Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Biology

Isolering och genetisk manipulation av vuxen Cardiac myocyter för Confocal Imaging

doi: 10.3791/1433 Published: September 17, 2009

Summary

Vuxen hjärt myocyter är primära celler som kan isoleras från djur hjärtan och odlade i flera dagar. Inom denna kultur period adenovirala genöverföring kan användas för att uttrycka genetiskt kodade biosensorer (GEBs) eller fluorescerande proteiner fusion. Båda metoder kan cellulära undersökningar med hjälp av konfokalmikroskopi.

Abstract

Hjärtat myocyter isolerade från vuxna hjärtan är allmänt accepterad som modell någonstans halvvägs mellan embryonala och neonatal muskelceller på ena sidan och en fungerande hjärta på den andra. Således cardiomyocytes fungera som bra modeller för hjärt-cellulär fysiologi och patofysiologi, för läkemedels-utredningar samt för undersökning av transgena djurmodeller. Här beskriver vi en metod för att isolera celler från hjärtat. Dessutom visar vi hur en genetisk manipulation på hjärtats myocyter kan utföras utan avel en transgen djur: Detta är en kombination av långsiktiga kultur (1 vecka) och adenovirala genöverföring. Det senare ett beskrivs från byggandet av viruset till transduktion av cellerna. Den kan användas för uttrycket av genetiskt kodade biosensorer (GEBs), fluorescerande proteiner fusion, men även för protein över uttryck och ner reglering, t.ex. med RNAi. Här ger vi ett exempel på uttryck för en fusionsprotein färgning en subcellulära struktur (Golgi). Sådana proteinuttryck kan visualiseras genom konfokal avbildning av z-stackar för en 3D-rekonstruktion av subcellulära strukturer. Protokollet består av state-of-the-art i cellkultur, molekylärbiologi och biofysik och ger därmed en metod för att utforska nya horisonter i cellulär kardiologi.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Det övergripande utformningen av det protokoll som innehåller fyra viktiga steg är avbildad i figur 1. Alla steg beskrivs i detalj. Cell isolering, transduktion och kultur, följt av konfokal avbildning ca 24 timmar senare en rad och obligatorisk tid. Viruset konstruktion bör göras före cellen isolering och används sedan för den genetiska transduktion.

1. Isolering av vuxna hjärt myocyter från råtta hjärtat

  1. Vuxna manliga Wistar råttor cirka 250 g vikt (6-12 veckor gamla) är sövda av intraperitoneal injektion av 170 l anestesi lösning per 100 g kroppsvikt
  2. Dessutom är en citrat lösning (2 ml / g kroppsvikt) injiceras för att undvika blodkoagulation under operationen.
  3. Langendorff Perfusion Set-Up bör utarbetas. Alla lösningar ska vara mättad med syre.
  4. När råttan är sövda, är djuret fast på en operation ombord och den övre delen av kroppen är desinficeras med 70% etanol.
  5. Djuret dödas genom att skära genom halspulsådern.
  6. Bröstkorgen öppnas med sax. Hjärtat och stora kroppspulsådern bör nu vara tillgänglig. Den pericard tas bort.
  7. Iskall lösning A + (5 ml) injiceras i båda kamrarna med en 26-nål för att arrestera hjärtat och tvätta ur blodet.
  8. Aorta är tog med en klämma och stympad vid aortabågen bara var de första förgrening sker.
  9. Hjärtat tas bort från bröstet och stora kroppspulsådern är fäst kanylen med en genomblödning som upprättats av pincett och en klämma för att möjliggöra retrograd Langendorff-perfusion. Var medveten om att inte foraminate aorta ventiler.
  10. Hjärtat måste fastställas av en ligatur runt aorta / kanyl. Öppna fartyg måste också knyts ihop.
  11. Hjärtat är retrogradely perfusion med syre-mättad lösning A + i rumstemperatur (23 ° C) i 10 min vid ett tryck på ca 70 mbar. Se till att inga luftbubblor in i aorta.
  12. Den perfusionen Lösningen är kopplas till en Liberase lösning vid en temperatur av 37 ° C i ca 25 min med en hastighet av 4 ml / min med hjälp av en peristaltiska pumpar. I slutet av perfusionen i hjärtat ska se marmorerat vitt. Matsmältningen tid kan behöva anpassas till situationen / vävnad skick.
  13. Hjärtat är hämtad från perfusionen set-up och placeras i en petriskål med lösning A vid en temperatur av 37 ° C. Resterande fartyg och förmak är avskurna. Fartygen är kasseras och förmak - om så behövs - behandlas olika (inte del av detta protokoll). Kamrarna är uppdelade i cirka 6 bitar.
  14. Bitarna överförs till en 100 ml E-kolv som innehåller 20 ml av lösning A vid en temperatur på 37 ° C och lite upprörd i ett 37 ° C vattenbad i 5 min. Slutligen supernatanten tas bort.
  15. Det förfarande som beskrivs ovan upprepas en eller två gånger. Supernatanten ska visas svagt ogenomskinlig.
  16. Den ökning av extracellulärt kalcium koncentrationen initieras genom att tillsätta 20 ml av lösning B 1 / 2 vid 37 ° C till celler och vävnader återstår en resterande av lösning A i Erlenmeyerkolv. Detta är något skakas i en 37 ° C vattenbad i ytterligare 5 min. Därefter supernatanten tas bort.
  17. Tillsätt ytterligare 20 ml lösning B 1 / 2. (Lösningen / supernatant bör nu innehålla viabla celler.) En droppe av celler överförs till en petriskål på ett inverterat cellkultur mikroskop. Om cellerna visar en hög spontan aktivitet (kontraktioner) behöver man vänta tills cellerna kommer att vila.
  18. Återigen supernatanten kasseras och 20 ml av lösning B 1 / 2 tillsätts.
  19. Spetsen på en plast pasteurpipett är avskuren på ett sådant sätt att vävnaden bitar kan passera lätt när upprörd genom öppningen. Med flambehandling skarpa kanter mjukas upp (smält).
  20. Nu vävnaden bitarna är lätt och försiktigt grov-. Vävnaden stycken skulle "falla sönder" i cellerna.
  21. Cellen innehåller supernatanten dekanteras och spädas ut med lösning B för att nå önskad celltäthet, som beror på typen av experiment och bör bestämmas empiriskt.

2. Konstruktion av ett adenovirus för fusionsprotein transduktion

Att producera Adenovirus Transpose-Ad adenovirala vektorsystem från MP Biomedicals används 1. Detta protokoll börjar med tillgängliga och testade inträde vektor (pCR259) för en fluorescerande fusionsprotein eller GEB s 2.

  1. Ett belopp på 10 ng av de ovan nämnda initiala pCR259 vektor som innehåller genen av intresse omvandlas med 100 l HighQ-1 Transponering-AD ™ 294 behöriga celler.
  2. Denna blandning inkuberas i 20 minuter på is följt av en värme chock för 45 s vid 42 ° C och lagras på is i ytterligare 2 min.
  3. Lägg till 900 & mu; L oselektiv LB-medium och växer vid 37 ° C under försiktig omrörning i 4 timmar.
  4. Plate 50 l, 100 l och 200 l på tallrikar med LB-medium med Kloramfenikol (cm, 20 mikrogram / ml), ampicillin (100 mikrogram / ml), tetracyklin (15 mikrogram / ml), X-Gal (280 mikrogram / ml ) och IPTG (40 mikrogram / ml). (En mer intensiv och snabbare blå färgning är möjligt genom att använda dyrare dye Bluo-Gal med 300μg/ml. Detta bör i synnerhet användas när du inte är så bekanta att identifiera och skilja blå / vit kolonier)
  5. Odla i 24 timmar vid 37 ° C. Lämna vid 4 ° C fram goda identifiering av blå kolonier är möjlig. När det finns problem att avgöra vilken kolonin är verkligen vita plocka några av kolonierna och replikera på en annan skylt som innehåller de tre antibiotika, X-Gal och IPTG och låta dem växa över natten vid 37 ° C.
    Anmärkning) Den HighQ-1 Transponering-AD ™ 294 celler innehåller två viktiga plasmider: De adenovirus ryggrad (transponera-Ad ™ 294) och en medhjälpare plasmid som uttrycker en transposase, som förmedlar att genen av intresse i målet platser, belägen i LacZ genen för Transpose-AD 294 plasmid.
  6. Att identifiera positiva kolonier som innehåller genen av intresse i viruset ryggraden utföra koloni-PCR så som beskrivs i 2,7-2,9. Använd vektor primers flankerar flera kloning webbplatsen (framåt 5 "CCCAGTCACGACGTTGTAAAACG 3", omvänd 5 'GCGGATAACAATTTCACACAGG 3') och gör en koloni PCR med 100% vita kolonier och använda en blå koloni som en kontroll för Transponering-AD 294 plasmider utan generna av intresse. Blå kolonier kommer att ge dig en kort PCR-fragment (~ 200bp), kolonier innehåller din gen av intresse visar en stor PCR-produkt (beroende på längden på ditt genen av intresse) och kolonier med två fragment finns flera cell kolonier och måste separeras om ytterligare används.
  7. Enligt tabellen nedan en Master Mix måste förberedas.
  8. Välj en 100% vit koloni med en autoklaveras tandpetare och först göra en kopia av denna koloni på en LB-plåt med CM.
  9. Överför kolonin i PCR-mix. Snurra den i PCR-mix 3-4 gånger än ta bort tandpetare innan den kan suga en hel del av PCR-mix. PCR-protokollet beror på KB av insatsen och den använda polymeras. Den glödgning temperatur grundfärger är 57 ° C och en användning av 35 cykler rekommenderas.
  10. Växa över natten kulturer (LB-medium med cm) av positiva kloner och isolera plasmider med en kommersiellt tillgänglig kit utan spin kolonner, eftersom centrifugalkraften stör det enorma viruset vektor.
  11. Förvandla 0,5 mikrogram av de isolerade plasmider i 100 l DH5α behöriga celler. Inkubera DNA med celler på is i 30 min. Heat shock 45 s vid 42 ° C och ställ på is i 2 min.
  12. Tillsätt 900 l oselektiv LB-medium och växer vid 37 ° C under försiktig omrörning i 1 timme.
  13. Plate 50 l på en tallrik med LB-medium med Cm, X-Gal och IPTG. Inkubera vid 37 ° C i 24 timmar.
  14. Välj och kopiera upp till 20 100% vita kolonier på separata Ampicillin, tetracyklin och kloramfenikol plattor som innehåller IPTG och X-Gal. Låt dem växa över natten vid 37 ° C. Välj kolonier som är 100% vit, kloramfenikol resistenta, ampicillin och tetracyklin känsliga.
  15. Koloni-PCR (valfritt): kan positiva kloner testas igen med koloni-PCR för att kontrollera att de innehåller insatsen.
  16. Välj en enda koloni av en positiv rekombinant och växa i 600 ml LB-medium med CM.
  17. Isolera plasmiden med hjälp av en plasmid maxi kit.
  18. Digest 5 mikrogram av plasmid med Pac jag i två timmar vid 37 ° C och stoppa reaktionen vid 65 ° C i 20 minuter.
  19. Koncentrera hela smälta in ett SpeedVac i rumstemperatur i 30 min till en slutlig volym på 10 l eller använda en fenol-kloroform extraktion metoden.
  20. Tina en injektionsflaska av frysta QBI-HEK 293 celler under försiktig omrörning i 37 ° C vattenbad. Skölj utsidan av flaskan med 70% etanol och fortsätt aseptiskt i en steril huva.
  21. Överför cellerna till en steril 15 ml tub, tillsätt 10 ml DMEM (+10% FCS) medan skonsam agitera och centrifugera 10 min vid 250xg till pellets cellerna.
  22. Kassera supernatanten. Suspendera pelleten i 10 ml DMEM (+10% FCS) genom att försiktigt pipettera upp och ned.
  23. Utsäde i en 75 cm 2-kolv och tillsätt 10 ml DMEM med 10% FCS till cellerna. Inkubera över natt vid 37 ° C i en 5% CO 2 inkubator.
  24. Nästa dag kontrollera celltäthet. QBI-HEK 293 celler bör delas upp i en 1:10 till 1:20 förhållande.
  25. Ta bort mediet från cellerna och trypsinize med 2 ml Trypsin för 1-3 min. Ge 10 ml DMEM till cellerna och centrifugera vid 250xg i 10 min.
  26. Ta noga på medellång och ger 10 ml färska medium till cellerna, resuspendera och räkna cellerna.
  27. Plattan i en sex-väl en bra med 2x10 5, 3x10 5 5, 5x10 5 och 6x10 5 celler. Inkubera skålen vid 37 ° C i en CO 2-inkubator.
  28. På följande dag använder en brunn med 50% sammanflödet att transfektera med den koncentrerade Pac jag smälta. Vi har goda erfarenheter av Lipofectamine 2000 transfektion, men även andra metoder (till exempel kalciumfosfat transfektion) bör vara lämpliga.
  29. Ändra mediet i väl 3-4 timmar innan transfektion att få celler i exponentiell tillväxt under förfarandet.
  30. Blanda 5 l Lipofectamine med 250 l DMEM och inkubera vid rumstemperatur i 5 minuter.
  31. Ge Lipofectamine-Medium blandningen till DNA (Pac jag smälta) och blanda genom att peka mot reaktionsrör, inte blanda genom att pipettera. Inkubera blandningen 20 min i rumstemperatur.
  32. Släpp transfektion blandningen till cellerna och rock plattan att blanda. Inkubera vid 37 ° C med 5% CO 2. Ändra medelstora efter 4-5 timmar.
  33. Två dagar efter transfektion ta mediet från cellerna och ge den till en ny kultur kolv (75 cm 2).
  34. Trypsinize cellerna med 500 l Trypsin för upp till 5 min. Ge 1 ml DMEM till cellerna, ta hela blandningen och lägg den tillsammans med 17 ml färsk medium (DMEM med FCS) i kulturen kolven. Odla cellerna vid 37 ° C med 5% CO 2 tills cytopatisk effekt (CPE) är synliga. Se Figur 2 för att lära CPE ska se ut.
  35. Samla cellerna med det medium i ett 50 ml rör och frysa celler vid -80 ° C. Bryt cellerna med tre frys / tö cykler (-80 ° C/37 ° C vattenbad).
  36. Centrifugera 20 minuter vid 8000xg och 4 ° C. Dekantera supernatanten till en 100 mm diameter fat och kasta pellet. Använd en steril filter med 0.45μm porstorlek till filtratet supernatanten. Detta är det första viruset lager (passage 1).
  37. Använd 1 / 3 av detta bestånd att transduce en 75cm 2 kolv med QBI-HEK 293 celler med 70% sammanflödet. Inkubera vid 37 ° C och 5% CO 2 tills CPE s är synliga.
  38. Om cellerna visar CPE s samla in dem och extrahera virus som gjort förut. Detta är passage 2 av viruset.
  39. Upprepa steg 2,37 och 2,38 med virus passage 2 och så vidare tills förstärkningen av de virus når en tillräckligt virus lager. Viruset kan koncentreras med specifika centrifugering rör (Amicon Ultra-15 Radialfläkt Filtersystem med ultracel-100 membran från Millipore) och lagras i flera månader vid -80 ° C. För att räkna infektiösa partiklar använda en plakett analys.
  40. Använd virus passage 2 eller högre för att transduce celler och för ytterligare förstärkning av viruset.

3. Primär cellkultur och adenovirala transduktion

  1. Sterila runda locket glider med 20 mm diameter placeras i standard 12-brunnars plattor.
  2. 20 l ECM-lösning är jämnt fördelade på varje täckglas. Rester kasseras. För torkning tillåter minst 1 timme vid 37 ° C. Alternativt kan beläggningen kan genom att torkas över natten (12 h) vid rumstemperatur.
  3. Varje brunn fylls med 1 ml Medium M199 med tillägg bestående antibiotika och ITS.
  4. En cellsuspension (från steg 1,21) på 200 till 400 l tillsätts till varje brunn. Odling av celler sker vid 37 ° C i 5% CO 2 inkubator.
  5. Celler får sediment och efter 1 h mediet förändras.
  6. Omedelbart efter att ha ändrat på medellång en tillräcklig mängd virus som innehåller lösning (från passagen 2 eller högre) blandas genom att försiktigt vagga plattan.
  7. I händelse av en långsiktig odlingsmedium byts var 2 dagar.
  8. 24 timmar efter transfektion GEB uttryck kan upptäckas.

4. Konfokala bildhantering för 3D subcellulära strukturer och Ca 2 + Signaling

Konfokala imaging kan utföras på alla konfokalmikroskop. Men, kalcium-imaging experiment kräver ett förvärv hastighet av minst video takt (25-30 Hz). Detta begränsar användbara tekniker för att antingen multi beam skannrar (t.ex. Nipkow skiva, svepte fältet eller kilo-beam array scanner) eller mycket snabb enda stråle scanner (t.ex. resonant skannern eller akusto optisk deflektor (AOD)-skanner). För en översikt se Ref. 3. 3D-subcellulära avbildning kräver en Z-Drive. Här ett kilo-beam array scanner (VTinfinity, VisiTech Int., Sunderland, Storbritannien) används.

  1. Mikroskop och kringutrustning måste ställas in i ett driftläge. Speciellt för laser detta kan kräva en uppvärmning tid tills en stabil uteffekt uppnås.
  2. Celler måste överföras till en experimentell kammare (cover-slip överföring). Den täckglas med celler överförs till en experimentell kammare. 1 mL Tyrode lösning (innehållande 1,8 mM extracellulärt kalcium) läggs sedan.
  3. Den experimentella kammaren måste placeras på mikroskop scenen. Stimulering elektroder, perfusion set-up och ytterligare peripheral enheter, t.ex. temperaturkontroll, behöver ordnas därefter.
  4. Cellerna kommer att fokusera på och väljs med vitt ljus och / eller epifluorescent belysning.
  5. Förvärv parametrar som laser makt, exponeringstid etc. eller en hel experiment protokoll måste ställa in.
  6. Tidsserier och / eller Z-sektionen bilder kan förvärvas.
  7. På set-up ytterligare avancerade multimode mätningar kan göras med hjälp av elektrofysiologi (patch-clamp) och / eller optisk manipulation som fluorescens omfördelning efter photobleach (FRAP) eller uncaging av ämnen inklusive två photon fotolys.
  8. Bildanalys, speciellt 3D-rekonstruktion görs på särskilda analysprogram såsom Imaris (Bitplane AG, Zürich, Schweiz), hastighet (Improvisation, Coventry, Storbritannien) eller Arivis Browser (arivis GmbH, Rostock, Tyskland).

5. Representativa resultat:

Det slutliga utfallet i protokollet är bildsekvenser som kan användas för att extrahera ytterligare uppgifter.

Ett exempel är den undersökning av subcellulära strukturer och organeller. Figur 3 visar exemplet med 3-dimensionella arrangemang av Golgiapparaten. I motsats till elektronmikroskopi alla utredningar kan utföras på levande celler.

Figur 1
Figur 1: Allmänna flöde av de viktigaste experimentella stegen.

Figur 2
Figur 2: Den vänstra bilden visar Q-HEK celler i kultur med 90-95% confluency som inte är transduced. Cytopatic effekter efter virus transduktion visas i den högra delen. Celler runda upp och ta bort från botten av plattan. I dessa celler kärnan upptar den största delen av cellerna som ett resultat av aktivt virus produktion.

Figur 3
Figur 3: Vuxen råtta hjärt myocyte transfererats med en YFP-fusionsprotein inriktning på Golgiapparaten. Hjärtat myocyter efter adenovirala genöverföring (en dag i kultur) uttrycker fluorescerande fusionsprotein. Panel A skildrar en enda konfokala skiva tas från ett z-stack. I panelen B samma cell framställs efter deconvolution hjälp av en teoretisk funktion punkt sprids (PSF). Denna de-suddig bild stack därefter används för att göra cellen och få en 3D-volym rekonstruktion som visas i panelen C eller en 3D-yta rekonstruktion (D). Baren är 10 mikrometer.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Det förfarande som beskrivs för isolering av råtta cardiomyocytes kan anpassas till andra arter, t.ex. mus 4 om det behövs. En parameter som behöver anpassning är det enzym mix för rötning (se nedan) och även varaktigheten av matsmältningen. Var medveten om att cellerna på vissa arter (t.ex. mus) kan vara mer känsliga än andra (t ex råtta).

Valet av kollagenas är förmodligen det mest avgörande steget i isolering förfarande. Vi väljer Blendzyme Liberase eftersom det är en syntetisk enzymatisk blandas med praktiskt taget ingen sats till sats variationer. Den konventionella metoden är att använda så kallade råolja kollagenas ur Clostridium histolyticum, vilket också är en giltig metod. Men sats till sats variationer kräver nya optimera för varje nytt parti.

Bortsett från den fluorescerande fusionsproteiner och GEB transduktion den adenovirala genöverföring kan också användas för över uttryck av funktionella proteiner eller nedreglering (t.ex. genom RNAi 5). Detta gäller eftersom transduktion effektiviteten är hög (> 95%) och reproducerbar.

Subscription Required. Please recommend JoVE to your librarian.

Acknowledgments

Detta arbete stöddes av den tyska National Science Foundation (DFG) och av det federala institutet för riskbedömning (BFR, Tyskland).

Materials

Name Company Catalog Number Comments
Anesthesia solution Serumwerk Bernburg GmbH (Ursotamin), Bayer Health Care (Rompun) Mixture of 1 ml Ursotamin (100 mg/ml Ketaminhydrochlorid) and 240 μl Rompun (2% Xylazinhydrochlorid)
Citrate solution 117,64 mg sodium citrate in 10 ml 0.9% NaCl solution
Solution A 134 mM NaCl, 4 mM KCl, 11 mM glucose, 1.2 mM MgSO4, 1.2 mM Na2HPO4, 10 mM HEPES, pH adjusted to 7.35 using 10 M NaOH, sterile filtered
Solution A+ Content of solution A plus 0.2 mM EGTA, pH adjusted to 7.35 using 10 M NaOH, sterile filtered
Liberase solution F. Hoffmann‐ La Roche Ltd. 11988476 001 500 μl stock solution in 15 ml solution A (stock solution:10 mg/ml Liberase Blendzyme 4 in aqua dest.)
Solution B Content of solution A plus 200 μM CaCl2 and 0.1% DNase solution
Solution B1/2 1:1 mixture of solution A and solution B
DNase solution Sigma-Aldrich D4527 Deoxyribonuclease I, Type 2 from bovine pancreas, 40 KU (15 mg) are dissolved in 5 ml of 10 mM Tris‐HCl buffer, adjusted to pH=7.35, additional content: 50 mM NaCl, 10 mM MgCl2, 1 mM dithi–rythritol; this solution is mixed with 5 ml glycerol
Extracellular matrix protein (ECM) solution Extracellular matrix protein (ECM) solution E1270 1 ml stock solution as purchased is diluted with 6 mLmedium M199
Culture medium M199 PAA Laboratories E15‐834 Medium M199 supplemented with 1 μl/ml ITS solution and 20 μl/ml penicillin‐streptomycin solution (5000 units/ml)
ITS solution 25 mg Insulin, 25 mg Transferrin and 50 μl Selenite stock solution are dissolved in 5 ml aqua dest. (stock solution: 0.5 mg/ml Sodiumselenite in aqua dest.). Add a few drops of 1 M HCl until one should get a clearsolution. Aliquots can be frozen.
Tyrode 135 mM NaCl, 5.4 mM KCl, 1.8 mM CaCl2, 2mM MgCl2, 10 mM glucose, 10 mM HEPES, pH adjusted to 7.35 using 10 M NaOH, sterile filtered
Master mix 5 μl 10×PCR‐Buffer, 5 μl MgCl2 (25 mM), 2 μl forward primer, 2 μl reverse primer, 1 μl dNTP´s (10 mM each), 33 μl H2O, 1 μl DMSO, 1 μl Taq‐DNA polymerase for each sample
LB‐Medium 10 g/l Tryptone, 5 g/l Yeast extract, 5 g/l NaCl (and 15 g/l Agar if used as solid medium), pH 7.0
Pac I New England Biolabs R0547L preparation: 50 μg DNA, 5 μl 10×buffer, 0.5 μl 100×BSA,0.75 μl Pac I, fill with H2O up to final volume of 50μl

DOWNLOAD MATERIALS LIST

References

  1. Kaestner, L., Ruppenthal, S., S, Molecular Imaging II. Licha, K., Lin, C. P. Vol. 7370, SPIE. Bellingham. 737008-737008 (2009).
  2. Viero, C., Kraushaar, U., Ruppenthal, S. In vivo imaging of Drosophila melanogaster pupae with mesoscopic fluorescence tomography. Cell Calcium. 43, (1), 59-59 (2008).
  3. Shorte, S. L., Frischknecht, F. Imaging Cellular and Molecular Biological Functions. Springer. Berlin Heidelberg. 289-289 (2007).
  4. Kaestner, L., Lipp, P. Optics in Life Science. Popp, J., von Bally, G. Vol. 6633, SPIE. Munich. 66330K-66330K (2007).
  5. Rinne, A., Littwitz, C., Bender, K. Adenovirus-mediated delivery of short hairpin RNA (shRNA) mediates efficient gene silencing in terminally differentiated cardiac myocytes. Methods Mol Biol. 515, 107-107 (2009).
Isolering och genetisk manipulation av vuxen Cardiac myocyter för Confocal Imaging
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Kaestner, L., Scholz, A., Hammer, K., Vecerdea, A., Ruppenthal, S., Lipp, P. Isolation and Genetic Manipulation of Adult Cardiac Myocytes for Confocal Imaging. J. Vis. Exp. (31), e1433, doi:10.3791/1433 (2009).More

Kaestner, L., Scholz, A., Hammer, K., Vecerdea, A., Ruppenthal, S., Lipp, P. Isolation and Genetic Manipulation of Adult Cardiac Myocytes for Confocal Imaging. J. Vis. Exp. (31), e1433, doi:10.3791/1433 (2009).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter