figura 2
Figura 2: A imagem da esquerda mostra as células HEK-Q, em cultura, com confluência de 90-95% que não são transduzidas. Efeitos citopático após a transdução viral são mostradas na parte direita. Células redondas e retire-se do fundo da placa. Nessas células o núcleo ocupa a maior parte das células como resultado de produção de vírus ativo.

Figura 3
Figura 3: miócito cardíaco de ratos adultos transfectadas com uma proteína de fusão YFP-targeting o aparelho de Golgi. Miócitos cardíacos após a transferência de genes adenovirais (um dia na cultura) expressar a proteína de fusão fluorescente. Um painel retrata uma única fatia confocal tirada de um z-stack. No painel B da mesma célula é descrita após deconvolução utilizando uma função de dispersão teórica ponto (PSF). Esta pilha de imagem borrada-se posteriormente usado para processar o celular e obter uma reconstrução volume 3D, como mostrado no painel de C ou uma reconstrução da superfície 3D (D). A barra representa 10 mM.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

O procedimento descrito para o isolamento de cardiomiócitos de rato pode ser adaptado para outras espécies, por exemplo, mouse 4, se necessário. Um parâmetro que as necessidades de adaptação é a mistura de enzimas para a digestão (veja abaixo) e também a duração da digestão. Estar ciente de que as células de algumas espécies (rato, por exemplo) pode ser mais frágil do que os outros (rato, por exemplo).

A escolha da colagenase é provavelmente o passo mais importante no processo de isolamento. Nós escolhemos Liberase Blendzyme porque é uma mistura sintética enzimática praticamente sem variações de lote para lote. O método convencional é o uso dos chamados colagenase bruto extraído de Clostridium histolyticum, que também é um método válido. No entanto, lote a lote variações requerem otimização novo para cada novo lote.

Para além das proteínas de fusão fluorescentes ea transdução GEB a transferência de genes adenovirais também pode ser usado para a expressão de proteínas mais funcional ou sua regulação para baixo (por exemplo, por RNAi 5). Isto é verdadeiro porque a eficiência de transdução é alta (> 95%) e reprodutível.

Subscription Required. Please recommend JoVE to your librarian.

Acknowledgments

Este trabalho foi financiado pelo alemão National Science Foundation (DFG) e pelo Instituto Federal de Avaliação dos Riscos (BfR, Alemanha).

Materials

Name Company Catalog Number Comments
Anesthesia solution Serumwerk Bernburg GmbH (Ursotamin), Bayer Health Care (Rompun) Mixture of 1 ml Ursotamin (100 mg/ml Ketaminhydrochlorid) and 240 μl Rompun (2% Xylazinhydrochlorid)
Citrate solution 117,64 mg sodium citrate in 10 ml 0.9% NaCl solution
Solution A 134 mM NaCl, 4 mM KCl, 11 mM glucose, 1.2 mM MgSO4, 1.2 mM Na2HPO4, 10 mM HEPES, pH adjusted to 7.35 using 10 M NaOH, sterile filtered
Solution A+ Content of solution A plus 0.2 mM EGTA, pH adjusted to 7.35 using 10 M NaOH, sterile filtered
Liberase solution F. Hoffmann‐ La Roche Ltd. 11988476 001 500 μl stock solution in 15 ml solution A (stock solution:10 mg/ml Liberase Blendzyme 4 in aqua dest.)
Solution B Content of solution A plus 200 μM CaCl2 and 0.1% DNase solution
Solution B1/2 1:1 mixture of solution A and solution B
DNase solution Sigma-Aldrich D4527 Deoxyribonuclease I, Type 2 from bovine pancreas, 40 KU (15 mg) are dissolved in 5 ml of 10 mM Tris‐HCl buffer, adjusted to pH=7.35, additional content: 50 mM NaCl, 10 mM MgCl2, 1 mM dithi–rythritol; this solution is mixed with 5 ml glycerol
Extracellular matrix protein (ECM) solution Extracellular matrix protein (ECM) solution E1270 1 ml stock solution as purchased is diluted with 6 mLmedium M199
Culture medium M199 PAA Laboratories E15‐834 Medium M199 supplemented with 1 μl/ml ITS solution and 20 μl/ml penicillin‐streptomycin solution (5000 units/ml)
ITS solution 25 mg Insulin, 25 mg Transferrin and 50 μl Selenite stock solution are dissolved in 5 ml aqua dest. (stock solution: 0.5 mg/ml Sodiumselenite in aqua dest.). Add a few drops of 1 M HCl until one should get a clearsolution. Aliquots can be frozen.
Tyrode 135 mM NaCl, 5.4 mM KCl, 1.8 mM CaCl2, 2mM MgCl2, 10 mM glucose, 10 mM HEPES, pH adjusted to 7.35 using 10 M NaOH, sterile filtered
Master mix 5 μl 10×PCR‐Buffer, 5 μl MgCl2 (25 mM), 2 μl forward primer, 2 μl reverse primer, 1 μl dNTP´s (10 mM each), 33 μl H2O, 1 μl DMSO, 1 μl Taq‐DNA polymerase for each sample
LB‐Medium 10 g/l Tryptone, 5 g/l Yeast extract, 5 g/l NaCl (and 15 g/l Agar if used as solid medium), pH 7.0
Pac I New England Biolabs R0547L preparation: 50 μg DNA, 5 μl 10×buffer, 0.5 μl 100×BSA,0.75 μl Pac I, fill with H2O up to final volume of 50μl

DOWNLOAD MATERIALS LIST

References

  1. Kaestner, L., Ruppenthal, S., S, Molecular Imaging II. Licha, K., Lin, C. P. Vol. 7370, SPIE. Bellingham. 737008-737008 (2009).
  2. Viero, C., Kraushaar, U., Ruppenthal, S. In vivo imaging of Drosophila melanogaster pupae with mesoscopic fluorescence tomography. Cell Calcium. 43, (1), 59-59 (2008).
  3. Shorte, S. L., Frischknecht, F. Imaging Cellular and Molecular Biological Functions. Springer. Berlin Heidelberg. 289-289 (2007).
  4. Kaestner, L., Lipp, P. Optics in Life Science. Popp, J., von Bally, G. Vol. 6633, SPIE. Munich. 66330K-66330K (2007).
  5. Rinne, A., Littwitz, C., Bender, K. Adenovirus-mediated delivery of short hairpin RNA (shRNA) mediates efficient gene silencing in terminally differentiated cardiac myocytes. Methods Mol Biol. 515, 107-107 (2009).
Isolamento e manipulação genética de adultos miócitos cardíacos for Imaging Confocal
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Kaestner, L., Scholz, A., Hammer, K., Vecerdea, A., Ruppenthal, S., Lipp, P. Isolation and Genetic Manipulation of Adult Cardiac Myocytes for Confocal Imaging. J. Vis. Exp. (31), e1433, doi:10.3791/1433 (2009).More

Kaestner, L., Scholz, A., Hammer, K., Vecerdea, A., Ruppenthal, S., Lipp, P. Isolation and Genetic Manipulation of Adult Cardiac Myocytes for Confocal Imaging. J. Vis. Exp. (31), e1433, doi:10.3791/1433 (2009).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter