Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Biology

El aislamiento y la manipulación genética de los miocitos cardiacos adultos de microscopía confocal

doi: 10.3791/1433 Published: September 17, 2009

Summary

Adultos miocitos cardíacos son las células primarias que pueden ser aisladas de corazones de animales y se cultivan durante varios días. Dentro de este período de la cultura de transferencia génica adenoviral pueden ser utilizadas para expresar biosensores genéticamente codificados (GEBS) o proteínas fluorescentes de fusión. Ambos enfoques permiten investigaciones celulares por medio de microscopía confocal.

Abstract

Miocitos cardíacos aislados de corazones de adultos son ampliamente aceptados como un modelo en algún lugar a medio camino entre las células musculares embrionarias y neonatal en un lado y un corazón de trabajo por el otro. Por lo tanto, los cardiomiocitos servir como buenos modelos para la fisiología y la fisiopatología celular cardiaca, para la investigación farmacéutica, así como para la exploración de modelos de animales transgénicos. A continuación se describe un método para aislar las células del corazón. Además se muestra como una manipulación genética en los miocitos cardíacos se pueden realizar sin la cría de un animal transgénico: Esta es la combinación de la cultura a largo plazo (1 semana) y la transferencia de genes adenovirales. Este último es descrito por la construcción de los virus de la transducción de las células. Puede ser utilizado para la expresión de los biosensores genéticamente codificados (GEBS), las proteínas fluorescentes de fusión, sino también para las proteínas sobre la expresión y regulación a la baja, por ejemplo, utilizando RNAi. Aquí tenemos un ejemplo de la expresión de una proteína de fusión de tinción de una estructura subcelular (Golgi). Como expresión de la proteína puede ser visualizado por la imagen confocal de z-pilas para una reconstrucción en 3D de estructuras subcelulares. El protocolo comprende el estado de la técnica en el cultivo celular, biología molecular y biofísica, y por lo tanto proporciona un método para explorar nuevos horizontes en cardiología celular.

Protocol

Los más de todo el diseño del protocolo que contiene cuatro pasos principales se muestra en la Figura 1. Todos los pasos se describen con todo detalle. Aislamiento celular, la transducción y la cultura, seguido de imagen confocal de aproximadamente 24 horas más tarde, es una escala de tiempo consecutivos y obligatorios. La construcción del virus se debe hacer antes del aislamiento de células y se utiliza para la transducción genética.

1. Aislamiento de los adultos miocitos cardíacos de corazón de rata

  1. Adultos ratas Wistar macho de aproximadamente 250 g de peso (6-12 semanas de edad) son anestesiados por inyección intraperitoneal de 170 l solución de anestesia por cada 100 g de peso corporal
  2. Además, una solución de citrato (2 l / g de peso corporal) se inyecta para evitar la coagulación de la sangre durante la cirugía.
  3. La perfusión Langendorff de configuración debe estar preparado. Todas las soluciones deben ser saturada con oxígeno.
  4. Cuando la rata es anestesiado, el animal se fija en un tablero de la cirugía y la parte superior del cuerpo se desinfecta con alcohol al 70%.
  5. El animal es asesinado por el corte a través de la carótida.
  6. El tórax se abre con unas tijeras. El corazón y la aorta ahora debe ser accesible. El Pericard se retira.
  7. Helado de la solución A + (5 ml) se inyecta en ambos ventrículos con una aguja de calibre 26 para parar el corazón y limpiarla de sangre.
  8. La aorta es agarrado con una abrazadera y trunca en el arco aórtico sólo se produce la primera ramificación.
  9. El corazón se retira del pecho y la aorta está conectada a la cánula de perfusión puesta en marcha de unas pinzas y una pinza para permitir retrógrada Langendorff-perfusión. Tenga en cuenta que no cribadas las válvulas aórticas.
  10. El corazón tiene que ser fijado por una ligadura alrededor de la aorta / cánula. Recipientes abiertos también deben ser ligados.
  11. El corazón es retrógrada perfundidos con solución saturada de oxígeno A + a temperatura ambiente (23 ° C) durante 10 minutos a una presión de aproximadamente 70 mbar. Asegúrese de que no queden burbujas de aire entre la aorta.
  12. La solución de perfusión se conecta a una solución Liberase a una temperatura de 37 ° C durante aproximadamente 25 minutos a una velocidad de 4 ml / min por medio de una bomba peristáltica. Al final de la perfusión del corazón debería ser de mármol blanco. El tiempo de digestión puede ser necesario adaptar a la condición de situación / tejido.
  13. El corazón es tomado de la perfusión de puesta a punto y se colocan en una solución que contiene una placa de Petri a una temperatura de 37 ° C. Buques restantes y las aurículas se cortan. Los vasos se descartan y las aurículas - si es necesario - se tratan de manera diferente (no forma parte de este protocolo). Los ventrículos están divididos en aproximadamente 6 piezas.
  14. Las piezas se introducen en un matraz Erlenmeyer de 100 ml que contienen 20 ml de solución A a una temperatura de 37 ° C y un poco nervioso en un baño de agua 37 ° C durante 5 min. Por último, el sobrenadante se descarta.
  15. El procedimiento descrito anteriormente se repite una o dos veces. El sobrenadante debe aparecer ligeramente opaca.
  16. El incremento de la concentración de calcio extracelular se inicia mediante la adición de 20 ml de solución B 1 / 2 a 37 ° C a las células y el tejido restante un residuo de la solución A en el erlenmeyer. Esto es un poco agitado en un baño de agua 37 ° C durante 5 min. Posteriormente se desecha el sobrenadante.
  17. Añadir otros 20 ml de solución B 1 / 2. (La solución sobrenadante / ahora debe contener células viables.) Una disminución de las células se transfieren a una placa de Petri en un microscopio invertido de cultivo celular. Si las células muestran una alta actividad espontánea (contracciones) uno tiene que esperar hasta que las células se detienen.
  18. Una vez más, se desecha el sobrenadante y 20 ml de solución B 1 / 2 se añade.
  19. La punta de una pipeta de plástico Pasteur se corta de tal manera que las piezas de tejido puede pasar fácilmente cuando se agita a través de la apertura. Con el tratamiento de la llama aristas se suavizan (derretida).
  20. Ahora las piezas de tejido son un poco más y se trituró con suavidad. Las piezas de tejido deben "desmoronarse" a las células.
  21. La celda que contiene sobrenadante se decanta y se diluye con la solución B para llegar a la densidad celular deseada, que depende del tipo de experimentos y debe ser determinada empíricamente.

2. Construcción de un adenovirus para la transducción de la proteína de fusión

Para producir el sistema de transposición adenovirus Ad-vector adenoviral de MP Biomedicals se utiliza 1. Este protocolo se inicia con el vector de entrada disponibles y probadas (pCR259) para una proteína de fusión fluorescentes o 2 s GEB.

  1. Una cantidad de 10 ng de la mencionada inicial pCR259 vector que contiene el gen de interés se transforma con 100 l HighQ-1-AD transposición ™ 294 células competentes.
  2. Esta mezcla se incuba durante 20 min en hielo seguido de un choque de calor durante 45 s en 42 ° C y almacenadas en hielo durante 2 min.
  3. Añadir 900 y mu; L del selectivo LB-medio y crecer a 37 ° C con agitación suave durante 4 horas.
  4. Placa de 50 l, 100 l 200 l, y en placas con LB-medio con cloranfenicol (Cm, 20 mg / ml), ampicilina (100 ug / ml), tetraciclina (15 mg / ml), X-Gal (280 ug / ml ) y IPTG (40 pg / ml). (A coloración más intensa y azul más rápido es posible mediante el uso de los más caros tinte Bluo-Gal con 300μg/ml. Esto se debe utilizar, en particular cuando no son tan familiares para reconocer y distinguir azul / blanco colonias)
  5. Crecer durante 24 horas a 37 ° C. Deja a 4 ° C hasta que una buena identificación de las colonias de color azul es posible. Cuando hay problemas para decidir qué colonia es verdaderamente blanco recoger algunas de las colonias y se replican en otra placa que contiene los tres antibióticos, X-Gal y IPTG y dejarlos crecer durante la noche a 37 ° C.
    Nota) El HighQ-1-AD transposición ™ 294 células contienen dos plásmidos importante: La columna vertebral de adenovirus (Ad-Transponer ™ 294) y un plásmido auxiliar que expresa una transposasa, que media la inserción del gen de interés en sus sitios de destino, que se encuentra en el gen LacZ transposición de las 294-AD plásmido.
  6. Para identificar las colonias de positivo que contiene el gen de interés en la columna vertebral virus realizar colonia-PCR como se describe en 2.7 a 2.9. El uso de vectores primers que flanquean el sitio de clonación múltiple (forward 5 'CCCAGTCACGACGTTGTAAAACG 3', invertir 5 'GCGGATAACAATTTCACACAGG 3') y hacer una colonia de PCR con las colonias 100% blanco y el uso de una colonia azul como un control de transposición-AD 294 plásmidos sin gen insertado de interés. Colonias de color azul le dará un breve fragmento de la PCR (~ 200bp), las colonias que contienen el gen de interés muestran un gran producto de la PCR (en función de la duración de su gen de interés) y en las colonias con dos fragmentos son múltiples colonias de células y tienen que ser separados si más utilizado.
  7. De acuerdo con la tabla a continuación una mezcla maestra tiene que estar preparado.
  8. Elija una sola colonia de 100% blanco con un palillo de dientes en autoclave y primero hacer una réplica de esta colonia en una placa LB-con Cm.
  9. Transferencia de la colonia en la PCR-mix. Girar en el PCR-mix 3-4 veces a quitar el palillo antes de que pudiera absorber una gran parte de la PCR-mix. La PCR-protocolo depende de la kb de la inserción y la polimerasa utilizada. La temperatura de hibridación de los cebadores es de 57 ° C y un uso de 35 ciclos se recomienda.
  10. Crecer en cultivos de noche (LB-medio con Cm) de los clones positivos y aislar los plásmidos con un kit comercial disponible sin columnas de centrifugado, porque la fuerza centrífuga rompe el vector del virus enorme.
  11. Transformar 0,5 g de los plásmidos aislados en 100 l células competentes DH5a. Incubar el ADN con las células en hielo durante 30 min. De choque térmico 45 s a 42 ° C y establecer en hielo durante 2 min.
  12. Añadir 900 l selectivo LB-medio y crecer a 37 ° C con agitación suave durante 1 hora.
  13. Placa 50 l de una placa que contiene LB-medio con Cm, X-Gal y IPTG. Se incuba a 37 ° C durante 24 horas.
  14. Seleccionar y reproducir hasta 20% de 100 colonias blancas en distintos ampicilina, tetraciclina y cloranfenicol placas que contienen IPTG y X-Gal. Vamos a crecer durante la noche a 37 ° C. Seleccione las colonias que son 100% blanco, resistente a cloranfenicol, ampicilina y tetraciclina sensibles.
  15. Colonia-PCR (opcional): los clones positivos se puede probar de nuevo con las colonias de PCR para comprobar que contiene el inserto.
  16. Elija una sola colonia de un positivo recombinante y crecer en 600 ml de LB-medio con Cm.
  17. Aislar el plásmido con un kit de maxi plásmido.
  18. Digest 5 ug de plásmido con Pac I durante dos horas a 37 ° C y detener la reacción a 65 ° C durante 20 min.
  19. Concentrar el resumen en un conjunto SpeedVac a temperatura ambiente durante 30 minutos a un volumen final de 10 l, o utilizar un método de extracción con fenol-cloroformo.
  20. Descongelar un vial de congelados QBI-HEK 293 células agitando suavemente en un baño de agua a 37 ° C. Enjuague el exterior de la cubeta con 70% de etanol y proceder en forma aséptica en una campana estéril.
  21. La transferencia de células a un tubo estéril de 15 ml, añadir gota a gota 10 ml de DMEM (+10% FCS) mientras se agita suavemente y centrifugar 10 minutos a 250xg para precipitar las células.
  22. Desechar el sobrenadante. Resuspender el precipitado en 10 ml de DMEM (+10% FCS) pipeteando suavemente hacia arriba y hacia abajo.
  23. Semilla en un frasco de 75 cm 2 y añadir 10 ml de DMEM con FCS al 10% de las células. Incubar durante la noche a 37 ° C en un 5% de CO 2 incubadora.
  24. Al día siguiente, comprobar la densidad de las células. QBI-HEK 293 células debería ser dividido en una proporción de 1:10 a 1:20.
  25. Eliminar el medio de las células y trypsinize con 2 ml de tripsina de 1-3 min. Dar 10 ml de DMEM a las células y se centrifuga a 250xg durante 10 minutos.
  26. Retire con cuidado el medio y dar 10 ml de medio fresco a las células, y el recuento de volver a suspender las células.
  27. Placa en una de seis y así con 2x10 5, 3x10 5 5, 5x10 5 y 6x10 5 células. Incubar la placa a 37 ° C en una incubadora de CO 2.
  28. Al día siguiente, el uso de un pozo con un 50% de confluencia para transfectar con el concentrado digerir Pac I. Tenemos buena experiencia con Lipofectamine 2000 transfección, pero también otros métodos (como la transfección de fosfato de calcio) debe ser adecuada.
  29. Cambiar el medio en el h y 3-4 antes de la transfección para obtener las células en crecimiento exponencial durante el procedimiento.
  30. Mezclar 5 Lipofectamine l con 250 l DMEM y se incuban a temperatura ambiente durante 5 min.
  31. Dar a la mezcla de Lipofectamine medianas en el ADN (Pac I digerir) y mezclar golpeando contra el tubo de reacción, no se mezcla con la pipeta. Incubar la mezcla 20 min a temperatura ambiente.
  32. La caída de la mezcla de transfección a las células y la roca de la placa para mezclar. Se incuba a 37 ° C con 5% de CO 2. Cambio medio después de 4-5 horas.
  33. Dos días después de la transfección tomar el medio de las células y dan en un frasco de cultivo fresco (75 cm 2).
  34. Trypsinize las células con 500 l de tripsina durante 5 min. Déle 1 ml DMEM a las células, tome toda la mezcla y lo puso, junto con 17 ml de medio fresco (DMEM con FCS) en el frasco de cultivo. Cultivar las células a 37 ° C con 5% de CO 2 hasta que los efectos citopáticos (CPE) son visibles. Ver Figura 2 para saber cómo CPE debe ser similar.
  35. Recoger las células con el medio en un tubo de 50 ml y congelar las células a -80 ° C. Romper las células con tres ciclos descongelación / congelación (-80 º C/37 · Baño de agua C).
  36. Centrifugar 20 minutos a 8000xg y 4 ° C. Decantar el sobrenadante en un plato de 100 mm de diámetro y desechar el sedimento. El uso de un filtro estéril con un tamaño de poro de 0.45μm filtrado el sobrenadante. Este es el primer virus de valores (paso 1).
  37. Use 1 / 3 de esta población para la transducción de un matraz con 75 cm 2 QBI-células HEK 293 con 70% de confluencia. Se incuba a 37 ° C y 5% de CO 2 hasta el CPE s son visibles.
  38. Si las células muestran CPE s que recoger y extraer el virus como se ha hecho antes. Este es el paso 2 del virus.
  39. Repita los pasos 2,37 y 2,38 con el paso del virus 2 y así sucesivamente hasta que la amplificación de los virus llega a un stock de virus suficiente. El virus se puede concentrar con tubos de centrifugación específico (Amicon Ultra-15 con unidad de filtro centrífugo Ultracel-100 de membrana de Millipore) y se almacena durante varios meses a -80 ° C. Para contar las partículas infecciosas utilizar una placa de ensayo.
  40. Utilice el paso del virus 2 o superior para la transducción de las células y para la amplificación del virus.

3. Cultivo de células primarias y transducción adenoviral

  1. Estéril cubreobjetos ronda de 20 mm de diámetro se colocan en la norma 12 y placas.
  2. 20 l solución ECM se distribuye por igual en cada hoja de la cubierta. Sus restos son desechados. Para el secado de permitir un mínimo de 1 hora a 37 ° C. Como alternativa, el recubrimiento puede por secado durante la noche (12 h) a temperatura ambiente.
  3. Cada pozo se llena con 1 ml de medio M199 con suplementos que incluye antibióticos e ITS.
  4. Una suspensión celular (del paso 1,21) de 200 a 400 l, se añade a cada pocillo. Cultivo de las células se produce a 37 ° C en un 5% de CO 2 incubadora.
  5. Las células se permite a los sedimentos y después de una media hora cambia.
  6. Inmediatamente después de cambiar el medio de una cantidad adecuada de solución que contiene virus (del paso 2 o superior) se mezcla agitando suavemente la placa.
  7. En el caso de un medio de cultivo a largo plazo se cambia cada 2 días.
  8. 24 horas después de la expresión de la transfección GEB es detectable.

4. Imagen confocal 3D de estructuras subcelulares y Ca 2 + señalización

Imagen confocal se puede realizar en cualquier microscopio confocal. Sin embargo, la imagen del calcio experimentos requieren una velocidad de adquisición de la tasa de video por lo menos (25-30 Hz). Esto restringe las tecnologías útiles a cualquiera de los escáneres multihaz (por ejemplo, el disco Nipkow, barrido de campo o kilo de haz escáner matriz) o el escáner de un solo haz muy rápido (por ejemplo, escáner de resonancia o acústico óptico deflector (AOD)-scanner). Para una visión general ver ref. 3. Las imágenes en 3D subcelular requiere un z-drive. Aquí un escáner de gama kilo de haz (VTinfinity, VisiTech int., Sunderland, Reino Unido) se utiliza.

  1. El microscopio y el equipo periférico debe ser puesto en un modo de funcionamiento. Especialmente para el láser que puede requerir un período de calentamiento hasta una potencia de salida estable se alcanza.
  2. Las células necesitan para ser transferido a una cámara experimental (cubreobjetos de transferencia). El cubreobjetos con las células se transfieren a una cámara experimental. 1 ml de solución de Tyrode (que contiene 1.8 mM de calcio extracelular) se añade.
  3. La cámara experimental tiene que ser colocado en la platina del microscopio. Electrodos de estimulación, la perfusión de configuración y más periphedispositivos naturales, control de temperatura, por ejemplo, necesitan ser arreglados en consecuencia.
  4. Las células se centrará en el seleccionado y con luz blanca y / o iluminación epifluorescencia.
  5. Parámetros de adquisición, como la energía láser, etc tiempo de exposición o un protocolo de experimento tiene que ser puesta en marcha.
  6. Imágenes de series de tiempo y / o Z-sección puede ser adquirido.
  7. En las mediciones multimodo configuración más avanzada se puede hacer con la electrofisiología (patch-clamp) y / o manipulación óptica como la redistribución de fluorescencia después de photobleach (FRAP) o uncaging de sustancias, entre ellas dos fotólisis fotón.
  8. De análisis de imagen, especialmente la reconstrucción 3D se realiza en el software de análisis específico, como Imaris (Bitplane AG, Zürich, Suiza), velocidad (Improvisación, Coventry, Reino Unido) o el navegador Arivis (arivis GmbH, Rostock, Alemania).

5. Los resultados representativos:

Los resultados finales del mismo son las secuencias de imágenes que se pueden utilizar para extraer datos adicionales.

Un ejemplo es la investigación de estructuras subcelulares y organelos. La Figura 3 muestra el ejemplo de la disposición de 3 dimensiones del aparato de Golgi. En contraste con microscopía electrónica de todas las investigaciones se pueden realizar en las células vivas.

Figura 1
Figura 1: Flujo general de los pasos experimentales más importantes.

Figura 2
Figura 2: La imagen izquierda muestra el Q-HEK células en cultivo con 90-95% de confluencia que no son transducidas. Efectos citopático después de la transducción viral se muestran en la parte derecha. Células redondas y desprenderse de la parte inferior de la placa. En estas células el núcleo ocupa la mayor parte de las células como resultado de la producción de virus activo.

Figura 3
Figura 3: miocitos cardiacos adultos de rata transfectadas con una proteína de fusión-YFP objetivo el aparato de Golgi. Miocitos cardíacos después de la transferencia de genes adenovirales (un día en la cultura) expresan la proteína de fusión fluorescentes. El panel A muestra una sola rebanada confocal tomado de un z-stack. En el panel B de la misma célula se muestra después de deconvolución utilizando una función de diferencia de puntos teóricos (PSF). Esta pila de imagen borrosa, posteriormente se utiliza para representar la célula y conseguir una reconstrucción del volumen 3D, como se muestra en el panel de C o una reconstrucción 3D de la superficie (D). La barra representa el 10 micras.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

El procedimiento descrito para el aislamiento de los cardiomiocitos de rata se puede adaptar a otras especies, por ejemplo, 4 de ratón, si es necesario. Un parámetro que las necesidades de adaptación es la mezcla de enzimas para la digestión (ver abajo) y también la duración de la digestión. Tenga en cuenta que las células de algunas especies (por ejemplo, ratón) puede ser más frágiles que otros (por ejemplo, ratas).

La elección de la colagenasa es probablemente el paso más importante en el procedimiento de aislamiento. Elegimos Liberase Blendzyme porque es una mezcla sintética enzimática, prácticamente sin variaciones de lote a lote. El método convencional consiste en el uso de la colagenasa llamado crudo extraído de Clostridium histolyticum, que también es un método válido. Sin embargo, lote a lote variaciones requieren la optimización de nuevo para cada nuevo lote.

Además de las proteínas de fusión fluorescentes y la transducción de GEB la transferencia de genes adenovirales también se puede utilizar para la expresión de las proteínas más funcional o su regulación a la baja (por ejemplo, RNAi 5). Esto es así porque la eficiencia de transducción es alta (> 95%) y reproducible.

Subscription Required. Please recommend JoVE to your librarian.

Acknowledgments

Este trabajo fue apoyado por la Fundación Nacional de Ciencias alemana (DFG) y el Instituto Federal de Evaluación de Riesgos (BfR, Alemania).

Materials

Name Company Catalog Number Comments
Anesthesia solution Serumwerk Bernburg GmbH (Ursotamin), Bayer Health Care (Rompun) Mixture of 1 ml Ursotamin (100 mg/ml Ketaminhydrochlorid) and 240 μl Rompun (2% Xylazinhydrochlorid)
Citrate solution 117,64 mg sodium citrate in 10 ml 0.9% NaCl solution
Solution A 134 mM NaCl, 4 mM KCl, 11 mM glucose, 1.2 mM MgSO4, 1.2 mM Na2HPO4, 10 mM HEPES, pH adjusted to 7.35 using 10 M NaOH, sterile filtered
Solution A+ Content of solution A plus 0.2 mM EGTA, pH adjusted to 7.35 using 10 M NaOH, sterile filtered
Liberase solution F. Hoffmann‐ La Roche Ltd. 11988476 001 500 μl stock solution in 15 ml solution A (stock solution:10 mg/ml Liberase Blendzyme 4 in aqua dest.)
Solution B Content of solution A plus 200 μM CaCl2 and 0.1% DNase solution
Solution B1/2 1:1 mixture of solution A and solution B
DNase solution Sigma-Aldrich D4527 Deoxyribonuclease I, Type 2 from bovine pancreas, 40 KU (15 mg) are dissolved in 5 ml of 10 mM Tris‐HCl buffer, adjusted to pH=7.35, additional content: 50 mM NaCl, 10 mM MgCl2, 1 mM dithi–rythritol; this solution is mixed with 5 ml glycerol
Extracellular matrix protein (ECM) solution Extracellular matrix protein (ECM) solution E1270 1 ml stock solution as purchased is diluted with 6 mLmedium M199
Culture medium M199 PAA Laboratories E15‐834 Medium M199 supplemented with 1 μl/ml ITS solution and 20 μl/ml penicillin‐streptomycin solution (5000 units/ml)
ITS solution 25 mg Insulin, 25 mg Transferrin and 50 μl Selenite stock solution are dissolved in 5 ml aqua dest. (stock solution: 0.5 mg/ml Sodiumselenite in aqua dest.). Add a few drops of 1 M HCl until one should get a clearsolution. Aliquots can be frozen.
Tyrode 135 mM NaCl, 5.4 mM KCl, 1.8 mM CaCl2, 2mM MgCl2, 10 mM glucose, 10 mM HEPES, pH adjusted to 7.35 using 10 M NaOH, sterile filtered
Master mix 5 μl 10×PCR‐Buffer, 5 μl MgCl2 (25 mM), 2 μl forward primer, 2 μl reverse primer, 1 μl dNTP´s (10 mM each), 33 μl H2O, 1 μl DMSO, 1 μl Taq‐DNA polymerase for each sample
LB‐Medium 10 g/l Tryptone, 5 g/l Yeast extract, 5 g/l NaCl (and 15 g/l Agar if used as solid medium), pH 7.0
Pac I New England Biolabs R0547L preparation: 50 μg DNA, 5 μl 10×buffer, 0.5 μl 100×BSA,0.75 μl Pac I, fill with H2O up to final volume of 50μl

DOWNLOAD MATERIALS LIST

References

  1. Kaestner, L., Ruppenthal, S., S, Molecular Imaging II. Licha, K., Lin, C. P. Vol. 7370, SPIE. Bellingham. 737008-737008 (2009).
  2. Viero, C., Kraushaar, U., Ruppenthal, S. In vivo imaging of Drosophila melanogaster pupae with mesoscopic fluorescence tomography. Cell Calcium. 43, (1), 59-59 (2008).
  3. Shorte, S. L., Frischknecht, F. Imaging Cellular and Molecular Biological Functions. Springer. Berlin Heidelberg. 289-289 (2007).
  4. Kaestner, L., Lipp, P. Optics in Life Science. Popp, J., von Bally, G. Vol. 6633, SPIE. Munich. 66330K-66330K (2007).
  5. Rinne, A., Littwitz, C., Bender, K. Adenovirus-mediated delivery of short hairpin RNA (shRNA) mediates efficient gene silencing in terminally differentiated cardiac myocytes. Methods Mol Biol. 515, 107-107 (2009).
El aislamiento y la manipulación genética de los miocitos cardiacos adultos de microscopía confocal
Play Video
PDF DOI

Cite this Article

Kaestner, L., Scholz, A., Hammer, K., Vecerdea, A., Ruppenthal, S., Lipp, P. Isolation and Genetic Manipulation of Adult Cardiac Myocytes for Confocal Imaging. J. Vis. Exp. (31), e1433, doi:10.3791/1433 (2009).More

Kaestner, L., Scholz, A., Hammer, K., Vecerdea, A., Ruppenthal, S., Lipp, P. Isolation and Genetic Manipulation of Adult Cardiac Myocytes for Confocal Imaging. J. Vis. Exp. (31), e1433, doi:10.3791/1433 (2009).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter