Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Biology

Выделение и генетических манипуляций взрослых кардиомиоцитов для конфокальной микроскопии

doi: 10.3791/1433 Published: September 17, 2009

Summary

Взрослых кардиомиоцитов являются первичные клетки, которые могут быть изолированы от животного сердца и культивировали в течение нескольких дней. В рамках этой культуры периода аденовирусных перенос генов могут быть использованы для выражения генетически закодированы биосенсоров (GEBs) или флуоресцентные белки слияния. Оба подхода позволяют сотовой исследования с помощью конфокальной микроскопии.

Abstract

Кардиомиоцитов изолированных от взрослых сердца широкое признание в качестве модели где-то на полпути между эмбриональной и неонатальной мышечные клетки с одной стороны и работающем сердце, с другой. Таким образом, кардиомиоцитах служат хорошими моделями для сердечной клеточной физиологии и патофизиологии, для фармацевтических исследований, а также для исследования трансгенных животных моделях. Здесь мы опишем метод выделения клеток из сердца. Кроме того, мы покажем, как генетические манипуляции на кардиомиоциты могут быть выполнены без разведения трансгенных животных: Это сочетание длинных культуры срок (1 неделя) и аденовирусных переноса генов. Последняя описывается от строительства вируса трансдукции клеток. Она может быть использована для выражения генетически закодированы биосенсоров (GEBs), флуоресцентные белки слияния, но и для белка за выражение и вниз регулирования, например, с помощью РНК-интерференции. Здесь мы приведем пример для выражения гибридный белок окрашивания субклеточные структуры (АГ). Такой экспрессии белка могут быть визуализированы с помощью конфокальной визуализации Z-стеки для 3D-реконструкция субклеточных структур. Протокол включает в себя состоянии дел в культуре клеток, молекулярной биологии и биофизики и таким образом обеспечивает подход для изучения новых горизонтов в сотовых кардиологии.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

За весь дизайн протокол, содержащий четыре основных этапа изображен на рисунке 1. Все шаги описаны во всех подробностях. Сотовые изоляции, трансдукции и культуры, а затем конфокальной микроскопии около 24 часов представляет собой последовательное и обязательное сроки. Вирус строительство должно быть сделано заранее изолятор, а затем используется для генетической трансдукция.

1. Выделение взрослых кардиомиоцитов из сердца крысы

  1. Взрослых самцов крыс линии Вистар примерно 250 г в весе (6-12 недель) являются anesthetised на введении препарата в 170 мкл раствора анестезии на 100 г веса
  2. Кроме того, цитрата (2 мкл / г веса тела) вводится, чтобы избежать свертывания крови во время операции.
  3. Langendorff перфузии Set-Up должны быть подготовлены. Все решения должны быть насыщена кислородом.
  4. Когда крыса anesthetised, животного фиксируется на доске и хирургии верхней части тела дезинфицируют 70% этанола.
  5. Животное убили, проходящем через сонной артерии.
  6. Грудная клетка открывается с помощью ножниц. Сердце и аорте должно быть доступным. Pericard удаляется.
  7. Ice-холодный раствор + (5 мл) вводят в обоих желудочках использованием 26-иглы для ареста сердца и промыть крови.
  8. Аорта схватил с зажимом и оборвать на дуги аорты просто были первыми ветвление.
  9. Сердце удаляется из груди и аорты прилагается к канюли из перфузии настройки по щипцов и зажим, чтобы ретроградный Langendorff-перфузии. Имейте в виду, чтобы не foraminate аортального клапанов.
  10. Сердце должно быть исправлено лигатуры вокруг аорты / канюли. Открытые суда также должны быть перевязаны.
  11. Сердце ретроградно озарен кислородом насыщенный раствор + при комнатной температуре (23 ° C) в течение 10 мин при давлении примерно 70 мбар. Убедитесь, что нет воздушных пузырей ввести аорты.
  12. Перфузии решение переключается на Liberase раствора при температуре 37 ° C в течение примерно 25 мин со скоростью 4 мл / мин с помощью перистальтического насоса. В конце перфузии сердце должно выглядеть мраморными белыми. Пищеварения время, возможно, придется адаптироваться к ситуации / ткани состоянии.
  13. Сердце взят из перфузии настройки и помещен в чашку Петри с раствором при температуре 37 ° C. Остальные суда и предсердия обрезаются. Судов отбрасываются и предсердия - при необходимости - трактуются по-разному (не входит в этот протокол). Желудочки разделены на примерно 6 штук.
  14. Части переданы в 100 мл колбу Эрленмейера, содержащую 20 мл раствора при температуре 37 ° С и слегка взволнован в 37 ° С на водяной бане 5 мин. Наконец супернатант отбрасывается.
  15. Описанная выше процедура повторяется несколько раз. Супернатант должен появиться чуть непрозрачным.
  16. Приращение концентрация ионов кальция инициируют добавлением 20 мл раствора B 1 / 2 на 37 ° C в клетки и ткани Остальные остаточного раствора в колбу. Это немного потрясен в 37 ° С водяной бане в течение еще 5 мин. Впоследствии супернатант отбрасывается.
  17. Добавить еще 20 мл раствора B 1 / 2. (Решение / супернатант должен содержать жизнеспособных клеток.) ​​Капля клетки передается в чашку Петри на инвертированный микроскоп культуры клеток. Если клетки показывают высокую спонтанную активность (сокращений) нужно ждать, пока клетки приходят, чтобы отдохнуть.
  18. Еще раз супернатант отбрасывается и 20 мл раствора В 1 / 2, добавил.
  19. Кончик пластиковой пипетки Пастера отрезана таким образом, что ткань произведения могут пройти легко, когда взволнованный через отверстие. С пламенем лечения острые края размягчаются (топленое).
  20. Теперь ткани куски слегка и осторожно растирают. Ткань части должны "развалиться" в клетки.
  21. Ячейку, содержащую надосадочную сливают и разбавляют раствор B для достижения желаемой плотности клеток, которая зависит от типа экспериментов и должна быть определена опытным путем.

2. Строительство аденовирус для синтеза белков трансдукции

Для получения аденовирусы Transpose-Ad Аденовирусные векторной системы от Biomedicals MP используется 1. Этот протокол начинается с доступных и проверенных вступления вектор (pCR259) для флуоресцентного белка слияния или GEB с 2.

  1. Размере 10 нг выше начальной pCR259 вектора, содержащего ген интереса трансформируется со 100 мкл-1 HighQ Transpose-AD ™ 294 компетентных клеток.
  2. Эту смесь выдерживают в течение 20 мин на льду следует теплового шока в течение 45 с при 42 ° С и хранят на льду в течение еще 2 мин.
  3. Добавить 900-му; Л неизбирательного LB-средой и расти при температуре 37 ° С при легком помешивании в течение 4 часов.
  4. Пластина 50 мкл, 100 мкл и 200 мкл на пластинах содержащих LB-среде с хлорамфениколом (См, 20 мкг / мл), ампициллин (100 мкг / мл), тетрациклину (15 мкг / мл), X-Gal (280 мкг / мл ) и IPTG (40 мкг / мл). (Более интенсивным и быстрее синего окрашивания можно, используя более дорогие красителя Bluo-Гал с 300μg/ml. Это должно быть использовано, в частности, когда вы не так хорошо знакомы в признании и отличительный синий / белый колоний)
  5. Вырасти в течение 24 часов при температуре 37 ° C. Оставить при 4 ° С до хорошей идентификации голубые колонии возможно. Когда Есть проблемы решить, какой колонии действительно белый забрать некоторые из колоний и репликации на другую пластину, содержащую трех антибиотиков, X-Gal и IPTG, и пусть они растут в течение ночи при температуре 37 ° C.
    Замечание) HighQ-1 Transpose-AD ™ 294 клетки содержат два важных плазмид: аденовирус позвоночника (Transpose-Ad ™ 294) и помощник плазмиды выражения транспозазы, которая выступает посредником вставка гена в свои сайты цели, находящейся в гене LacZ из Transpose-AD 294 плазмиды.
  6. Чтобы определить положительные колонии, содержащие ген интереса к вирусу позвоночник выполняют колонии-PCR, как описано в 2.7-2.9. Использование вектора грунтовки фланговые сайт множественного клонирования (вперед 5 'CCCAGTCACGACGTTGTAAAACG 3', обратный 5 'GCGGATAACAATTTCACACAGG 3') и сделать ПЦР колонии со 100%-белые колонии и использовать одну синий колонии в качестве контроля за Transpose-AD 294 плазмид без встроенного гена интересов. Синие колонии даст вам краткий фрагмент ПЦР (~ 200bp), колонии содержащий ген проявляют интерес большого продукта ПЦР (в зависимости от длины вашего интересующего гена) и колонии с двумя фрагментами несколько колоний клеток и должны быть отделены если в дальнейшем использоваться.
  7. Согласно таблице ниже мастера смесь должна быть подготовлена.
  8. Выберите один 100% белый колонии автоклавного зубочистку и сначала повторить этой колонии на LB-пластина с Ст.
  9. Передача колонию в ПЦР-смеси. Twirl его в ПЦР-смеси 3-4 раза, чем удалить зубочисткой прежде чем она сможет впитать много ПЦР-смеси. ПЦР-протокола зависит от кб вставлять и использовать полимеразы. Температуры отжига праймеров составляет 57 ° С, а использование 35 циклов рекомендуется.
  10. Вырасти за ночь культур (LB-среде с см) положительных клонов и изолировать плазмиды с коммерческой доступны комплект без спина колонны, потому что центробежная сила срывает огромный вектор вируса.
  11. Преобразование 0,5 мкг изолированных плазмид в 100 мкл DH5α компетентных клеток. Инкубируйте ДНК с клетками на льду в течение 30 мин. Теплового шока 45 с при 42 ° С и установить на льду в течение 2 мин.
  12. Добавить 900 мкл неизбирательного LB-средой и расти при температуре 37 ° С при легком помешивании в течение 1 часа.
  13. Пластина 50 мкл на пластину, содержащую LB-среде с Cm, X-Gal и IPTG. Инкубировать при 37 ° С в течение 24 часов.
  14. Пика и повторить до 20 100% белые колонии на отдельных ампициллин, тетрациклин и хлорамфеникол чашки, содержащие IPTG и Х-Гал. Пусть они растут в течение ночи при температуре 37 ° C. Выберите колонии, которые на 100% белый, устойчивы хлорамфеникол, ампициллин и тетрациклином чувствительны.
  15. Колония-PCR (необязательно): положительные клоны могут быть проверены снова колонии-ПЦР и проверить, что они содержат вставки.
  16. Выберите одну колонию положительные рекомбинантных и расти в 600 мл LB-среде с Ст.
  17. Изолировать плазмиды использованием плазмиды комплект макси.
  18. Дайджест 5 мкг плазмиды с Pac я в течение двух часов при температуре 37 ° С и остановить реакцию при 65 ° С в течение 20 мин.
  19. Концентрат целом дайджеста в SpeedVac при комнатной температуре в течение 30 мин до конечного объема 10 мкл или использовать фенол-хлороформ экстракции.
  20. Оттепель флакон замороженных QBi-HEK 293 клеток с нежным агитации в 37 ° С водяной бане. Промыть вне флакон с 70% этанола и приступить асептически в стерильные капотом.
  21. Передача клетки стерильные 15 мл трубки, добавляют по каплям 10 мл DMEM (+10% FCS), в то время как нежный агитацию и центрифуги 10 мин при 250xg для осаждения клеток.
  22. Удалите супернатант. Ресуспендируют гранул в 10 мл DMEM (+10% FCS), осторожно пипетирования вверх и вниз.
  23. Семенной в 75 см 2 колбу и добавляют 10 мл DMEM с 10% FCS к клеткам. Выдержите в течение ночи при температуре 37 ° С в 5% СО 2 инкубатора.
  24. На следующий день проверить плотность клеток. QBi-HEK 293 клетки должны быть разделены на 1:10 до 1:20 отношение.
  25. Удаление среды из клеток и trypsinize с 2 мл трипсина в течение 1-3 мин. Дайте 10 мл DMEM в клетки и центрифуге при 250xg течение 10 мин.
  26. Удалить тщательно средних и дают 10 мл свежей среды для клеток, ресуспендирования и считать клетки.
  27. Пластина в шесть и одна скважина с 2x10 5, 3х10 5 5, 5x10 6x10 5 и 5 клеток. Инкубируйте блюдо при температуре 37 ° С в СО 2-инкубаторе.
  28. На следующий день использовать также с 50% слияния для трансфекции с концентрированным Pac я переварить. У нас есть хороший опыт работы с Lipofectamine 2000 трансфекции, но и другими методами (такими как кальций фосфат трансфекции) должны быть подходящими.
  29. Изменение средней и 3-4 ч до трансфекции, чтобы получить клетки в экспоненциальный рост во время процедуры.
  30. Смешайте 5 мкл Lipofectamine с 250 мкл DMEM и инкубировать при комнатной температуре в течение 5 мин.
  31. Дайте Lipofectamine-Medium смеси ДНК (Pac я дайджест) и перемешать, нажав на реакционную трубку, не смешивания с помощью пипетки. Выдержите смесь 20 мин при комнатной температуре.
  32. Оставьте смесь для трансфекции клеток и рок пластинка перемешать. Инкубировать при 37 ° C с 5% CO 2. Изменение среде после 4-5 часов.
  33. Через два дня после трансфекции принять среды от клеток и отдать его в свежем колбу культуры (75 см 2).
  34. Trypsinize клеток с 500 мкл трипсина на срок до 5 мин. Дайте 1 мл DMEM в клетки, возьмите всю смесь и поместить его вместе с 17 мл свежей среды (DMEM с ФТС) в культуре колбу. Развивайте клетки при 37 ° C с 5% CO 2, пока цитопатический эффект (ЦПЭ) видны. На рисунке 2, чтобы узнать, как CPE должно выглядеть.
  35. Сбор клетки со средой, в 50 мл трубку и заморозить клетки при температуре -80 ° C. Перерыв клетки с тремя циклов замораживания / оттаивания (-80 ° С/37 ° С водяной бане).
  36. Центрифуга 20 мин при 8000xg и 4 ° C. Декантируйте супернатант в 100 мм диаметром блюдо и отбросить гранул. Используйте стерильный фильтр с размером пор 0.45μm для фильтрата супернатант. Это первая акция вируса (проход 1).
  37. Используйте 1 / 3 от этой акции для трансдукции 75см 2 колбу с QBi-HEK 293 ячеек с 70% слияния. Инкубировать при 37 ° С и 5% CO 2 до CPE с видны.
  38. Если клетки показывают, CPE с собирать их и извлекать вирусов как делал раньше. Это отрывок 2 вируса.
  39. Повторите шаги 2,37 и 2,38 с вирусом прохождения 2 и так далее, пока усиление вирусов достигает достаточный запас вируса. Вирус может быть сконцентрированы с конкретными труб центрифугирования (Amicon Ультра-15 центробежный фильтр с ultracel-100 мембрану из Millipore) и сохраняется в течение нескольких месяцев при температуре -80 ° C. Для подсчета инфекционных частиц использовать доску анализа.
  40. Используйте вирус проход 2 или выше для трансдукции клеток и для дальнейшего усиления вируса.

3. Первичные культуры клеток и аденовирусной трансдукции

  1. Стерильные круглый скользит крышка диаметром 20 мм размещаются в стандартных 12-луночных планшетах.
  2. 20 мкл раствора ECM равномерно распределяется по каждой покровным стеклом. Останки, отбрасываются. Для сушки следует выдержать минимум 1 час при температуре 37 ° C. Кроме покрытия может по сухой в течение ночи (12 ч) при комнатной температуре.
  3. Каждая скважина заполняется 1 мл Средний M199 с приложениями включает антибиотики и ITS.
  4. Клеточной суспензии (с шагом 1,21) от 200 до 400 мкл в каждую лунку добавляют. Культивирование клеток происходит при температуре 37 ° С в 5% СО 2 инкубатора.
  5. Клетки имеют право осадка и через 1 ч среда изменилась.
  6. Сразу же после изменения среды достаточное количество раствора, содержащего вирус (от прохождения 2 или выше) смешивают осторожно покачайте его тарелку.
  7. В случае долгого культуральной среде термин меняется каждые 2 дня.
  8. 24 часа после трансфекции выражение GEB может быть обнаружено.

4. Конфокальной микроскопии для 3D субклеточных структур и Са 2 + сигнализации

Конфокальной микроскопии может быть выполнена на любом конфокальной микроскопии. Тем не менее, кальций-изображений эксперименты требуют приобретения скорости не менее видео, частоту (25-30 Гц). Это ограничивает используемым технологиям либо нескольких сканеров пучка (например, диск Нипкова, прокатилась поле или килограмм-лучевой массив сканера) или очень быстро один луч сканера (например, резонансный сканер или акусто оптический дефлектор (AOD)-сканер). Для обзора см.. 3. 3D-визуализация субклеточных требует Z-Drive. Здесь килограмм-лучевой массив сканера (VTinfinity, VisiTech Int., Сандерленд, Великобритания) не используется.

  1. Микроскопа и периферийное оборудование должно быть установлено в рабочий режим. Специально для лазерных это может потребовать разогрева период до стабильного мощность будет достигнута.
  2. Клетки должны быть переданы в экспериментальной камере (покровное стекло передачи). Покровные стекла с клетками передаются экспериментальной камере. 1 мл Tyrode раствора (содержащего 1,8 мМ внеклеточного кальция) будет добавлена.
  3. Экспериментальной камере должен быть помещен на столик микроскопа. Стимуляция электродов, перфузии настройку и дальнейшее peripheRAL устройств, например, контроль температуры, должны быть организованы соответственно.
  4. Клетки будут сосредоточены на и выбрать с помощью белого света и / или epifluorescent освещения.
  5. Приобретение таким параметрам, как мощность лазера, и т.д. время экспозиции или весь протокол эксперимента должна быть настройки.
  6. Временных рядов и / или Z-раздел изображения могут быть приобретены.
  7. На настройку дальнейшее развитие многомодовых измерений можно сделать с помощью электрофизиологии (патч-зажим) и / или оптическое манипулирование как флуоресценции после перераспределения photobleach (FRAP) или uncaging веществ, в том числе два фотолиза фотона.
  8. Анализ изображений, особенно в 3D-реконструкция осуществляется на специализированное программное обеспечение анализа, таких как Imaris (Bitplane AG, Цюрих, Швейцария), скорость (импровизация, Ковентри, Великобритания) или Arivis браузер (arivis GmbH, Росток, Германия).

5. Представитель Результаты:

Окончательные итоги протокола последовательности изображений, которые могут быть использованы для извлечения дополнительных данных.

Примером может служить исследование субклеточных структур и органелл. На рисунке 3 изображен пример 3-мерного расположение аппарата Гольджи. В отличие от электронной микроскопии все расследования может быть выполнено на живых клетках.

Рисунок 1
Рисунок 1: Общий поток основных экспериментальных шагов.

Рисунок 2
Рисунок 2: левое изображение изображает Q-HEK клеток в культуре с 90-95% слияния, которые не трансдуцированных. Cytopatic эффектов после вирусной трансдукции показаны в правой части. Клетки круглые и оторваться от нижней части пластины. В этих клетках ядра занимает большую часть клетки, в результате активного производства вируса.

Рисунок 3
Рисунок 3: взрослых крыс сердечных миоцитов трансфицированных YFP-синтез белка ориентации аппарата Гольджи. Кардиомиоцитов после аденовирусных переноса генов (один день в культуре) выражают флуоресцентного белка слияния. Группа изображает одну конфокальной ломтик взят из Z-Stack. В панели В той же ячейке изображен после деконволюции использованием теоретической функции рассеяния точки (PSF). Это де-размытое изображение стек впоследствии используется для визуализации клеток и получить 3D-реконструкции объем, как показано на панели C или 3D реконструкции поверхности (D). Бар составляет 10 мкм.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Процедуре, описанной для выделения кардиомиоцитов крысы могут быть адаптированы для других видов, например, мыши 4, если это необходимо. Параметром, который необходимо адаптации фермент смесь для пищеварения (см. ниже), а также продолжительность пищеварения. Имейте в виду, что клетки некоторых видов (например, мыши) может быть более хрупкой, чем другие (например, крысы).

Выбор коллагеназы, пожалуй, самый важный шаг в изоляции процедуры. Мы выбираем Liberase Blendzyme, потому что это синтетический ферментативных смесь практически без партии к партии вариаций. Обычный метод заключается в использовании так называемого сырого коллагеназы извлечены из Clostridium histolyticum, который также является действительным методом. Тем не менее, от партии к партии вариации требуют новых оптимизации для каждой новой партии.

Помимо флуоресцентных белков слияния и трансдукции GEB аденовирусных перенос генов может быть также использован для более выражение функциональных белков или их вниз регулирования (например, РНК-интерференции 5). Это справедливо, потому трансдукции эффективность высокая (> 95%) и воспроизводимыми.

Subscription Required. Please recommend JoVE to your librarian.

Acknowledgments

Работа выполнена при поддержке Немецкого Национального научного фонда (DFG) и Федерального института оценки рисков (BfR, Германия).

Materials

Name Company Catalog Number Comments
Anesthesia solution Serumwerk Bernburg GmbH (Ursotamin), Bayer Health Care (Rompun) Mixture of 1 ml Ursotamin (100 mg/ml Ketaminhydrochlorid) and 240 μl Rompun (2% Xylazinhydrochlorid)
Citrate solution 117,64 mg sodium citrate in 10 ml 0.9% NaCl solution
Solution A 134 mM NaCl, 4 mM KCl, 11 mM glucose, 1.2 mM MgSO4, 1.2 mM Na2HPO4, 10 mM HEPES, pH adjusted to 7.35 using 10 M NaOH, sterile filtered
Solution A+ Content of solution A plus 0.2 mM EGTA, pH adjusted to 7.35 using 10 M NaOH, sterile filtered
Liberase solution F. Hoffmann‐ La Roche Ltd. 11988476 001 500 μl stock solution in 15 ml solution A (stock solution:10 mg/ml Liberase Blendzyme 4 in aqua dest.)
Solution B Content of solution A plus 200 μM CaCl2 and 0.1% DNase solution
Solution B1/2 1:1 mixture of solution A and solution B
DNase solution Sigma-Aldrich D4527 Deoxyribonuclease I, Type 2 from bovine pancreas, 40 KU (15 mg) are dissolved in 5 ml of 10 mM Tris‐HCl buffer, adjusted to pH=7.35, additional content: 50 mM NaCl, 10 mM MgCl2, 1 mM dithi–rythritol; this solution is mixed with 5 ml glycerol
Extracellular matrix protein (ECM) solution Extracellular matrix protein (ECM) solution E1270 1 ml stock solution as purchased is diluted with 6 mLmedium M199
Culture medium M199 PAA Laboratories E15‐834 Medium M199 supplemented with 1 μl/ml ITS solution and 20 μl/ml penicillin‐streptomycin solution (5000 units/ml)
ITS solution 25 mg Insulin, 25 mg Transferrin and 50 μl Selenite stock solution are dissolved in 5 ml aqua dest. (stock solution: 0.5 mg/ml Sodiumselenite in aqua dest.). Add a few drops of 1 M HCl until one should get a clearsolution. Aliquots can be frozen.
Tyrode 135 mM NaCl, 5.4 mM KCl, 1.8 mM CaCl2, 2mM MgCl2, 10 mM glucose, 10 mM HEPES, pH adjusted to 7.35 using 10 M NaOH, sterile filtered
Master mix 5 μl 10×PCR‐Buffer, 5 μl MgCl2 (25 mM), 2 μl forward primer, 2 μl reverse primer, 1 μl dNTP´s (10 mM each), 33 μl H2O, 1 μl DMSO, 1 μl Taq‐DNA polymerase for each sample
LB‐Medium 10 g/l Tryptone, 5 g/l Yeast extract, 5 g/l NaCl (and 15 g/l Agar if used as solid medium), pH 7.0
Pac I New England Biolabs R0547L preparation: 50 μg DNA, 5 μl 10×buffer, 0.5 μl 100×BSA,0.75 μl Pac I, fill with H2O up to final volume of 50μl

DOWNLOAD MATERIALS LIST

References

  1. Kaestner, L., Ruppenthal, S., S, Molecular Imaging II. Licha, K., Lin, C. P. Vol. 7370, SPIE. Bellingham. 737008-737008 (2009).
  2. Viero, C., Kraushaar, U., Ruppenthal, S. In vivo imaging of Drosophila melanogaster pupae with mesoscopic fluorescence tomography. Cell Calcium. 43, (1), 59-59 (2008).
  3. Shorte, S. L., Frischknecht, F. Imaging Cellular and Molecular Biological Functions. Springer. Berlin Heidelberg. 289-289 (2007).
  4. Kaestner, L., Lipp, P. Optics in Life Science. Popp, J., von Bally, G. Vol. 6633, SPIE. Munich. 66330K-66330K (2007).
  5. Rinne, A., Littwitz, C., Bender, K. Adenovirus-mediated delivery of short hairpin RNA (shRNA) mediates efficient gene silencing in terminally differentiated cardiac myocytes. Methods Mol Biol. 515, 107-107 (2009).
Выделение и генетических манипуляций взрослых кардиомиоцитов для конфокальной микроскопии
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Kaestner, L., Scholz, A., Hammer, K., Vecerdea, A., Ruppenthal, S., Lipp, P. Isolation and Genetic Manipulation of Adult Cardiac Myocytes for Confocal Imaging. J. Vis. Exp. (31), e1433, doi:10.3791/1433 (2009).More

Kaestner, L., Scholz, A., Hammer, K., Vecerdea, A., Ruppenthal, S., Lipp, P. Isolation and Genetic Manipulation of Adult Cardiac Myocytes for Confocal Imaging. J. Vis. Exp. (31), e1433, doi:10.3791/1433 (2009).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter