Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Immunology and Infection

Allelotyping PCR לזיהוי סלמונלה enterica Serovars enteritidis, הדר, היידלברג, ו Typhimurium

doi: 10.3791/3130 Published: July 22, 2011

Summary

אנו מתארים זמנית PCR לזיהוי מהיר של סלמונלה enterica serovars enteritidis, הדר, היידלברג, ו Typhimurium. Serovars סלמונלה מסוימים ניתן לזהות על ידי מיקוד זמנית PCR לגנים רצפים ייחודיים אשכול O-האנטיגן ביוסינתזה ו flagellin של serovar נתון. Serovar מוקצה אז סלמונלה לבודד המבוססת על הופעתו של, amplicons גודל מסוים (מוצר PCR) המתאים אלל היעד.

Abstract

בדיקות שוטפות PCRs מסחרי לזיהוי היעד סלמונלה גנים ייחודיים הסוג הזה. עם זאת, ישנם שני מינים, שישה מינים, ומעל 2,500 serovars סלמונלה שונים, לא כולם שווים משמעותם לבריאות הציבור. לדוגמה, מציאת ס enterica תתי IIIa אריזונה על חווה ביצה שולחן שכבה הוא חסר משמעות לעומת בידוד ש ' תת המין enterica אני serovar enteritidis, הגורם המוביל סלמונלה קשור לצריכה של ביצים השולחן. Serovars מזוהים על בסיס הבדלים antigenic ב lipopolysaccharide (LPS) (אנטיגן O) flagellin (H1 ו-H2 אנטיגנים). הבדלים אלו הם antigenic החיצונית של גיוון של גנים אללים גנים הקשורים פנוטיפ זה.

פיתחנו allelotyping, זמנית PCR כי המפתחות על הבדלים גנטיים בין ארבע הגדולות ס enterica תתי serovars מצאתי עופות הקשורים במחלה האנושית משמעותית בארה"ב. זוגות פריימר PCR היו ממוקדות גנים מפתח או רצפים ייחודיים serovar סלמונלה ספציפיים נועד לייצר amplicon עם גודל מסוים עבור הגן או האלל. סלמונלה serovar מוקצה לבודד מבוסס על שילוב של תוצאות ה-PCR מבחן ספציפי LPS ו flagellin אללים גנים. PCRs זמנית המתוארות במאמר זה הן ספציפיות לגילוי ש תת המין enterica אני serovars enteritidis, הדר, היידלברג, ו Typhimurium.

כאן אנו מדגימים כיצד להשתמש PCRs זמנית כדי לזהות serovar עבור סלמונלה לבודד.

Protocol

1. הכנת תבנית ה-PCR

הערה: על מנת למזער את זיהום PCR שריד, חשוב לשמור על מספר צעדים מפתח חשוב PCR פיזית, נפרדים זה מזה: הכנה 1) תבנית (DNA), 2) הגדרת ה-PCR, ו - 3) ג'ל אלקטרופורזה. מומלץ גם להשתמש טיפים מחסום כדי למנוע התרבות או מגיב זיהום pipetters.

  1. לחסן 1 מ"ל של לוריא Bertani מרק או בינוני מורכבות אחרות (עירוי הלב והמוח, Superbroth, וכו ') עם סלמונלה לבודד מהמושבה מבודד אחד. דגירה תרבות בין לילה ב 37 ° C.
  2. העברת 1 מ"ל ל סטרילית, 1.5 צינור microfuge מ"ל כושר, צנטריפוגה ההשעיה תא החיידק XG ב 4500 2 דקות ~. לתאי גלולה.
  3. למזוג supernatant, resuspend התא גלולה ב 1 מ"ל של אתנול 100% ולהגדיר בטמפרטורת החדר למשך 10 דקות. תאים גלולה כמו קודם (4500 XG, 2 דקות.), להסיר את התאים supernatant ו resuspend ב 1 מ"ל PBS.
  4. תאים צנטריפוגה (4500 XG, 2 דקות.) להשליך תאים supernatant ו resuspend ב 1 מ"ל סטרילי של DH 2 O.
  5. לדלל את ההשעיה התא הסופי 1 / 20 ב DH 2 O (5 μl/95 μl DH 2 O) ולאחסן ב -20 ° C. חיי המדף של תאים שלמים כתבנית PCR ב -20 ° C הוא כ חודש.

2. הגדרת ה-PCR

הערה: הכנה מחלק של תערובת התגובה PCR (תבנית מאגרים, oligonucletoideprimers, נוקלאוטידים ו-DNA פולימראז תקי) צריך להתבצע בחדר נפרד פיזית ייעודי נעשה רצוי עבודה PCR / UV.

הערה: PCR הקימו חדר חייב גם להיות עצמאי עם מקפיא המיועד -20 ° C לאחסון PCR ריאגנטים (מאגרים, primers oligonucleotide, ו נוקלאוטידים), אנזימים תבנית, pipetter ייעודי להגדיר עבור ההתקנה PCR, כפפות גומי חד פעמיות , מעיל מעבדה, טיפים מחסום, microtiter צלחות זכוכית, נימים, צינורות microfuge ו אקונומיקה 10% משטחי decontaminating. השתמש סט pipetter ייעודי (P10, P100, P1000 ו) לוותר ריאגנטים PCR. זו קבוצה פיפטה אסור לעזוב את תחנת העבודה הגדרת.

הערה: לקבל או ביולוגיה מולקולרית PCR כיתה DH 2 O ו aliquot 1 מ"ל לתוך צינורות קיבולת 1.5 מ"ל צנטריפוגות. לוותר aliquoted DH 2 O לאחר כל שימוש, כדי למנוע זיהום אפשרי צולבות. גישה דומה מומלץ עם חומרים כימיים אחרים PCR.

הערה: לטהר את אזור העבודה לפני השימוש עם תאורה UV ו / או לנגב את המשטחים עם אקונומיקה 10%. ללבוש מעיל מעבדה וכפפות לטקס בביצוע ההתקנה PCR. מזעור הלוך ושוב תנועה PCR הגדרת לאזורים שבהם התגובות PCR מודגרת ב thermocylcer ומוצרים PCR (amplicons) מופרדים על agarose ג'לים. אם לחזור לאזור PCR הגדרת, להיפטר זוג של כפפות לטקס שהנך לובש לשים על זוג חדש של כפפות.

  1. ביצוע פריימר מאסטר המניות DH 2 o ריכוז של 5x10 מ -4 לדלל את primers 1 / 20 ב DH 2 O (5 μl/95 μl DH 2 o; 25 מיקרומטר). רצף oligonucleotide עבור כל צבע יסוד הקלדה flagellin מתואר בטבלה 1.
  2. אחזר ריאגנטים PCR ותבנית מהמקפיא -20 ° C, ולאפשר ריאגנטים דגימות להפשיר את הקרח. השאירו את פולימראז ה-DNA תקי במקפיא עד הצורך.
  3. לוותר ריאגנטים עבור לערבב PCR התגובה allelotyping כפי שמתואר בטבלה 1.
  4. לוותר 9μl של תערובת התגובה PCR לתוך כל אחד 10 בארות תחתית עגולה צלחת microtiter סטרילי, 96, טוב, קלקר, החל בראש העמודה (למשל A1) ולעבור את הטור לראש הבא.
  5. הוסף 1 μl של DH 2 O ל μl 9 של ה-PCR לערבב (אין שליטה DNA) לבאר הראשון (A1), 0.5μl של תבניות בקרה חיובית (i / g, מ הקלדה primers ו-Typhimurium enteritidis; r/z10 הקלדת primers-היידלברג הדר; 1,2 ו / e, n, x-הקלדה primers Typhimurium והדר) כדי μl 9 תמהיל PCR ב 2 nd היטב (B1), ו - 1 μl של Escherichia coli K12 DH5α ל 9 מ"ל של תערובת PCR בבאר השלישית (C1).
  6. גם עבור כל אחד נוסף (D1-H1, A2, B2), להוסיף 1 μl של תבנית מדגם מופשר ל μl 9 של תערובת התגובה PCR. עבור i / g, מ allelotyping PCR, ש enterica serovar Typhimurium (i) enteritidis (ז, מ ') לשמש שולטת חיובית, סלמונלה serovars היידלברג (r) והדר (Z10) הם שולטת חיובית עבור r / z 10 multiplex allelotyping PCR.
  7. מקום 10 μl קיבולת זכוכית לתוך הנימים בעלי המיועד טכנולוגיה איידהו Rapidcycler (8).
  8. מאובטח פעם בעל, לטעון כל נימי זכוכית עם תערובת התגובה PCR ידי נגיעה נימי אלבארות התחתון של הצלחת microtiter. הטה את המחזיק כדי לאפשר לנוזל לעבור את הצינור לספק רווח בין הקצוות תמהיל PCR לפני החום איטום צינורות זכוכית עם פנס בוטאן לאטום את שני הקצוות של הנימים.
  9. מניחים את צינורות נימי מחזיק לתוך טכנולוגיה איידהו Rapidcycler ולהשתמש תוכניות thermocycler המתואר בטבלה 1 עבור primers allelotyping שונים כדי להפעיל את ה-PCR.
  10. המשיכו לשלב ג'ל אלקטרופורזה כאשר תוכנית thermocycler הושלמה.

3. ג'ל אלקטרופורזה

הערה: יש ללבוש חלוק מעבדה שונים המיועדים לשימוש במעבדה אלקטרופורזה ו זוג חדש של כפפות גומי חד פעמיות.

הערה: יש ללבוש משקפי מגן UV לעין מגן או מגן פנים ותמיד היו כפפות בעת הטיפול ברומיד ethidium, במיוחד ג'לים agarose.

  1. הכן 100 מ"ל מותכת 1.5% (w / v) ביולוגיה מולקולרית כיתה ב agarose 1xTAE (או 1X TBE) חיץ אלקטרופורזה (7) שוב ושוב על ידי חימום במיקרוגל ההשעיה agarose מערכת בהספק 20% מרווחי 2-5 דקות עם ראייה תקופתיות בדיקה. הגדר את agarose מותכת באמבט מים C ° 60 עד equilibrates את הטמפרטורה של המים באמבטיה.
  2. הגדרת תבנית ג'ל במסרק לפני מזיגת agarose מותכת. בחר מסרק עם שיניים ג'ל מספיק כדי לייצר בארות מספיק שולטת, דוגמאות, ולפחות 3 תקנים משקל מולקולרי עבור המיקומים שלהם בקצוות באמצע הג'ל agarose.
  3. הוסף 2 μl של ethidium ברומיד (10 מ"ג / מ"ל) עד ​​100 מ"ל של מותך 1.5% (w / v) agarose ב 1xTAE (או TBE), בעדינות בקבוק מערבולת לערבב, להימנע לייצר בועות, בעדינות לשפוך את תכולת הבקבוק למרכז התבנית ג'ל על 15 על 10 ס"מ agarose ג'ל. השתמש קצה של נייר או מגבת נייר כדי להסיר בועות הג'ל agarose.
  4. תן עובש ג'ל להגדיר בטמפרטורת החדר עד agarose מבצרת (~ 30-45 דקות). מעבירים את המגש עם ג'ל ג'ל & המסרק הצוללת, תא אלקטרופורזה אופקי המכיל 1X טה (או 1X TBE) חיץ אלקטרופורזה. בעדינות להסיר את המסרק של הג'ל agarose.
  5. בדוק את המיקום של המגש ג'ל יחסית הקתודה או הקוטב החיובי של החדר אלקטרופורזה כדי להיות בטוח מוט זה בחלק התחתון של הג'ל. הערה: זכרו את ה-DNA מטען שלילי נודד לכיוון הקתודה (כלומר, "לרוץ אדום").
  6. Premix 200 μl של סמני דנ"א משקל מולקולרי (0.25 מיקרוגרם / μl) עם 40 μl של דיי DNA 6X טוען. טען 4.8 μl של ה-DNA מעורבבים מראש מולקולרית משקל דה מרקר XIV אל, בארות first האמצעי האחרון.
  7. טען כל אחד מתחיל עם דגימות ה-PCR גם 2 וגם להתקדם היטב כל הבאים, נע משמאל לימין. הימנע טעינת המדגם בכל אחד בארות המכיל את תקן משקל מולקולרי.
  8. כדי לטעון דוגמאות הכלול זכוכית בכל נימי:
    1. הסר כל נימי מבעל שלה לחרוט בשני הקצוות של נימי עם חותך זכוכית.
    2. המקום האגודל והאצבע של שתי הידיים משני צדדיו של נימי בסימן חותך את הכוס להצמיד את נימי.
    3. מניחים את מנפק על נימי מול סוף לערבב את תגובת ה-PCR ולאט לאט להפוך את הבוכנה עם כיוון השעון עד נוזלי הוא בתחתית של התחתית.
    4. מניחים את נימי לבאר להיות טעון ולאט לאט להפוך את הבוכנה בכיוון השעון לוותר המדגם Ficoll משוקלל לתוך agarose היטב. להיזהר לא לנקב את היטב עם נימי או להציג את בועת אוויר לתוך הבאר על ידי הפיכת גם בעבר הרבה כאשר האחרון של הנוזל עוזב את נימי.
  9. לאחר כל דגימות סטנדרטים נטענים, להגדיר את מתח קבוע של אספקת החשמל ל 90 V (9 וולט / ס"מ agarose ג'ל).
  10. הפסק אלקטרופורזה פעם הצהוב צבע (Taurazine) הקדמי הוא 1 ס"מ מהחלק התחתון של הג'ל.
  11. לאחר אלקטרופורזה הושלמה, להעביר את הג'ל על transilluminator UV לדמיין שברי דנ"א תקן משקל מולקולרי. לכידת תמונה על סרט פולארויד באמצעות מצלמת פולארויד עם כתום זכוכית המסנן (הגדרות: 2 x, y ו - 4.5) או כדימוי דיגיטלי באמצעות מצלמה CCD ותמונה להדפיס עם מדפסת תרמית.
  12. מניחים את מחזיקי נימי ב אקונומיקה 10% דק '15-30. לשטוף 3 פעמים עם DH 2 O ומקום שוב בחדר ההתקנה PCR לייבוש באוויר.

4. נציג Multiplex PCR תוצאות

תוצאות עבור allelotyping PCR של סלמונלה מבודד 1-10 מוצגים באיור 1 (נתיבי 3-12) ופירשו כדלקמן. ייעוד האלל O ניתנת סלמונלה לבודד מבוסס על amplicon (מוצר PCR) התאמה בגודל לשלוט PCR וחזה כמו פריימר את האלל O קובע בשימוש (3): B-560bp, C1-340bp, C2-400 נ"ב, D1-620 נ"ב, ו-E1-280 נ"ב. עבור מבודד נבדק עם allelotyping O-PCR (איור 1 א), אנו מוקצה O אללים B (מסלולים 10 -13), C1 (מסלולים 7-9), C2 (נתיבי 4, 5), D1 (מסלול 3), ו - E1 (מסלול 6) עד סלמונלה עשר מבודד נבדק נתיבי 3-12. מבודד אלה סלמונלה אותו נבדקו, באותו סדר כמו איור. 1A, עבור אללים H1 i; גרם, מ '; r; ו Z10 (איור 1 ב', ג'). שוב, אלל H1 מוקצה לכל לבודד תלויה בנוכחות amplicon התאמת גודל לשלוט PCR ו כצפוי את פריימר 4 אלל H1 קובע בשימוש (3): i-510 נ"ב (איור 1B, מסלול 2 ;) ז, מ-310 נ"ב (איור 1B, נתיב 2); r-170 נ"ב (איור 1C, נתיב 2); ו Z10-360 נ"ב (איור 1C, מסלול 2). אללים H1 חולקו אחד מעשרת מבודד סלמונלה: i - מבודד 3 ו - 8 (איור 1B, נתיבי 5 & 10); g, m-1 ו -5 מבודד (איור 1B, נתיבים 3 & 7), r ל מבודד 6 ו -9 (איור 1C, נתיבי 8 & 11). ו Z10 עד 2 מבודד, 7, ו -10 (איור 1C, נתיבים 4, 9, & 12) סלמונלה לבודד 4 היה שלילי במשך ארבע אללים H1 שנבדקו. לבסוף, מבודד סלמונלה נבדקו על ידי ה-PCR עבור אללים H2 הקשורות 1,2, 1,5, 1,6, 1,7 ו-e אנטיגן מורכב, n, x, e, n, z15 מורכב אנטיגן. פריימר מגדיר עבור H2 1,2, 1,5, 1,6, 1,7 מורכבים H2 דואר, n, x, e, n, z15 לייצר מורכבות 290 נ"ב ו 150 amplicons נ"ב, בהתאמה (3). מגדיר פריימר אינה יכולה להבחין אללים ספציפיים בתוך H2 H2 או אנטיגן מורכב להקצות סוג אלל סופי, לשעבר. 1,2, כדי לבודד (3) סלמונלה מבודד 4, 6, 8-10 היו חיוביות עבור אללים H2 H2 הקשורות 1,2,. 1,5, 1,6, 1,7 מורכב אנטיגן, בעוד מבודד 2 ו 7 היו חיוביות עבור אללים H2 הקשורים הדואר, n, x, e, n, z15 מורכב אנטיגן (מידע לא מוצג). בעוד סלמונלה מבודד 1, 3 ו 5 היו שליליות עבור שני קומפלקסים אנטיגן H2, רק מבודדת 1 ו 5 היו שליליות עבור H2 flagellin, כפי שנקבע באמצעות כללי H2 flagellin PCR (1) (הנתונים לא מראים). תוצאות אלו מסוכמים בטבלה 2 יחד עם serovar סלמונלה משוערת המוקצה לכל לבודד.

איור 1
באיור 1. Multiplex PCR לזיהוי O ספציפיים אללים H הקשורים ס enterica Serovars enteritidis, הדר, היידלברג, ו Typhimurium. (A) O אלל Multiplex PCR. (B, C) Multiplex H1 אלל PCR לזיהוי אללים Flagellin: i / g, מ '(B) r/z10 (C). Lanes 1and 13: 100 סולם נ"ב (Promega; במדיסון, וויסקונסין); מסלול 2: זמנית שולטת PCR עבור אללים O B, C1, C2, D1, ו-E (A), אללים H1 i / g, מ '(B) אללים H1 r/z10 (ג); ואת נתיבי 3-12: סלמונלה מבודד 10/01 (טבלה 2).

PCR מאסטר מיקס Thermocycler (Rapidcycler)
ריאגנטים הרכב / ריכוז כמות   פרמטרים צפוי גודל
H1 i / g, מ '
DH 2 O 63 μl תוכנית 1 94 ° C עבור 1 דקות
חיץ 10X-PCR 20 מ"מ MgCl 2 10 μl תוכנית 2 94 ° C עבור 1 s
500 mMTris pH8 55 ° C עבור 1 s
2.5 מ"ג / מ"ל ​​BSA 72 מעלות של 20
5% Ficoll 400 במשך 40 מחזורים
10 mMTartrazine Slope = 2.0
פריימר i (f) * AACGAAATCAACAACAACCTGC 2 μl תוכנית 3 72 מעלות צלזיוס למשך 4 דקות 510 נ"ב
פריימר i (r) * TAGCCATCTTTACCAGTTCCC 2 μl
פריימר גרם, מ (ו) * GCAGCAGCACCGGATAAAG 2 μl 310 נ"ב
פריימר גרם, מ '(r) * CATTAACATCCGTCGCGCTAG 2 μl
DMSO 5 μl
dNTP 10 mM 2 μl
תקי 5 יחידות / μl 2 μl
90 μl
H1 r / z 10
DH 2 O 55 μl תוכנית 1 94 ° C עבור 1 דקות
חיץ 10X-PCR 30 מ"מ MgCl 2 10 μl תוכנית 2 94 ° C עבור 1 s
500 mMTris pH8 55 ° C עבור 1 s
2.5 מ"ג / מ"ל ​​BSA 72 מעלות של 20
5% Ficoll 400 במשך 40 מחזורים
10 mMTartrazine Slope = 2.0
פריימר r (f) * CCTGCTATTACTGGTGATC 4μl תוכנית 3 72 מעלות צלזיוס למשך 4 דקות 170 נ"ב
פריימר r (r) * GTTGAAGGGAAGCCAGCAG 4μl
פריימר z 10 (ו) * GCACTGGCGTTACTCAATCTC 4μl 360 נ"ב
פריימר z 10 (r) * GCATCAGCAATACCACTCGC 4μl
DMSO 5 μl
dNTP 10 mM 2 μl
תקי 5 יחידות / μl 2 μl
90 μl
PCR מאסטר מיקס Thermocycler (Rapidcycler)
ריאגנטים הרכב / ריכוז כמות   פרמטרים צפוי גודל
H2 1,2 / e, n, x
DH 2 O 63.6 μl תוכנית 1 94 ° C עבור 1 דקות
חיץ 10X-PCR 20 מ"מ MgCl 2 10 μl תוכנית 2 94 ° C עבור 1 s
500 mMTris pH8 55 ° C עבור 1 s
2.5 מ"ג / מ"ל ​​BSA 72 מעלות של 20
5% Ficoll 400 במשך 40 מחזורים
10 mMTartrazine Slope = 2.0
פריימר 1,2 (ו) * AGAAAGCGTATGATGTGAAA 2 μl תוכנית 3 72 מעלות צלזיוס למשך 4 דקות 290 נ"ב
פריימר 1,2 (r) * ATTGTGGTTTTAGTTGCGCC 2 μl
פריימר e, n, x (ו) * TAACTGGCGATACATTGACTG 2 μl 150 נ"ב
פריימר e, n, x (r) 1 TAGCACCGAATGATACAGCC 2 μl
DMSO 5 μl
dNTP 10 mM 2 μl
תקי 5 יחידות / μl 2 μl
90 μl
Generic H2
DH 2 O 72 μl תוכנית 1 94 ° C עבור 1 דקות
חיץ 10X-PCR 30 מ"מ MgCl 2 10 μl תוכנית 2 94 מעלות צלזיוס למשך 10 שניות
500 mMTris pH8 45 מעלות צלזיוס למשך 10 שניות
2.5 מ"ג / מ"ל ​​BSA 72 מעלות צלזיוס למשך 35 שניות
5% Ficoll 400 במשך 40 מחזורים
10 mMTartrazine Slope = 2.0
פריימר fljB (ו) * CAAGTAATCAACACTAACAGTC 2 μl תוכנית 3 72 מעלות צלזיוס למשך 4 דקות 1500 bp
פריימר fljB (r) * TTAACGTAACAGAGACAGCAC 2 μl
dNTP 10 mM 2 μl
תקי 5 יחידות / μl 2 μl
90 μl

טבלה 1. פרוטוקול סלמונלה flagellinallelotyping PCR: הרכב, התנאים, ואת התוצאות הצפויות.

* ריכוז המניות עבודה של primers PCR oligonucleotide הוא 25 מיקרומטר

לבודד O אלל H1 אלל H2 אלל Serovar
  ב C1 C2 D1 E אני ז, מ ' r Z10 1,2, 1,5, 1,6, 1,7 e, n, x, e, n, z15 Generic 1  
1 - - - + - - + - - - - - Enteritidis
2 - - + - - - - - + - + + הדר / איסטנבול 3
3 - - + - - + - - - - - + קנטאקי
4 - - - - + - - - - + - + לא ידוע
5 - + - - - - + - - - - - מונטווידאו
6 - + - - - - - + - + - + Infantis או וירצ'וב 2
7 - + - - - - - - + - + + מבאנדקה
8 + - - - - + - - - + - + Typhimurium
9 + - - - - - - + - + - + היידלברג
10 + - - - - - - - + + - + חיפה

טבלה 2. Allelotyping תוצאות PCR (איור 1) ואת הכינוי Serovar סלמונלה בהתבסס על זיהוי O, H1, H2 ו אללים

> 1 H2 PCR מייצרת amplicon 1.5 kb סלמונלה עבור כל בעל H2 flagellin, ללא קשר אלל H2 (1). PCR זה משמש כדי להבדיל מן monophasic סלמונלה biphasic.
2 H2 זמנית PCR אינה יכולה להבחין בין אללים שונים עבור H2 1,2, 1,5, 1,6, 1,7 מורכב אנטיגן (3).
3 phage המרה ש enterica serovar הדר משנה LPS O אנטיגן לייצר serovar באיסטנבול. Allelotyping O-PCR לא יכול להבחין בשינויים הללו עדין / antigenic גנטית.

Serovar 1 O אלל H1 אלל H2 אלל
  ב C1 C2 D1 E אני ז, מ ' r Z10 1,2, 1,5, 1,6, 1,7 e, n, x, e, n, z15 Generic 2
קליפורניה + - - - - - + - - - - -
Typhimurium + - - - - + - - - + - +
היידלברג + - - - - - - + - + - +
חיפה + - - - - - - - + + - +
מונטווידאו - + - - - - + - - + - +
Othmarschen - + - - - - + - - - - -
Athinai - + - - - + - - - - + +
Papuana - + - - - - - + - - + +
מבאנדקה - + - - - - - - + - + +
Chincol - - + - - - + - - - + +
קנטאקי - - + - - + - - - - - +
הדר / איסטנבול 3 - - + - - - - - + - + +
Enteritidis - - - + - - + - - - - -
Seremban - - - + - + - - - + - +
Campinense - - - + - - - + - - + +
לומה - - - + - - - + - - - +
פורטלנד - - - + - - - - + + - +
ברואנדה - - - + - - - - + - + +
Treguier - - - + - - - - + - - +
סימי - - - - + - - + - - + +
Weltevreden - - - - + - - + - - - +
בקריסטיאנסטאד - - - - + - - - + - + +
ביאפרה - - - - + - - - + - - +

3. טבלת סלמונלה enterica Serovars מזוהה על ידי Allelotyping PCR

1 serovars מודגשת מודגש הם אלה נתקלים לעתים קרובות יותר על ידי אבחון או מזון מעבדה במיקרוביולוגיה.
2 H2 PCR מייצרת amplicon 1.5 kb סלמונלה עבור כל בעל H2 flagellin, ללא קשר אלל H2 (1). PCR זה משמש כדי להבדיל מן monophasic סלמונלה biphasic.
3 phage המרה ש enterica serovar הדר משנה LPS O אנטיגן לייצר serovar באיסטנבול. Allelotyping O-PCR לא יכול להבחין בשינויים הללו עדין / antigenic גנטית.

Discussion

רוב זמינים מסחרית בדיקות PCR לזיהוי מטרות גנים סלמונלה ייחודית הסוג (דוגמה invA). עם זאת, לא סלמונלה כולם שווים ביכולתם לגרום למחלה בבני אדם או שכיחות בקרב אוכלוסיות בעלי חיים. זיהוי מוקדם של הבדלים antigenic ב סלמונלה LPS-אנטיגן O ו flagellinH1 ו אנטיגנים H2 יש להוביל הבידול של סלמונלה אל מעל 2500 serovars מבוסס על ההבדלים הללו antigenic. ישנם 46 אנטיגנים O נבדל ברורה flagellin 86 (H) אנטיגנים מזוהה סלמונלה הסוג. סלמונלה יכול להחזיק אחד (H1) או שניים שונים (H1 & H2) flagellins. שילוב שונה של O, H1, H2 ו אנטיגנים להסביר את serovars סלמונלה 2500 מוכרת היום. Serovar מוקצה מבוסס על הנוסחה antigenic נגזר זיהוי של O הפרט אנטיגנים H. הנוסחה antigenic כתוב כמו O: H1: H2, והיכן "-", מתייחס בהעדר H1 או H2 flagellin ו "NT" (לא typeable) עבור סלמונלה שלילי אנטיגן-O. לדוגמה, Typhimurium serovar מוקצה ס enterica לבודד עם הנוסחה antigenic ב: אני: 1,2 בעוד enteritidis ניתן לבודד עם D1 הנוסחה: g, מ ': -. זו וריאציה antigenic באוכלוסייה סלמונלה היא הביטוי החיצוני של הבדלים ברמת נוקלאוטיד כי ולכן ניתן לנצל בקלות על ידי PCR.

זיהינו את ההבדלים הגנטיים הקשורים O ספציפיים אללים H לפתח allelotyping PCR לזיהוי ס enterica serovars: enteritidis, הדר, היידלברג, Typhimurium ו (3). המשימה דיווח נכון של סלמונלה serovar דורש בדיקה של כל אללים הקשורים O: H1: נוסחאות H2 antigenic עבור enteritidis (D1: g, מ ': -), הדר (C2: Z10: e, n, x), היידלברג (B : r: 1,2), ו Typhimurium (B: i: 1,2). ללא ידע של האלל O או אנטיגן, הממצא של גרם H1, אלל מ 'לבד לא בהכרח לזהות סלמונלה לבודד כמו enteritidis כמו סלמונלה serovars אחרים: Agona, קליפורניה, מונטווידאו, גם להחזיק את זה אלל זהה. בעוד ה-PCR allelotyping תוכנן במקור כדי לזהות ביטוי שהוזכר serovars סלמונלה, בדיקה זו ניתן לזהות נוסף 19 serovars (לוח 3). PCR allelotyping שלנו תוכנן במקור כדי לזהות אללים O ו-H. בפועל, זה הפך להיות מעשי יותר וחסכונית לנו לזהות את O-אנטיגן על ידי מבחן התלכדות שקופיות, באמצעות O-antisera ספציפיים, ולא לבצע את allelotyping O PCR כאשר עובדים עם תרבויות סלמונלה מבודדים. עם זאת, אנו ממליצים להשתמש allelotyping O PCR אם המעבדה שלך משתמשת PCR כמסך (2) או להקליד סלמונלה מבודד שהוגשו על FTA כרטיסים (6), וכוללים סלמונלה ספציפי PCR עם מסך הראשון של דגימות (4 ). הגבל את PCRs allelotyping רק דגימות אלה המזוהות סלמונלה על ידי PCR או בדיקות ביוכימיות / antigenic.

הפרוטוקול המתואר במאמר זה כבר מותאם לשימוש עם טכנולוגיה איידהו Rapidcycler, thermocycler אוויר חם אשר מאפשר להקטין כרכים התגובה ורץ התנאים התגובה בפחות זמן מאשר thermocyclers לחסום רבים חימום. כדי להתאים את פרוטוקול לשימוש עם thermocycler בלוק חימום עשויים לדרוש אופטימיזציה התנאים התגובה אמפירית על ידי הפחתת / העלאת הטמפרטורה חישול, התאמת ריכוזי פריימר, או התאמת MgCl 2 בריכוז. לדוגמה, אנו צריכים להתאים את פרוטוקול המחקר MJ-200 PTC thermocycler כדלקמן. עבודה עם הכרכים אותה התגובה המתוארת בטבלה 1, מניות הפועלים concentrationof קבוצת פריימר הייתי מדולל ל -2.5 מיקרומטר, הטמפרטורה חישול ירדה מ 55 ° C עד 45 ° C, ופעמים הדגירה על denaturation, חישול הרחבה צעדים הוארך עד s 20 עבור i / g, מ allelotyping PCR. לאחר שולט חיוביות ושליליות המתאים חיוניים עד תחילת אופטימיזציה ראשונית לכל PCR, לרבות הפרוטוקולים שפורסמו. אנו ממליצים על רכישת serovars סלמונלה ידוע, במיוחד Anatum (E1: e, h: 1,6), enteritidis (D1: ז, מ ': -), הדר (C2: Z10: e, n, x), היידלברג (B: r : 1,2), מונטווידאו (C1: g, m, s: 1,2,7) ו Typhimurium (B: i: 1,2); ו Escherichia coli K12 מעבדה זן (DH5α, LE393, JM109 וכו ' ) כפקדי חיובי ושלילי בהתאמה עבור בדיקות PCR allelotyping המתואר במאמר זה. כמה אלה serovars סלמונלה ישמש שולטת חיובי או שלילי, בהתאם אלל נבדק.

אמצעי זהירות מסוימים והנחיות צריך להיות מלווה בעת ביצוע זה אחרת אבחון PCR. ראשית, ההפרדה הפיזיתהכנת תבנית, PCR הגדרת, ועל ג'ל אלקטרופורזה היא קריטית במניעת PCR ניתן לשאת על זיהום דיווח מוטעה של תוצאות חיוביות שגויות. בנוסף, הכללת הבקרות המתאימות יש צורך בכל PCR שגרתיות כמו פקדים אלה לזהות בעיות כשהן מתעוררות לסייע בפרשנות של התוצאות (5). והכי חשוב, עקביות היא חיונית, במיוחד בכל הקשור לתנאים electrophoretic עבור andestimation (PCR מוצר) זיהוי amplicon גודל amplicon. כדי להמחיש את הנקודה הזו, אנחנו בכוונה מושעה אלקטרופורזה מוקדם יותר נועד באיור 1 א. סטנדרטים משקל מולקולרי (נתיבים 1 ו 13) ושליטה חיובית (מסלול 2) לא מופרדים מספיק כדי להעריך במדויק בגדלים או לצפות הפרדה של שברי DNA שבו יש הבדלים קטנים (~ 50 נ"ב) בגדלים. הפרדה נאותה של קטעי DNA, בעיקר סטנדרטים משקל מולקולרי, חיונית כמו דיווח חיוביות תלויה אמידה מדויקת של גודל amplicon ו הבחנה "חיובי אמיתי" מתוך הלא ספציפית amplicons כי הם נצפו לעתים בניהול היומיומי של כל ה-PCR (5 ). לדוגמה, יש amplicon שאינם ספציפיים 1B איור, מסלול 7 (~ 700 נ"ב בגודל). אילו אלקטרופורזה הופסק מוקדם מדי, כאשר מול לצבוע רק בשלב חצי הדרך הג'ל agarose, לא תהיה הבחנה קטנה בין 500 לבין 700 נ"ב נ"ב שברי DNA. לכן, מדגם בנתיב 7 היה דווח בטעות חיובי הן עבור i ו-g, אללים מ.

לבסוף, צריך להכיר את מגבלות הקשורות מבחן כלשהו. כמה allelotyping H1/H2 PCR אין לי כוח מפלה להבחין הבדלים גנטיים קלים אללים השייכים H2 1,2, 1,5, 1,6, 1,7 מורכב אנטיגן, דואר, n, x / e , n, z15 מורכב אנטיגן ואת מורכבות G H1 אנטיגן, הכוללת את, גרם אלל מ. אחד או שניים שינויים חומצת אמינו להסביר את epitopes שונה נוכח אלה אנטיגנים flagellar. זה היה קשה עבורנו ולכן לעיצוב primers שעלול לנצל זוג אלה בודד לפעמים בסיס הבדלים ברצף הגן flagellin (3). לדוגמה, סלמונלה serovars דבלין (D1: g, p: -) וברטה (D1: F, G, t: -) גם PCR חיובי עם g שלנו, mallelotyping primers. Allelotyping primers H2 אינה יכולה להבחין Typhimurium (B: i: 1,2) מ לאגוס (B: i: 1,5), היידלברג (B: r: 1,2) מ ברדפורד (B: r: 1,5), Winneba (B: r: 1,6), או רמו (B: r: 1,7), או הדר (C2: Z10: e, n, x) מ Glostrup (C2: Z10: e, n, z15). בעוד הסבירות להיתקל בכמה serovars אלה: לאגוס, ברדפורד, Winneba, רמו או Glustrup הוא מרוחק, היא האפשרות דורש גם מתן הצהרה על הגבלה של בדיקות או בדיקה נוספת מאשרות.

לסיכום, זה serotyping PCR מבוססי במהירות מזהה ס enterica serovars enteritidis, הדר, היידלברג Typhimurium, ו-O, H1, H2 ו אללים הקשורים serovars 19 נוספים. Assay זהו מהירה, חסכונית מיקרוביולוגית חלופית לגישה המסורתית סלמונלה serotyping.

Disclosures

אין ניגודי אינטרסים הכריז.

Acknowledgments

עבודה זו נתמכה על ידי משרד החקלאות מענקים 1999-35212-8680, 2005-01378, ו 2010-04288-01, USDA קרנות פורמולה ומדינת גרנט לרפואה וטרינרית של גאורגיה המחקר החקלאי. פרוטוקול המתוארים בפרסום זה פותחה לשימוש על ידי סטודנטים במסגרת קורסי מחקר מכוון: MIBO 4900L, ג'ין 4960H, BCMB 4960L ו 4960H Biol באוניברסיטת ג'ורג'יה בשימוש על ידי התלמידים על מספר פרויקטים של מחקר באפידמיולוגיה מולקולרית של מאורר מעבדה. אנו רוצים להודות סטודנטים רבים אשר ביצעו מחקר מאורר ולי מעבדות, ויו"ר המחלקה שלנו, ג'ון Glisson לתמיכה מאמצינו לשלב הוראה לתואר ראשון עם המחקר.

Materials

Name Company Catalog Number Comments
Luria Bertani Fisher Scientific (or any comparable source)
Microfuge tubes Fisher Scientific 1.5 ml capacity (or any comparable source)
Ethanol Fisher Scientific 200 proof (or any comparable source)
dH2O Sigma-Aldrich Molecular Biology Grade (or any comparable source; PCR only)
10 x PCR Buffer: Idaho Technologies 20 mM MgCl2 (buffer comes with BSA, Ficoll and Tartrazine)
30 mM MgCl2
40 mM MgCl2
PCR primers
DMSO
dNTP Roche Group (or any comparable source)
Taq DNA Polymerase Denville Scientific (or any comparable source)
Capillary pipettes Idaho Technologies 10 µl volume
Rapid Cycler Idaho Technologies
Agarose Bio-Rad Low EEO; Molecular Biology Grade (or any comparable source)
50 X TAE Buffer or 5X TBE Buffer Fisher Scientific (or any comparable source)
Ethidium bromide Bio-Rad (or any comparable source)
Horizontal, submersible gel electrophoresis chamber with gel mold Bio-Rad (or any comparable source)
Power supply Bio-Rad (or any comparable source)
Molecular Imager Gel Doc System Bio-Rad (or any comparable source)
Table 4. Materials

DOWNLOAD MATERIALS LIST

References

  1. Dauga, C., Zabrovskaia, A., Grimont, P. A. D. Restriction fragment length polymorphism analysis of some flagellin genes of Salmonella enterica. J. Clin. Microbiol. 36, 2835-2843 Forthcoming.
  2. Hong, Y., Liu, T., Lee, M. D., Hofacre, C. L., Maier, M., White, D. G., Ayers, S., Wang, L., Berghaus, R., Maurer, J. A rapid screen of broth enrichments for Salmonella enterica serovars Enteritidis, Hadar, Heidelberg, and Typhimurium using an allelotyping multiplex PCR that targets O and H antigen alleles. J. Food Prot. 72, 2198-2201 (2009).
  3. Hong, Y., Liu, T., Lee, H. ofacre, Maier, C. L., White, M., Ayers, D. G., Wang, S., Berghaus, L., R, M. aurer J.Rapid screening of Salmonella enterica serovars Enteritidis, Hadar, Heidelberg and Typhimurium using a serologically-correlative allelotyping PCR targeting the O and H antigen alleles. BMC Microbiol. (2008).
  4. Liu, T., Liljebjelke, K., Bartlett, E., Hofacre, C. L., Sanchez, S., Maurer, J. J. Application of nested PCR to detection of Salmonella in poultry environments. J. Food Prot. 65, 1227-1232 (2002).
  5. Maurer, J. J. Rapid detection and limitation of molecular techniques. Ann. Rev. Food Sci. Tech. 2, 259-279 (2011).
  6. Moscoso, H., Alvarado, I., Hofacre, C. L. Molecular analysis of infectious bursal disease virus from bursal tissues collected on FTA filter paper. Avian Dis. 50, 391-396 (2006).
  7. Sambrook, J., Fritsch, E. F., Maniatis, T. Molecular cloning: a laboratory. 2nd ed, Cold Spring Harbor Laboratory Press. Cold Spring Harbor, N.Y. (1989).
  8. Wittwer, C. T., Fillmore, G. C., Hillyard, D. R. Automated polymerase chain reaction capillary tubes with hot air. Nucleic Acids Res. 17, 4353-4357 (1989).
Allelotyping PCR לזיהוי<em> סלמונלה enterica</em> Serovars enteritidis, הדר, היידלברג, ו Typhimurium
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Maurer, J. J., Lee, M. D., Cheng, Y., Pedroso, A. An Allelotyping PCR for Identifying Salmonella enterica serovars Enteritidis, Hadar, Heidelberg, and Typhimurium. J. Vis. Exp. (53), e3130, doi:10.3791/3130 (2011).More

Maurer, J. J., Lee, M. D., Cheng, Y., Pedroso, A. An Allelotyping PCR for Identifying Salmonella enterica serovars Enteritidis, Hadar, Heidelberg, and Typhimurium. J. Vis. Exp. (53), e3130, doi:10.3791/3130 (2011).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter