Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Bioengineering

تصنيع أجهزة الاستشعار الكهروكيميائية الدنا للكشف Reagentless من الأحماض النووية والبروتينات والجزيئات الصغيرة

doi: 10.3791/2922 Published: June 1, 2011

Summary

"E - DNA" وأجهزة الاستشعار ، reagentless ، وقد تم تكييف أجهزة الاستشعار الكهروكيميائية التي تحقق أداء جيدا حتى عندما تحدى مباشرة في الدم والمصفوفات المعقدة الأخرى ، إلى الكشف عن مجموعة واسعة من الحمض النووي والبروتين وanalytes جزيء صغير. هنا نقدم إجراء العامة للتصنيع واستخدام أجهزة الاستشعار من هذا القبيل.

Abstract

كما يمارس حاليا الطب والأطباء ترسل العينات الى المختبر المركزي للاختبار ، وبالتالي يجب الانتظار لساعات أو أيام لتلقي النتائج. وسوف يخدم العديد من المرضى بشكل أفضل من خلال اختبارات سريعة والسرير. تحقيقا لهذه الغاية وضعت مختبرنا وآخرون ، reagentless تنوعا منصة جهاز الاستشعار البيولوجي التي تدعم ، reagentless الكشف الكمي الكهروكيميائية ، والأحماض النووية (DNA ، RNA) والبروتينات (بما في ذلك الأجسام المضادة) والجزيئات الصغيرة غير المجهزة analytes مباشرة في العينات السريرية والبيئية. في هذا الفيديو ، وندلل على إعداد واستخدام أجهزة الاستشعار عدة في هذه الفئة "E - DNA". على وجه الخصوص ، نبتدع والتظاهر استشعار للكشف عن تسلسل الحمض النووي هدفا في تفاعل البلمرة سلسلة خليط ، وهو جسم مضاد الفيروس محددة والكوكايين المخدرات. الإجراء يتطلب إعداد ثلاث ساعات فقط من التدريب العملي على الجهد يعقبه الحضانة بين عشية وضحاها ، واستخدامها يتطلب دقائق فقط.

Protocol

1. الأمر الذي يمهد الطريق

  1. شراء ذات الصلة ، والحمض النووي التحقيق معدلة كيميائيا من شركة قليل النوكليوتيد التوليف مخصصة مثل تقنيات Biosearch (نوفاتو ، CA) أو شهادة ميدلاند (ميدلاند ، تكساس). يتم تعديل التحقيق خلال تجميعي من إضافة ثيول في نهاية C6 - 3' وزرقاء الميثيلين الأكسدة النشطة في نهاية 5' - الخمسين.
  2. حل الحمض النووي في التحقيق الفوسفات مخزنة المالحة 7.4 درجة الحموضة إلى تركيز 200 ميكرومتر والتحقق من تركيزها من خلال قياس الامتصاصية في 260 نانومتر في استخدام الطيف. نظرا لشاردة الميثيلين الأزرق على الحمض النووي لجنة التحقيق ينبغي أن يكون الحل صبغة زرقاء مرئية.
  3. تعد طازجة 1 مل من حل 10 ملم من تريس (2 - carboxyethyl) الفوسفين TCEP في الماء ، المقطر منزوع الأيونات (DI - المياه). في تجربتنا ، هذه الحلول لا تزال TCEP الطازجة لمدة أسبوع عند تخزينها في الظلام في 4 درجة مئوية.
  4. للحد من أي ثاني كبريتيد السندات التي قد تكون موجودة في تحقيق حل الحمض النووي ، والجمع بين 1 ميكرولتر من المخزون حل مسبار الحمض النووي مع 2 ميكرولتر من الحل TCEP ومزيج بلطف مع ماصة. احتضان الخليط لمدة ساعة واحدة في وعاء الظلام ، والمبردة. وينبغي أن الحل أصبح واضحا في البداية زرقاء كما TCEP يقلل عكسية الميثيلين الأزرق. اذا لم تصبح الحل واضح ، كرر الإجراء باستخدام حل TCEP طازجة أو ، ربما ، في درجة حرارة الغرفة.
  5. بعد ساعة واحدة تمييع التحقيق DNA خفض حل مع 1 مل من المخزن ، وهذا سوف يخفف ذلك إلى تركيز 200nM. في وقت لاحق ، وسوف تحتضن مجموعة من الأقطاب الكهربائية القرص الذهب في 200 ميليلتر من أجزاء هذا الحل التحقيق المخفف.
  6. طازجة إعداد ما لا يقل عن 2 مل من mercaptohexanol 2mm والفوسفات مخزنة في المياه المالحة.

2. استشعار التحضير

  1. الجمع بين 0.05 ميكرون مسحوق الألومينا مع الماء على قطعة قماش التلميع الغرامة. تلميع مجموعة من الأقطاب الكهربائية الذهب القرص (CH الآلات ، أوستن ، تكساس) عن طريق الضغط على سطح الذهب بقوة في قماش مبللة ، ونقلها في نمط الرقم ثمانية لحوالي ثلاث دقائق في القطب.
  2. شطف الأقطاب مصقول مع DI - المياه وتزج بهم في أنابيب إيبندورف تمتلئ نفسه. يصوتن لمدة خمس دقائق لإزالة أي مسحوق الألومينا المتبقية.
  3. وضع أقطاب كهربائية في حل M 0.5 حامض الكبريتيك ، وإرفاقها إلى potentiostat جنبا الى جنب مع مكافحة البلاتين والفضة / كلوريد الفضة الإلكترود المرجعي ، وتشغيل سلسلة من voltammograms للأكسدة ، والحد ، وتنظيف electrochemically سطوحها. بعد هذا إجراء تنظيف الكهروكيميائية الثاني في حل من بوكل 0.01 م في 0.1 م حامض الكبريتيك. ويمكن الاطلاع على التفاصيل الدقيقة لهذه الإجراءات تنظيف الطبيعة من خلال موقعنا البروتوكولات ورقة 1 ، وتكملة لهذا الفيديو.
  4. ترتيب مجموعة من أنابيب 2 مل إيبندورف في رفوف وملء كل مع 200 ميكرولتر من تحقيق حل الحمض النووي. وسوف تركز على الحمض النووي التحقيق في هذا الحل تحديد الكثافة مع السلطات الوطنية المعينة التي حزمة المسبار على سطح جهاز الاستشعار. أداء المجس تعتمد بشدة على الكثافة التحقيق مع الكثافة المثلى تتراوح بين العمارة استشعار واحد إلى التالي. وبالتالي يجب تركيز التحقيق المستخدمة في هذه الخطوة أن يكون الأمثل لكل نوع جديد من أجهزة الاستشعار 2. لدينا أبنية التحقيق التحقيق حتى الآن ، فإن تركيز الحمض النووي التحقيق التي نتبعها في هذه الخطوة مجموعة من 15 نانومتر إلى 2 ميكرون ، 200 نانومتر مع كونها قيمة نموذجية.
  5. شطف الأقطاب الذهب مع قرص دي في المياه ، وتزج بهم ثم في الحل مسبار الحمض النووي ذات الصلة في أنبوب إيبندورف لمدة ساعة. عند هذه النقطة ، فإن الحمض النووي التحقيق نعلق على سطح القطب الذهب عبر تشكيل المونولاير النفس ثيول على اساس الذهب تجميعها.
  6. شطف الأقطاب مع DI - المياه ، وتزج بهم في mercaptohexanol 2mm وإيبندورف في أنبوب وتخزينها في مكان مظلم لمدة 3 ساعات ليلة وضحاها في درجة حرارة الغرفة لضمان تشكيل كامل للأحادي الطبقة الذاتي تجميعها. هذه الخطوة تتضمن mercaptohexanol كجزء من المونولاير مختلطة لضمان تشكيل المونولاير مستقرة. لمنع التبخر قد تحتاج إلى ختم القطب في أنبوب إيبندورف مع parafilm. ويمكن تخزين أجهزة الاستشعار في هذا الحل لعدة أيام إذا لزم الأمر.
  7. عندما تكون مستعدا لاستخدام أجهزة الاستشعار ، مع شطفه DI - المياه ونقع بعد ذلك في المخزن لمدة لا تقل مدة عشر دقائق. ويجب أيضا أجهزة استشعار تهدف الى الكشف عن الأجسام المضادة تكون مغمورة في محلول من 100 نانومتر حبلا الاعتراف السابقة ذات الصلة للاستخدام ، يعقبه سريعا للغاية مع شطف العازلة.

3. اختبار أجهزة الاستشعار ، والكشف عن الحمض النووي

  1. في هذا البروتوكول ، وسمت به 17 حبلا التحقيق النوكليوتيدات إلى القطب الذهب. لديه الميثيلين مراسل الأكسدة الزرقاء في نهاية 3' التابعة لها (الشكل 1). عندما جزيء التحقيق مع hybridizes حبلا التقاط الحالية عبر الدائرة استشعار النقصان.
  2. شطف جهاز استشعار جديدة مع DI - المياه وتزج به في فارغةالعينة التي تفتقر إلى الهدف بغية تسجيل إشارة الخلفية التي ينتجها. إرفاق استشعار لقيادة القطب العمل من potentiostat. وضع العداد الكهربائي البلاتين والفضة وكلوريد مرجع / الفضة الكهربائي الى حل.
  3. تشغيل قياس الموجة مربعة من 0 إلى -0.6 V مع سعة 25 فولت وحجم خطوة من 1mV. سوف الأمثل تردد موجة مربعة تعتمد على تفاصيل التحقيق العمارة 2،3 ، وبالنسبة للأبنية التحقيق قمنا بتوظيف القيم المثلى وعادة ما تكون في حدود 6-60 هرتز. سترى الذروة عند حوالي تقريب -0.35 الخامس ، فإن احتمال الأكسدة الميثيلين الأزرق (إمكانات الذروة قد تحول قليلا اعتمادا على درجة الحموضة دقيقة من محلول الاختبار الخاص بك). ارتفاع من خط الأساس الحالية لهذه الذروة يتناسب مع كفاءة نقل الإلكترون بين الزرقاء والميثيلين القطب الذهب (Figure2). حفظ هذا القياس الخلفية.
  4. تحريك كهربائي في التوصل إلى حل التي تحتوي على جزيء DNA الهدف من الفائدة ، ويوازن (من 5 إلى 120 دقيقة اعتمادا على حجم وهيكل وتركيز 5 ، target4) وجمع الثانية voltammagram موجة مربعة. وذروة الذروة في الخامس -0.35 التغيير من القياس الأولي الخلفية. ويرتبط حجم هذا التغيير إلى تركيز الحليلة. فمن بيانات الناتج الرئيسي لهذا الاستشعار (الشكل 3).
  5. قياس التغير النسبي إشارة ، فإن نسبة انخفاض أو زيادة في نسبة إشارة إلى الذروة الخلفية ، غالبا ما يكون أكثر دقة من قياس التغير المطلق في الحالية ، وهذا يصحح للتغيرات في مساحة سطح القطب. للقيام بذلك ، يتم تقسيم الفرق بين التيار والتيار ذروة الذروة الخلفية بواسطة ذروة الخلفية الحالي.

4. استشعار التجديد

  1. قياساتك مرة واحدة كاملة ، نقل أجهزة الاستشعار في وعاء مملوء بالماء DI لمدة 30 ثانية ، أو بخ مع دفق مستمر من DI - المياه لمدة 30 ثانية. كرر ذلك مرات أكثر مع اثنين من المياه العذبة منزوع الأيونات. ملاحظة : بعض analytes مقاومة لهذا النهج ؛ بالنسبة لهم محاولة عدوانية الشطف في 6 هيدروكلوريد الجوانيدين M أو الايثانول 70 ٪.
  2. وضع المجس مرة أخرى إلى حل حيث سيتم إجراء قياسات. في غضون دقيقة ، كان ينبغي أن عاد إلى الارتفاع ذروة قيمتها الأصلية. ومن الجدير بالذكر أن هذه المجسات المعرض في كثير من الأحيان تغيير إشارة أكبر قليلا خلال أول اختبار لهم ودورة التجديد ، والنتائج متسقة للغاية خلال دورات لاحقة 6.

5. اختبار أجهزة الاستشعار ، والكشف عن الاجسام المضادة

  1. في هذا البروتوكول ، ومسبار الحمض النووي الميثيلين الأزرق وثيول تعديل المستخدمة في هذه المجسات بمثابة حبلا "مرساة" 7. وتعلق مباشرة إلى القطب الذهب. غير المهجنة ثم هذا مع الثاني ، حبلا "الاعتراف" الحمض النووي التي تم مترافق تساهميا للمستضد ذات الصلة (الشكل 4). لقد كان لدينا حظ جيدة مع بيوت التركيب التجارية ، مثل التكنولوجيا وBiosearch Panagene ، لتركيب الحمض النووي في الوهم المستضد اللازمة. يتم تنفيذ الخطوة التهجين بها جهاز استشعار نقل سابقة التجهيز في أنبوب إيبندورف تحتوي على 100 نيوتن متر من الحمض النووي حبلا الاعتراف ذات الصلة في برنامج تلفزيوني لمدة 1 ساعة.
  2. وضع أجهزة الاستشعار في حل فارغة ذات الصلة. إرفاقه الكهربائي يؤدي عمل من potentiostat ووضع العداد الكهربائي والفضة والبلاتين والفضة / كلوريد مسرى إشارة إلى الحل.
  3. أداء مربع voltammetry موجة كما هو موضح أعلاه. لهندسة مسبار خاص لقد استخدمنا هنا موجة التردد هو الأمثل مربع 60 هرتز. سترى حول ذروة تقريب -0.35 خامسا حفظ هذا القياس الخلفية.
  4. نقل الأقطاب في التوصل إلى حل يتضمن الحليلة الهدف ، احتضان لمدة 5 إلى 60 دقيقة ، والثاني جمع voltammagram موجة مربعة. إذا كان الهدف هو الضد الحالي سيكون في ذروة انخفاض -0.35 الخامس. ويرتبط حجم هذا التغيير إلى تركيز الأجسام المضادة.

6. اختبار أجهزة الاستشعار ، والكشف عن جزيء صغير

  1. في هذه الحالة ، فإن جزيء المسبار على سطح حساس هو aptamer ، وهو جزيء الحمض النووي أو الحمض النووي الريبي التي تم تحديدها في المختبر لتحليلها ربط محددة الجزيئي ، والذي يتغير هيكله (طيات) عند ملزمة لالحليلة هدفها 8،9 ( الشكل 5). هنا نوظف الكوكايين ملزم aptamer الحمض النووي ، التي وضعها مختبر 10،11 ستويانوفيتش.
  2. شطف جهاز استشعار جديدة مع DI - المياه وتزج به في عينة فارغة تفتقر إلى الهدف بغية تسجيل إشارة الخلفية التي ينتجها. إرفاق استشعار لقيادة القطب العمل من potentiostat. مكان عداد البلاتين والفضة وكلوريد مرجع / الفضة الى حل.
  3. أداء مربع voltammetry موجة كما هو موضح أعلاه. لهندسة مسبار خاص يعمل لدينا هنا الأمثل تردد الموجة هو مربع 200Hz (لكن 60 هرتز يعمل أيضا). سترى حول ذروة تقريب -0.35 خامسا حفظ هذا القياس الخلفية.
  4. نقل الأقطاب في التوصل إلى حل يتضمن الحليلة المستهدفة ، لاحتضان 5 دقائق ~ ، وجمع الثانية voltammagram موجة مربعة. وذروة الذروة في الخامس -0.35 التغيير. ويرتبط حجم هذا التغيير إلى تركيز الحليلة الهدف. إذا لم تتمكن من الحصول على عينة الكوكايين والبروكائين ، واستخدام غير المنظم الذي يمكن أن تستخدم كبديل.

7. ممثل النتائج :

عندما تستخدم للكشف عن الحمض النووي باستخدام العمارة الأولى ، وينبغي الاشارة بنسبة 60 ٪ على الأقل عند معايرتها في الهدف نانومتر 200. بعد ثلاثة يشطف وجيزة في الماء منزوع الأيونات ، ينبغي أن يشير الى عودة قريبة جدا (في حدود 0،1-5 ٪) إلى قيمته الأصلية. وينبغي أن أجهزة استشعار الخضوع لكشف الأجسام المضادة انخفاض إشارة من 40 إلى 80 ٪. Aptamer المستندة إلى أجهزة استشعار للكشف عن الكوكايين يحمل إشارة زيادة تصل الى 200 ٪ اعتمادا على وتيرة والتغطية السطحية التي تعمل فيها. للاستشعار الكوكايين وتغطية السطح المنخفض هو أفضل 3.

الشكل 1
الشكل 1. الكشف عن الحمض النووي DNA مع جهاز الاستشعار البيولوجي الكهروكيميائية.

الشكل 2
شاشة بالرصاص الرقم 2. تظهر إشارة التي ينتجها جهاز الاستشعار البيولوجي E - DNA voltammetry خلال موجة مربعة.

الشكل 3
شاشة بالرصاص الرقم 3. تظهر الإشارات التي ينتجها جهاز الاستشعار البيولوجي E - DNA voltammetry خلال موجة مربع ، قبل وبعد التهجين مع تحليلها.

الشكل 4
الشكل 4. الكشف عن الأجسام المضادة مع جهاز الاستشعار البيولوجي السقالة.

الشكل 5
الشكل 5. الكشف عن الكوكايين أو البروكائين مع جهاز الاستشعار البيولوجي aptamer الكهروكيميائية.

مخصص أليغو تسلسل تعليقات
دقق خطية الحمض النووي (LP17) 5' - HS - (CH2) 6 - TGGATCGGCGTTTTATT - (CH2) 7 - NH - MB - 3 ' HPLC منقى ، ويمكن أن يؤمر مع SS
الحمض النووي المستهدف الحليلة AATAAAACGCCGATCCA معدلة
الاعتراف ستراند 5' - TEG - مستضد CAGTGGCGTTTTATTCTTGTTACTG - 3 "
سقالة انكور 5' - HS - (CH 2) 6 GCAGTAACAAGAATAAAACGC CACTGC - (CH 2) 7 ميغابايت HPLC منقى ، ويمكن أن يؤمر مع SS
A4 الكوكايين Aptamer 5' - HS - AGACAAGGAAAATCCTTCAATGAAGTGGGTCG - MethyleneBlue - 3 ' HPLC منقى ، ويمكن أن يؤمر مع SS

الجدول 1. التحقيق وتسلسل الحمض النووي المستهدف.

Discussion

ملاحظة هامة هي أن أيا من هذه التجارب المذكورة أعلاه ستعمل بشكل صحيح ما لم تكن قد الأقطاب تنظيفها بشكل صحيح. وهنا لدينا دليل لإجراء تنظيف كهربائية. عند العمل مع الآلات potentiostats CH ، ونحن تشغيل هذه الخطوات التنظيف باستخدام مجموعة من ثلاثة برامج الماكرو.

المرحلة صفر (E - نظيفة O)
تزج الأقطاب في 0.5MH 2 SO 4 وربطها الأقطاب العمل من potentiostat. أيضا إرفاق وتزج في اشارة حج / AgCl والبلاتين القطب المضاد. تبدأ خطوة الأكسدة (2 V لمدة 5 ليالي) ثم خطوة التخفيض (V 0.35 لمدة 10 ق).

المرحلة الأولى (E - نظيفة 1)
بدء الأكسدة والحد من عمليات التفحص في ظل الظروف الحمضية نفسها (0.5MH 2 SO 4) ،35-1،5 الخامس (20 بمسح بمعدل المسح من 4 ق / الخامس والفاصل الزمني للعينة من 0.01 V ، تليها أربع بفحص بمعدل مسح 0.1 V / s و فاصل زمني عينة من 0.01 V).

المرحلة الثانية (E - نظيفة 2)
إجراء مجموعة أخرى من الأكسدة الكهروكيميائية والحد من عمليات التفحص في ظل الظروف الحمضية (0.01 م KCl/0.1 MH 2 SO 4) تغطي أربعة نطاقات المحتملة المختلفة (تنفيذ كافة شرائح لمدة 10 بمعدل فحص الخامس ق 1 و 0.1 فاصل زمني عينة من 0.01 V ) : (ط) مداها 0،2-0،75 الخامس ؛ (ب) مجموعة المحتملة 0،2-1،0 الخامس ، (ج) مجموعة المحتملة ،2-1،25 الخامس ؛ (رابعا) مداها 0،2-1،5 V.

ويمكن استخدام أنواع كثيرة من الأقطاب الكهربائية الذهب لاجراء هذه التجارب. بالإضافة إلى القرص أقطاب الذهب مثل تلك المستخدمة هنا ، ونحن قد حققت نجاحا مع السطوح microfabricated الذهب ، وأسلاك الذهب ، والذهب على لوحات الدوائر المطبوعة.

جنبا إلى جنب مع أجهزة الاستشعار وصفها في هذه الورقة ، تم الإبلاغ عن العديد من الحمض النووي الكهروكيميائية جهاز الاستشعار البيولوجي أبنية أخرى. وهذا يشمل أجهزة استشعار مع pseudoknot 12 ، حبلا الثلاثية 13 ، 14 شطيرة ، ساندويتش سوبر 15 ، أو ثلاثي العمارة 16.

في المستقبل ، ونحن نتوقع أن تستخدم هذه المجسات في نقطة التشخيص والرعاية الطبية. وقد تم إدماجها بنجاح في العديد من الأجهزة ميكروفلويديك 17،18 ، وتقديم العديد من المزايا أكثر من أنظمة الكشف عن الحليلة البصرية. على وجه الخصوص ، يمكن لهذه الوظيفة في أجهزة الاستشعار عكر ، كثيفة بصريا وعينات للغاية لصناعة السيارات في الفلورسنت.

Disclosures

لا يوجد شيء في الكشف عنها.

Acknowledgments

وقد تم تمويل هذا العمل من خلال منحة (OPP1015402) من مؤسسة بيل وميليندا غيتس من خلال مبادرة التحديات الكبرى للاستكشافات ، والمعاهد الوطنية للصحة من خلال المنح GM062958 - 01 و2R01EB002046. تم تنفيذ هذا العمل في جزء تحت رعاية وزارة الطاقة الأميركية عن طريق مختبر لورانس ليفرمور الوطني في إطار العقد DE - AC52 - 07NA27344.

Materials

Name Company Catalog Number Comments
Gold Disk Electrodes CH Instruments, Inc. CHI101 Can be re-used
Synthetic Probe DNA Biosearch Technologies Custom
Synthetic Target DNA Sigma-Aldrich Custom
Mercaptohexanol Sigma-Aldrich 725226-1G Store in cool dark place
Platinum Electrode BASi MW-1032 Can be re-used
Ag/AgCl Reference BASi MF-2052 Can be re-used
Polishing Cloth Buehler 40-7212
Alumina Polish Buehler 40-6325-016
Phosphate buffered saline Buffer, pH 7.4 Sigma-Aldrich P7059-1L
CH Instruments 605A CH Instruments, Inc. 605A Use any potentiostat
Newborn Calf Serum Sigma-Aldrich N4637-500ML Stored frozen
NanoDrop Fisher Scientific ND-2000 Use any UV-Vis
PCR Mix Bio-Rad 170-8862 Stored frozen
Cocaine Sigma-Aldrich C5776 DEA License Required
Procaine Sigma-Aldrich P9879 Substitute for Cocaine
Anti-Flag Antibody Sigma-Aldrich F1804-1mg

DOWNLOAD MATERIALS LIST

References

  1. Xiao, Y., Lai, R. Y., Plaxco, K. W. Preparation of electrode-immobilized, redox-modified oligonucleotides for electrochemical DNA and aptamer-based sensing. Nat. Protocols. 2, 2875-2880 (2007).
  2. Ricci, F., Lai, R. Y., Heeger, A. J., Plaxco, K. W., Sumner, J. J. Effect of Molecular Crowding on the Response of an Electrochemical DNA Sensor. Langmuir. 23, 6827-6834 (2007).
  3. White, R. J., Phares, N., Lubin, A. A., Xiao, Y., Plaxco, K. W. Optimization of Electrochemical Aptamer-Based Sensors via Optimization of Probe Packing Density and Surface Chemistry. Langmuir. 24, 10513-10518 (2008).
  4. Lubin, A. A., Vander Stoep Hunt, B., White, R. J., Plaxco, K. W. Effects of Probe Length, Probe Geometry, and Redox-Tag Placement on the Performance of the Electrochemical E-DNA Sensor. Analytical Chemistry. 81, 2150-2158 (2009).
  5. Lubin, A. A., Plaxco, K. W. Folding-Based Electrochemical Biosensors: The Case for Responsive Nucleic Acid Architectures. Accounts of Chemical Research. 43, 496-505 (2010).
  6. Lubin, A. A., Lai, R. Y., Baker, B. R., Heeger, A. J., Plaxco, K. W. Sequence-Specific, Electronic Detection of Oligonucleotides in Blood, Soil, and Foodstuffs with the Reagentless, Reusable E-DNA Sensor. Analytical Chemistry. 78, 5671-5677 (2006).
  7. Cash, K. J., Ricci, F., Plaxco, K. W. An Electrochemical Sensor for the Detection of Protein?Small Molecule Interactions Directly in Serum and Other Complex Matrices. Journal of the American Chemical Society. 131, 6955-6957 (2009).
  8. Baker, B. R. An Electronic, Aptamer-Based Small-Molecule Sensor for the Rapid, Label-Free Detection of Cocaine in Adulterated Samples and Biological Fluids. Journal of the American Chemical Society. 128, 3138-3139 (2006).
  9. Ferapontova, E. E., Olsen, E. M., Gothelf, K. V. An RNA Aptamer-Based Electrochemical Biosensor for Detection of Theophylline in Serum. Journal of the American Chemical Society. 130, 4256-4258 (2008).
  10. Stojanovic, M. N., Landry, D. W. Aptamer-Based Colorimetric Probe for Cocaine. Journal of the American Chemical Society. 124, 9678-9679 (2002).
  11. Stojanovic, M. N., Prada, P. de, Landry, D. W. Aptamer-Based Folding Fluorescent Sensor for Cocaine. Journal of the American Chemical Society. 123, 4928-4931 (2001).
  12. Cash, K. J., Heeger, A. J., Plaxco, K. W., Xiao, Y. Optimization of a Reusable, DNA Pseudoknot-Based Electrochemical Sensor for Sequence-Specific DNA Detection in Blood Serum. Analytical Chemistry. 81, 656-661 (2009).
  13. Xiao, Y. An Electrochemical Sensor for Single Nucleotide Polymorphism Detection in Serum Based on a Triple-Stem DNA Probe. Journal of the American Chemical Society. 131, 15311-15316 (2009).
  14. Zuo, X., Xiao, Y., Plaxco, K. W. High Specificity, Electrochemical Sandwich Assays Based on Single Aptamer Sequences and Suitable for the Direct Detection of Small-Molecule Targets in Blood and Other Complex Matrices. Journal of the American Chemical Society. 131, 6944-6945 (2009).
  15. Xia, F. An Electrochemical Supersandwich Assay for Sensitive and Selective DNA Detection in Complex Matrices. Journal of the American Chemical Society. 132, 14346-14348 (2010).
  16. Patterson, A. Using Triplex-Forming Oligonucleotide Probes for the Reagentless, Electrochemical Detection of Double-Stranded DNA. Analytical Chemistry. 82, 9109-9115 (2010).
  17. Ferguson, B. S. Integrated Microfluidic Electrochemical DNA Sensor. Analytical Chemistry. 81, 6503-6508 (2009).
  18. Swensen, J. S. Continuous, Real-Time Monitoring of Cocaine in Undiluted Blood Serum via a Microfluidic, Electrochemical Aptamer-Based Sensor. Journal of the American Chemical Society. 131, 4262-4266 (2009).
تصنيع أجهزة الاستشعار الكهروكيميائية الدنا للكشف Reagentless من الأحماض النووية والبروتينات والجزيئات الصغيرة
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Rowe, A. A., White, R. J., Bonham, A. J., Plaxco, K. W. Fabrication of Electrochemical-DNA Biosensors for the Reagentless Detection of Nucleic Acids, Proteins and Small Molecules. J. Vis. Exp. (52), e2922, doi:10.3791/2922 (2011).More

Rowe, A. A., White, R. J., Bonham, A. J., Plaxco, K. W. Fabrication of Electrochemical-DNA Biosensors for the Reagentless Detection of Nucleic Acids, Proteins and Small Molecules. J. Vis. Exp. (52), e2922, doi:10.3791/2922 (2011).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter