Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Immunology and Infection

Een Allelotyping PCR voor het vaststellen van Salmonella enterica Serovars Enteritidis, Hadar, Heidelberg, en Typhimurium

doi: 10.3791/3130 Published: July 22, 2011

Summary

Beschrijven we een multiplex-PCR voor de snelle detectie van Salmonella enterica serovars Enteritidis, Hadar, Heidelberg, en Typhimurium. Specifieke Salmonella serovars kunnen worden geïdentificeerd door zich te richten een multiplex PCR om genen en sequenties die uniek zijn voor het O-antigen biosynthese cluster en flagelline van een bepaalde serovar. Serovar wordt vervolgens toegewezen aan een Salmonella isoleren op basis van het optreden van de specifieke, grootte amplicons (PCR-product) die overeenkomt met het doel allel.

Abstract

De huidige commerciële PCR's test voor het identificeren van Salmonella doelwitgenen uniek is voor dit geslacht. Echter, er zijn twee soorten, zes ondersoorten, en meer dan 2.500 verschillende Salmonella serovars, en niet allemaal gelijk zijn in hun betekenis voor de volksgezondheid. Bijvoorbeeld, het vinden van S. enterica subspecies IIIa Arizona op een tafel ei laag boerderij is onbeduidend in vergelijking met de isolatie van S. enterica serovar Enteritidis Ik ondersoort, de belangrijkste oorzaak van salmonellose gekoppeld aan de consumptie van eieren. Serovars zijn geïdentificeerd op basis van antigene verschillen in lipopolysaccharide (LPS) (O antigen) en flagelline (H1 en H2 antigenen). Deze antigene verschillen zijn het uiterlijk van de diversiteit van genen en gen-allelen in verband met dit fenotype.

We hebben een allelotyping, multiplex PCR die toetsen op genetische verschillen tussen de vier grote S. enterica subspecies Ik serovars gevonden in pluimvee en gepaard met een significante menselijke ziekten in de VS. De PCR-primer paren werden gericht op de belangrijkste genen of sequenties die uniek zijn voor een specifieke Salmonella serovar en ontworpen om een amplicon met een grootte van specifiek voor dat gen of allel te produceren. Salmonella serovar wordt toegewezen aan een isoleren gebaseerd op de combinatie van de PCR-test resultaten voor specifieke LPS en flagelline gen allelen. De multiplex PCR's beschreven in dit artikel zijn specifiek voor de detectie van S. enterica subspecies I serovars Enteritidis, Hadar, Heidelberg, en Typhimurium.

Hier laten we zien hoe het multiplex PCR's te gebruiken om serovar te identificeren voor een Salmonella te isoleren.

Protocol

1. Voorbereiding van de PCR Template

Opmerking: Om zoveel mogelijk te beperken PCR overdracht verontreiniging, is het belangrijk om een aantal belangrijke sleutel stappen in de PCR fysiek gescheiden van elkaar: 1) template (DNA) de voorbereiding, 2) PCR setup, en 3) gelelektroforese. Het is ook aan te raden om barrière tips gebruiken om cultuur of reagens besmetting van pipetters te voorkomen.

  1. Inoculeren 1 ml van Luria Bertani bouillon of andere complexe medium (Brain Heart Infusion, Superbroth, enz.) met Salmonella te isoleren van een enkele geïsoleerde kolonie. 'S nachts Incubeer cultuur bij 37 ° C.
  2. Breng 1 ml van een steriele, 1,5 ml microfugebuisje, centrifuge de bacteriële cel-suspensie bij 4500 xg voor ~ 2 minuten. naar pellet cellen.
  3. Decanteer supernatant, resuspendeer de celpellet in 1 ml 100% ethanol en zet bij kamertemperatuur gedurende 10 minuten. Pellet-cellen als voorheen (4500 xg, 2 min.), Verwijder het supernatant en resuspendeer cellen in 1 ml PBS.
  4. Centrifuge cellen (4500 xg, 2 min.), Gooi supernatant en resuspendeer cellen in 1 ml van de steriele dH 2 O.
  5. Verdun de laatste celsuspensie 1 / 20 in dH 2 O (5 μl/95 ul dH 2 O) en bewaar bij -20 ° C. De houdbaarheid van de hele cellen als PCR-template bij -20 ° C is ongeveer een maand.

2. PCR Setup

Let op: Voorbereiding en uitgifte van de PCR-mix (template, buffers, oligonucletoideprimers, nucleotiden en Taq DNA-polymerase) moet worden uitgevoerd in een fysiek gescheiden ruimte gewijd en bij voorkeur gedaan in een PCR / UV-werkstation.

Opmerking: De PCR opgezet ruimte moet ook op zichzelf staand met een aangewezen -20 ° C vriezer voor de opslag van de PCR-reagentia (buffers, oligonucleotide primers, en nucleotiden), enzymen en template, dedicated pipetter voor PCR-setup, wegwerpbare latex handschoenen , laboratoriumjas, barrière tips, microtiterplaten, glas haarvaten, microfugebuizen buizen, en 10% bleekmiddel voor het reinigen van oppervlakken. Gebruik een speciale pipetter set (P10, P100, P1000 en) voor PCR-reagentia afzien. Deze pipet set mag nooit verlaten de set-up werkstation.

Let op: Het verkrijgen van moleculaire biologie of PCR graad dH 2 O en aliquot 1 ml in 1,5 ml centrifuge buizen. Verdeel hoeveelheden verdeeld dH 2 O na elk gebruik om mogelijke kruisbesmetting te vermijden. Een soortgelijke aanpak is aan te bevelen met de andere PCR-reagentia.

Let op: Maak de werkruimte voor gebruik met UV-verlichting en / of vegen beneden oppervlak met 10% bleekwater. Draag laboratoriumjas en latex handschoenen bij het uitvoeren van PCR-setup. Een minimum te beperken heen en weer verkeer van PCR set-up naar gebieden waar de PCR-reacties worden geïncubeerd in de thermocylcer en PCR-producten (amplicons) zijn gescheiden op agarose gels. Als je terug gaat in de PCR set-up gebied, beschikken over de paar latex handschoenen je op dit moment draagt ​​en op een nieuw paar handschoenen.

  1. Maak een meester primer voorraad in dH 2 o om een concentratie van 5x10 -4 M. Verdun de primers 1 / 20 in dH 2 O (5 μl/95 ul dH 2 O, 25 uM). De oligonucleotide volgorde voor elke flagelline typen primer wordt beschreven in Tabel 1.
  2. Ophalen PCR-reagentia en template van -20 ° C vriezer, en laat reagentia en monsters uit te ontdooien op ijs. Laat de Taq DNA-polymerase in de vriezer totdat het nodig is.
  3. Verdeel reagentia voor allelotyping PCR-mix, zoals beschreven in Tabel 1.
  4. Doseer 9μl van de PCR-mix in elk van de 10 ronde bodem putten in een steriele, 96-well, polystyreen microtiterplaat, te beginnen bij de top van de kolom (bijv. A1) en het verplaatsen door de kolom naar de top van de volgende.
  5. Voeg 1 ui dH 2 O aan de 9 pi PCR-mix (geen DNA controle) aan de eerste put (A1), 0.5μl van de positieve controle templates (i / g, m het typen van primers-Typhimurium en Enteritidis; r/z10 het typen van primers-Heidelberg en Hadar, en 1,2 / e, n, x te typen primers-Typhimurium en Hadar) tot 9 ul van de PCR-mix in de 2 e en (B1), en 1 ul van Escherichia coli K12 DH5a aan de 9 ml van de PCR-mix in het derde goed (C1).
  6. Voor elke extra goed (D1-H1; A2, B2), voeg 1 ui van de ontdooide monster sjabloon om de 9 ui van de PCR-mix. Voor de i / g, m allelotyping PCR, S. enterica serovar Typhimurium (i) en Enteritidis (g, m) dienen als positieve controles, en Salmonella serovars Heidelberg (r) en Hadar (Z10) zijn de positieve controles voor de r / z 10 allelotyping multiplex PCR.
  7. Plaats 10 pi capaciteit glas haarvaten in de aangewezen houders voor de Idaho Technology Rapidcycler (8).
  8. een keer stevig in de houder, belasting elk glas met de PCR-mix capillair door het aanraken van de capillaire aan deonderzijde putjes van de microtiterplaat. Kantel de houder, zodat de vloeistof naar beneden de buis en de ruimte tussen de uiteinden en de PCR-mix voor warmte afsluiting van de glazen buisjes met een butaan fakkel aan beide uiteinden van de haarvaten zegel te verstrekken.
  9. Plaats de capillaire buizen en houder in de Idaho Technology Rapidcycler en gebruiken thermocycler programma's beschreven in tabel 1 voor de verschillende allelotyping primers voor de PCR uit te voeren.
  10. Ga verder met gel elektroforese stap wanneer het thermocycler programma is voltooid.

3. Gel Elektroforese

Let op: Draag een ander laboratoriumjas bestemd voor gebruik in elektroforese lab en een nieuw paar wegwerp latex handschoenen.

Let op: Draag UV beschermende oog veiligheidsbril of gelaatsscherm en altijd waren handschoenen bij het ​​hanteren van ethidiumbromide, vooral agarose gels.

  1. Bereiding van 100 ml gesmolten 1,5% (w / v) moleculaire biologie kwaliteit agarose in 1xTAE (of 1x TBE) elektroforese buffer (7) door herhaaldelijk het verwarmen van de agarose suspensie in een magnetron vastgesteld op 20% vermogen voor 2-5 min. intervallen met periodieke visuele inspectie. Stel de gesmolten agarose in 60 ° C waterbad tot het evenwicht houdt om de temperatuur van het waterbad.
  2. Stel de gel vorm met kam voor het gieten van de gesmolten agarose. Kies een gel kam met voldoende tanden om genoeg putten produceren voor controles, monsters, en ten minste drie moleculair gewicht normen voor hun stage aan de uiteinden en het midden van de agarose gel.
  3. Voeg 2 pl ethidiumbromide (10 mg / ml) tot 100 ml van gesmolten 1,5% (w / v) agarose in 1xTAE (of TBE), voorzichtig swirl fles te mengen, vermijd het produceren van bubbels, en voorzichtig giet de inhoud van de fles in het midden van de gel mal voor 15 bij 10 cm agarosegel. Gebruik de rand van het tissue of keukenrol om alle luchtbellen te verwijderen in de agarose gel.
  4. Laat de gel mal op kamertemperatuur tot de agarose stolt (~ 30-45 min.). Breng de gel lade met gel en kam om dompelpompen horizontale elektroforese kamer met 1X TAE (of 1x TBE) elektroforese buffer. Verwijder voorzichtig de kam uit de agarose gel.
  5. Controleer de plaatsing van de gel lade ten opzichte van de kathode of de positieve pool van de electroforese kamer om er zeker van deze paal is aan de onderkant van de gel. Let op: Denk aan de negatief geladen DNA migreert naar de kathode (ie, "run op rood").
  6. Premix 200 ul van de DNA-moleculair gewicht merkers (0,25 ug / ul) met 40 ul van 6X DNA Loading Dye. Belasting 4,8 pi van het voorgemengde DNA moleculair gewicht Marker XIV bij de eerste, middelste en laatste putten.
  7. Belasting van elk van de PCR-monsters te beginnen met goed 2 en de overgang naar iedere volgende goed, van links naar rechts. Voorkomen dat het laden van het monster in een van de putjes die het molecuulgewicht standaard.
  8. Voor het laden van monsters in elk glas capillair:
    1. Verwijder elk capillair uit de houder en etsen beide uiteinden van de capillair met een glassnijder.
    2. Plaats duim en wijsvinger van beide handen aan weerszijden van de capillaire gemarkeerd door de glassnijder en klik de capillaire.
    3. Plaats de capillaire dispenser op het einde tegenovergestelde van de PCR-mix en langzaam draai de zuiger met de klok mee totdat het vloeibaar is bij de onderkant van de buis.
    4. Plaats de capillaire in de put te laden en langzaam draai de zuiger met de klok mee om de Ficoll-gewogen monster afzien in de agarose goed. Wees niet te doorboren het goed met de capillaire of in te voeren een luchtbel in de put door het draaien te veel verleden, toen de laatste van de vloeistof verlaat de capillaire.
  9. Zodra alle monsters en standaarden worden geladen, stelt u de constante spanning van de voeding tot 90 V (9 volt / cm agarose gel).
  10. Stop met elektroforese een keer de gele kleurstof (Taurazine) front is 1 cm van de onderkant van de gel.
  11. Zodra elektroforese is voltooid, overdracht van de gel op een UV-transilluminator om DNA-fragmenten en moleculaire gewicht standaard te visualiseren. Capture beeld op Polaroid film met behulp van een polaroid camera met oranje glazen filter (instellingen: 2 x, en 4,5 y) of als een digitaal beeld met behulp van een CCD-camera en afdrukken beeld met een thermische printer.
  12. Plaats de capillaire houders in 10% bleekmiddel voor 15-30 minuten. Spoel drie keer met dH 2 O en plaats terug in de PCR-setup ruimte aan de lucht drogen.

4. Vertegenwoordiger van Multiplex PCR-resultaten

Resultaten voor allelotyping PCR van de Salmonella-isolaten 1-10 zijn weergegeven in figuur 1 (lanen 3-12) en als volgt geïnterpreteerd. Een O-allel benaming wordt gegeven aan Salmonella te isoleren op basis van amplicon (PCR-product) matching in grootte van de PCR-controle en zoals voorspeld voor de O-allel primer sets gebruikt (3): B-560bp, C1-340 basispunten, C2-400 bp, D1-620 bp, en E1-280 bp. Voor isolaten met de O allelotyping PCR (Fig. 1A), we toegewezen O allelen B (lanen 10 -13), C1 (lanen 7-9), C2 (lanen 4, 5), D1 (laan 3) en E1 (baan 6) tot de tien Salmonella-isolaten getest in lanen 3-12. Deze zelfde Salmonella-isolaten werden getest, in dezelfde volgorde als Fig. 1A, voor H1 allelen i; g, m, r, en z10 (Fig. 1B, C). Nogmaals, een H1 allel is toegewezen aan elk isolaat afhankelijk van de aanwezigheid van een amplicon matching in grootte van de PCR-controle en zoals voorspeld voor de 4 H1 allel primer sets gebruikt (3): i-510 bp (Fig. 1B, laan 2 ), g, m-310 bp (Fig. 1B, laan 2), r-170 bp (Fig. 1C, laan 2) en Z10-360 bp (Fig. 1C, laan 2). H1 allelen werden toegewezen aan een van de tien Salmonella-isolaten: i - isoleert 3 en 8 (Fig. 1B, lanen 5 & 10); g, m-isoleert 1 en 5 (Fig. 1B, lanen 3 en 7), r om isoleert 6 en 9 (Fig. 1C, lanen 8 & 11);. z10 en te isoleert 2, 7 en 10 (Fig. 1C, lanen 4, 9, en 12) Salmonella isolaat 4 was negatief voor de vier geteste H1 allelen. Ten slotte werden Salmonella-isolaten getest door PCR voor H2 allelen geassocieerd met het 1,2, 1,5, 1,6, 1,7 antigen complex en e, n, x, e, n, Z15 antigeen complex. De primer sets voor de H2 1,2, 1,5, 1,6, 1,7 complex en H2 e, n, x, e, n, Z15 complex produceren 290 bp en 150 bp amplicons, respectievelijk (3). De primer sets kunnen geen onderscheid maken specifieke H2 allelen binnen een H2 antigen complex tot een definitieve allel type, ex toe te wijzen. 1,2, naar een isoleren (3) Salmonella-isolaten 4, 6, 8-10 waren positief voor H2 allelen geassocieerd met H2 1,2;. 1,5; 1,6, 1,7 antigen complex, terwijl de isoleert 2 en 7 waren positief voor H2 allelen geassocieerd met e, n, x, e, n, Z15 antigen complex (gegevens niet getoond). Terwijl de Salmonella-isolaten 1, 3 en 5 negatief waren voor de twee H2 antigeen complexen, maar isoleert 1 en 5 negatief waren voor H2 flagelline, zoals bepaald met behulp van een generieke H2 flagelline PCR (1) (gegevens niet tonen). Deze resultaten zijn samengevat in tabel 2, samen met de vermoedelijke Salmonella serovar toegewezen aan elk te isoleren.

Figuur 1
Figuur 1. Multiplex PCR voor het identificeren van specifieke O-en H-allelen geassocieerd met S. enterica serovars Enteritidis, Hadar, Heidelberg, en Typhimurium. (A) O Allel Multiplex PCR. (B, C) H1 Allel Multiplex PCR voor het vaststellen van flagelline Allelen: i / g, m (B) en r/z10 (C). Lanen 1 en 13: 100 bp ladder (Promega, Madison, WI), laan 2: multiplex PCR-controles voor O allelen B, C1, C2, D1 en E (A), H1 allelen i / g, m (B), en H1 allelen r/z10 (C); en lanen 3-12: Salmonella-isolaten 1-10 (tabel 2).

PCR Master Mix Thermocycler (Rapidcycler)
Reagentia Samenstelling / concentratie Aantal   Parameters Verwachte Maat
H1 i / g, m
dH 2 O 63 pl Programma 1 94 ° C gedurende 1 min.
10X PCR-buffer 20 mM MgCl 2 10 pi Programma 2 94 ° C gedurende 1 s
500 mMTris pH8 55 ° C gedurende 1 s
2,5 mg / ml BSA 72 ° C gedurende 20 s
5% Ficoll 400 Voor 40 cycli
10 mMTartrazine Helling = 2,0
Primer i (f) * AACGAAATCAACAACAACCTGC 2 pi Programma 3 72 ° C gedurende 4 min 510 bp
Primer i (r) * TAGCCATCTTTACCAGTTCCC 2 pi
Primer g, m (f) * GCAGCAGCACCGGATAAAG 2 pi 310 bp
Primer g, m (r) * CATTAACATCCGTCGCGCTAG 2 pi
DMSO 5 pl
dNTP 10 mM 2 pi
Taq 5 eenheden / ul 2 pi
90 pl
H1 r / z 10
dH 2 O 55 pl Programma 1 94 ° C gedurende 1 min.
10X PCR-buffer 30 mM MgCl 2 10 pi Programma 2 94 ° C gedurende 1 s
500 mMTris pH8 55 ° C gedurende 1 s
2,5 mg / ml BSA 72 ° C gedurende 20 s
5% Ficoll 400 Voor 40 cycli
10 mMTartrazine Helling = 2,0
Primer r (f) * CCTGCTATTACTGGTGATC 4μl Programma 3 72 ° C gedurende 4 min 170 bp
Primer r (r) * GTTGAAGGGAAGCCAGCAG 4μl
Primer z 10 (f) * GCACTGGCGTTACTCAATCTC 4μl 360 bp
Primer z 10 (r) * GCATCAGCAATACCACTCGC 4μl
DMSO 5 pl
dNTP 10 mM 2 pi
Taq 5 eenheden / ul 2 pi
90 pl
PCR Master Mix Thermocycler (Rapidcycler)
Reagentia Samenstelling / concentratie Aantal   Parameters Verwachte Maat
H2 1,2 / e, n, x
dH 2 O 63,6 ul Programma 1 94 ° C gedurende 1 min.
10X PCR-buffer 20 mM MgCl 2 10 pi Programma 2 94 ° C gedurende 1 s
500 mMTris pH8 55 ° C gedurende 1 s
2,5 mg / ml BSA 72 ° C gedurende 20 s
5% Ficoll 400 Voor 40 cycli
10 mMTartrazine Helling = 2,0
Primer 1,2 (f) * AGAAAGCGTATGATGTGAAA 2 pi Programma 3 72 ° C gedurende 4 min 290 bp
Primer 1,2 (r) * ATTGTGGTTTTAGTTGCGCC 2 pi
Primer e, n, x (f) * TAACTGGCGATACATTGACTG 2 pi 150 bp
Primer e, n, x (r) een TAGCACCGAATGATACAGCC 2 pi
DMSO 5 pl
dNTP 10 mM 2 pi
Taq 5 eenheden / ul 2 pi
90 pl
Generieke H2
dH 2 O 72 pl Programma 1 94 ° C gedurende 1 min.
10X PCR-buffer 30 mM MgCl 2 10 pi Programma 2 94 ° C gedurende 10 s
500 mMTris pH8 45 ° C gedurende 10 s
2,5 mg / ml BSA 72 ° C gedurende 35 s
5% Ficoll 400 Voor 40 cycli
10 mMTartrazine Helling = 2,0
Primer fljB (f) * CAAGTAATCAACACTAACAGTC 2 pi Programma 3 72 ° C gedurende 4 min 1500 bp
Primer fljB (r) * TTAACGTAACAGAGACAGCAC 2 pi
dNTP 10 mM 2 pi
Taq 5 eenheden / ul 2 pi
90 pl

Tabel 1. Protocol voor Salmonella flagellinallelotyping PCR: samenstelling, voorwaarden, en de verwachte resultaten.

* De werkvoorraad concentratie van PCR oligonucleotideprimers is 25 uM

Isoleren O Allel H1 Allel H2 Allel Serovar
  B C1 C2 D1 E ik g, m r z10 1,2; 1,5; 1,6; 1,7 e, n, x, e, n, Z15 Generic 1  
1 - - - + - - + - - - - - Enteritidis
2 - - + - - - - - + - + + Hadar / Istanbul 3
3 - - + - - + - - - - - + Kentucky
4 - - - - + - - - - + - + Onbekende
5 - + - - - - + - - - - - Montevideo
6 - + - - - - - + - + - + Infantis of Virchow 2
7 - + - - - - - - + - + + Mbandaka
8 + - - - - + - - - + - + Typhimurium
9 + - - - - - - + - + - + Heidelberg
10 + - - - - - - - + + - + Haifa

Tabel 2. Allelotyping PCR Resultaten (afb. 1) en Salmonella serovar Aanwijzing op basis van identificatie van O, H1, H2 en Allelen

> Een H2 PCR produceert een 1,5 kb amplicon voor alle Salmonella bezit H2 flagelline, ongeacht de H2 allel (1). Deze PCR wordt gebruikt om monofasische te onderscheiden van de bifasische Salmonella.
2 H2 multiplex PCR kan geen onderscheid maken tussen de verschillende allelen voor de H2 1,2, 1,5, 1,6, 1,7 antigen complex (3).
3 Faag conversie van S. enterica serovar Hadar verandert LPS O antigeen serovar Istanbul te produceren. De O allelotyping PCR kan niet onderscheiden van deze subtiele genetische / antigene veranderingen.

Serovar 1 O Allel H1 Allel H2 Allel
  B C1 C2 D1 E ik g, m r z10 1,2; 1,5; 1,6; 1,7 e, n, x, e, n, Z15 Generieke 2
Californië + - - - - - + - - - - -
Typhimurium + - - - - + - - - + - +
Heidelberg + - - - - - - + - + - +
Haifa + - - - - - - - + + - +
Montevideo - + - - - - + - - + - +
Othmarschen - + - - - - + - - - - -
Athinai - + - - - + - - - - + +
Papuana - + - - - - - + - - + +
Mbandaka - + - - - - - - + - + +
Chincol - - + - - - + - - - + +
Kentucky - - + - - + - - - - - +
Hadar / Istanbul 3 - - + - - - - - + - + +
Enteritidis - - - + - - + - - - - -
Seremban - - - + - + - - - + - +
Campinense - - - + - - - + - - + +
Lome - - - + - - - + - - - +
Portland - - - + - - - - + + - +
Rwanda - - - + - - - - + - + +
Treguier - - - + - - - - + - - +
Simi - - - - + - - + - - + +
Weltevreden - - - - + - - + - - - +
Kristianstad - - - - + - - - + - + +
Biafra - - - - + - - - + - - +

Tabel 3. Salmonella enterica serovars Geïdentificeerd Allelotyping PCR

1 De serovars gemarkeerd in vet zijn degenen die vaker ondervonden door diagnostische of voedsel microbiologisch laboratorium.
2 H2 PCR produceert een 1,5 kb amplicon voor alle Salmonella bezit H2 flagelline, ongeacht de H2 allel (1). Deze PCR wordt gebruikt om monofasische te onderscheiden van de bifasische Salmonella.
3 Faag conversie van S. enterica serovar Hadar verandert LPS O antigeen serovar Istanbul te produceren. De O allelotyping PCR kan niet onderscheiden van deze subtiele genetische / antigene veranderingen.

Discussion

De meeste commercieel beschikbare PCR-tests voor de opsporing van Salmonella doelen genen die uniek zijn voor het geslacht (ex. Inva). Echter, niet alle Salmonella zijn gelijk in hun vermogen om ziekte te veroorzaken bij de mens of prevalentie in dierpopulaties. Vroegtijdige herkenning van antigene verschillen in Salmonella LPS O-antigeen en flagellinH1 en H2-antigenen heeft geleid tot de differentiatie van Salmonella in meer dan 2500 serovars op basis van deze antigene verschillen. Er zijn 46 verschillende O-antigenen en 86 verschillende flagelline (H) antigenen die in het geslacht Salmonella. Salmonella kan een (H1) of twee verschillende (H1 & H2) flagellins bezitten. De verschillende combinatie van O, H1, H2 en antigenen account voor de 2500 Salmonella serovars erkend. Een serovar is toegewezen op basis van de antigene formule afgeleid van de identificatie van de individuele O-en H-antigenen. De antigene formule wordt geschreven als O: H1: H2; en waar "-", verwijst naar de afwezigheid van H1 of H2 flagelline en "NT" (niet-typeerbare) voor Salmonella negatief voor de O-antigeen. Zo is bijvoorbeeld de serovar Typhimurium toegewezen aan een S. enterica isoleren met de antigene formule B: i: 1,2, terwijl Enteritidis is gegeven aan een te isoleren met de formule D1: g, m: -. Deze antigene variatie in de populatie Salmonella is de uiterlijke manifestatie van verschillen op de nucleotide niveau dat dus gemakkelijk kan worden uitgebuit door PCR.

We hebben de genetische verschillen die verband houden met specifieke O-en H-allelen voor een allelotyping PCR voor het identificeren van S. te ontwikkelen enterica serovars: Enteritidis, Hadar, Heidelberg, en Typhimurium (3). De juiste opdracht en rapportage van Salmonella serovar vereist dat het testen op alle allelen geassocieerd met O: H1: H2 antigene formules voor Enteritidis (D1: g, m: -), Hadar (C2: Z10: e, n, x), Heidelberg (B : r: 1,2), en Typhimurium (B: i: 1,2). Zonder kennis van de O-allel of antigeen, het vinden van de H1 g, is m allel alleen niet per se identificeren van de Salmonella Enteritidis isoleren als andere Salmonella serovars: Agona, Californië, en Montevideo, ook over deze zelfde allel. Terwijl de allelotyping PCR werd oorspronkelijk ontworpen om te detecteren op de voorgrond genoemde Salmonella serovars, kan deze test identificeren een extra 19 serovars (tabel 3). Onze allelotyping PCR werd oorspronkelijk ontworpen om O-en H-allelen op te sporen. In de praktijk is het meer praktisch en kosteneffectief voor ons om het O-antigeen te identificeren door slide agglutinatie test, met behulp van O-specifieke antisera, in plaats van het uitvoeren van de O allelotyping PCR bij het ​​werken met geïsoleerde Salmonella culturen. Echter, we raden het gebruik van de O allelotyping PCR als je lab gebruikt deze PCR als een scherm (2) of voor het typen van Salmonella-isolaten ingediend FTA-kaarten (6), en omvatten een Salmonella-specifieke PCR met het eerste scherm van de monsters (4 ). Beperk de allelotyping PCR's om alleen die monsters die als Salmonella geïdentificeerd door PCR of biochemische / antigene testen.

Het protocol wordt beschreven in dit artikel is geoptimaliseerd voor gebruik met de Idaho Technology Rapidcycler, een hete-lucht thermocycler die het mogelijk maakt om de schaal van een reactie volumes en loopt reactie-omstandigheden in minder tijd dan veel verwarmingsblok thermocyclers. Aan te passen dit protocol voor gebruik met een verwarmingsblok thermocycler kan verlangen het optimaliseren van reactie-omstandigheden empirisch door het verlagen / verhogen gloeien temperaturen; te passen primer concentraties; of het aanpassen van MgCl 2 concentraties. Zo hebben we het protocol aan te passen voor de MJ Research PTC-200 thermocycler als volgt. Werken met dezelfde reactie volumes beschreven in tabel 1, van de werkvoorraad concentrationof de i primer set werd verdund tot 2,5 uM, was de annealing temperatuur verlaagd van 55 ° C tot 45 ° C, en incubatie tijden op de denaturatie, annealing en extensie stappen werd verlengd tot 20 s voor de i / g, m allelotyping PCR. Na de positieve en negatieve controles zijn essentieel in de eerste opstart en optimalisatie voor een PCR, met inbegrip van gepubliceerde protocollen. We raden aan het verwerven van bekende Salmonella serovars, in het bijzonder Anatum (E1: e, h: 1,6), Enteritidis (D1: g, m: -), Hadar (C2: Z10: e, n, x), Heidelberg (B: r : 1,2), Montevideo (C1: g, m, s: 1,2,7) en Typhimurium (B: i: 1,2), en een laboratorium Escherichia coli K12 stam (DH5a, LE393, JM109, etc. ) als positieve en negatieve controles respectievelijk voor de allelotyping PCR-testen beschreven in dit artikel. Verschillende van deze Salmonella serovars zal dienen als positief of negatief controles, afhankelijk van welk allel is getest.

Bepaalde voorzorgsmaatregelen en richtlijnen moeten worden gevolgd tijdens het uitvoeren van deze en eventuele andere diagnostische PCR. Ten eerste, de fysieke scheidingvan template voorbereiding, PCR set-up, en gelelektroforese is van cruciaal belang in het voorkomen van mogelijk PCR-carry-over besmetting en onjuiste rapportage van vals-positieven. Daarnaast is het opnemen van passende controles is nodig in een routine PCR zoals deze controles problemen op te sporen als ze zich voordoen en helpen bij de interpretatie van resultaten (5). Het belangrijkste is, consistentie is essentieel, in het bijzonder met betrekking tot de elektroforetische voorwaarden voor amplicon (PCR product) detectie andestimation van amplicongrootte. Ter illustratie van dit punt, we doelbewust opgeschort elektroforese eerder dan de bedoeling is in figuur 1A. Het molecuulgewicht normen (lanen 1 en 13) en de positieve controle (laan 2) zijn niet voldoende van elkaar gescheiden nauwkeurig schatten maten of scheiding van DNA-fragmenten waar er kleine verschillen (~ 50 bp) in de maten te nemen. Adequate scheiding van DNA-fragmenten, in het bijzonder het moleculair gewicht normen essentieel is voor het rapporteren positives is afhankelijk van een nauwkeurige schatting van amplicongrootte en onderscheidende "echt positief" van niet-specifieke amplicons die soms worden waargenomen in de dagelijkse gang van PCR (5 ). Bijvoorbeeld, er is een niet-specifieke amplicon in figuur 1B, baan 7 (~ 700 bp in grootte). Was elektroforese is te vroeg gestopt, toen de kleurstof front was alleen op de manier waarop half punt in de agarose gel, zou er weinig verschil tussen de 500 bp en 700 bp DNA-fragmenten. Daarom zou steekproef in baan 7 ten onrechte zijn gemeld als positief voor zowel de i en g, m allelen.

Tot slot, moet men erkennen de beperkingen verbonden aan een test. Een aantal van de H1/H2 allelotyping PCR hebben niet de macht om discriminerende subtiele genetische verschillen in de allelen die behoren tot de H2 1,2 onderscheiden; 1,5; 1,6, 1,7 antigen complex, e, n, x / e , n, Z15 antigen complex en de H1 G-antigen complex, dat de g, m allel omvat. Een of twee aminozuur veranderingen rekening voor de verschillende epitopen aanwezig in deze flagellaire antigenen. Daarom was het moeilijk voor ons om primers die kunnen misbruiken deze soms enkel basepaar verschillen in de flagelline gensequentie (3) te ontwerpen. Bijvoorbeeld, Salmonella serovars Dublin (D1: g, p: -) en Berta (D1: f, g, t: -) zijn ook positieve PCR met onze g, mallelotyping primers. De H2 allelotyping primers kunnen geen onderscheid maken Typhimurium (B: i: 1,2) van Lagos (B: i: 1,5), Heidelberg (B: r: 1,2) uit Bradford (B: r: 1,5), Winneba (B: r: 1,6), of Remo (B: r: 1,7), of Hadar (C2: Z10: e, n, x) uit Glostrup (C2: Z10: e, n, Z15). Terwijl de kans op tegenkomen sommige van deze serovars: Lagos, Bradford, Winneba, Remo of Glustrup is afgelegen, het is een mogelijkheid en vereist, hetzij het verstrekken van disclaimer op de tests 'beperking of een andere bevestigende test.

Kortom, deze PCR-gebaseerde serotypering identificeert snel S. enterica serovars Enteritidis, Hadar, Heidelberg en Typhimurium, en O, H1, H2 en allelen geassocieerd met 19 extra serovars. Deze test is een snelle, kosteneffectief alternatief voor traditionele microbiologische benadering van serotypering Salmonella.

Disclosures

Geen belangenconflicten verklaard.

Acknowledgments

Dit werk werd ondersteund door USDA Grants 1999-35212-8680, 2,005 tot 01,378, en 2010-04288-01, USDA Formule fondsen en de Staat der Diergeneeskunde van Georgië Agricultural Research Grant. Het protocol wordt beschreven in deze publicatie is ontwikkeld voor gebruik door studenten als onderdeel van gericht onderzoek cursussen: MIBO 4900L, GENE 4960H, BCMB 4960L, en BIOL 4960H aan de Universiteit van Georgia en gebruikt door de studenten op verschillende moleculaire epidemiologie onderzoeksprojecten in de Maurer laboratorium. We willen de vele studenten die onderzoek hebben uitgevoerd in Maurer en Lee laboratoria, en onze afdeling stoel, John Glisson bedanken voor de ondersteuning van onze inspanningen om undergraduate onderwijs te integreren met onderzoek.

Materials

Name Company Catalog Number Comments
Luria Bertani Fisher Scientific (or any comparable source)
Microfuge tubes Fisher Scientific 1.5 ml capacity (or any comparable source)
Ethanol Fisher Scientific 200 proof (or any comparable source)
dH2O Sigma-Aldrich Molecular Biology Grade (or any comparable source; PCR only)
10 x PCR Buffer: Idaho Technologies 20 mM MgCl2 (buffer comes with BSA, Ficoll and Tartrazine)
30 mM MgCl2
40 mM MgCl2
PCR primers
DMSO
dNTP Roche Group (or any comparable source)
Taq DNA Polymerase Denville Scientific (or any comparable source)
Capillary pipettes Idaho Technologies 10 µl volume
Rapid Cycler Idaho Technologies
Agarose Bio-Rad Low EEO; Molecular Biology Grade (or any comparable source)
50 X TAE Buffer or 5X TBE Buffer Fisher Scientific (or any comparable source)
Ethidium bromide Bio-Rad (or any comparable source)
Horizontal, submersible gel electrophoresis chamber with gel mold Bio-Rad (or any comparable source)
Power supply Bio-Rad (or any comparable source)
Molecular Imager Gel Doc System Bio-Rad (or any comparable source)
Table 4. Materials

DOWNLOAD MATERIALS LIST

References

  1. Dauga, C., Zabrovskaia, A., Grimont, P. A. D. Restriction fragment length polymorphism analysis of some flagellin genes of Salmonella enterica. J. Clin. Microbiol. 36, 2835-2843 Forthcoming.
  2. Hong, Y., Liu, T., Lee, M. D., Hofacre, C. L., Maier, M., White, D. G., Ayers, S., Wang, L., Berghaus, R., Maurer, J. A rapid screen of broth enrichments for Salmonella enterica serovars Enteritidis, Hadar, Heidelberg, and Typhimurium using an allelotyping multiplex PCR that targets O and H antigen alleles. J. Food Prot. 72, 2198-2201 (2009).
  3. Hong, Y., Liu, T., Lee, H. ofacre, Maier, C. L., White, M., Ayers, D. G., Wang, S., Berghaus, L., R, M. aurer J.Rapid screening of Salmonella enterica serovars Enteritidis, Hadar, Heidelberg and Typhimurium using a serologically-correlative allelotyping PCR targeting the O and H antigen alleles. BMC Microbiol. (2008).
  4. Liu, T., Liljebjelke, K., Bartlett, E., Hofacre, C. L., Sanchez, S., Maurer, J. J. Application of nested PCR to detection of Salmonella in poultry environments. J. Food Prot. 65, 1227-1232 (2002).
  5. Maurer, J. J. Rapid detection and limitation of molecular techniques. Ann. Rev. Food Sci. Tech. 2, 259-279 (2011).
  6. Moscoso, H., Alvarado, I., Hofacre, C. L. Molecular analysis of infectious bursal disease virus from bursal tissues collected on FTA filter paper. Avian Dis. 50, 391-396 (2006).
  7. Sambrook, J., Fritsch, E. F., Maniatis, T. Molecular cloning: a laboratory. 2nd ed, Cold Spring Harbor Laboratory Press. Cold Spring Harbor, N.Y. (1989).
  8. Wittwer, C. T., Fillmore, G. C., Hillyard, D. R. Automated polymerase chain reaction capillary tubes with hot air. Nucleic Acids Res. 17, 4353-4357 (1989).
Een Allelotyping PCR voor het vaststellen van<em> Salmonella enterica</em> Serovars Enteritidis, Hadar, Heidelberg, en Typhimurium
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Maurer, J. J., Lee, M. D., Cheng, Y., Pedroso, A. An Allelotyping PCR for Identifying Salmonella enterica serovars Enteritidis, Hadar, Heidelberg, and Typhimurium. J. Vis. Exp. (53), e3130, doi:10.3791/3130 (2011).More

Maurer, J. J., Lee, M. D., Cheng, Y., Pedroso, A. An Allelotyping PCR for Identifying Salmonella enterica serovars Enteritidis, Hadar, Heidelberg, and Typhimurium. J. Vis. Exp. (53), e3130, doi:10.3791/3130 (2011).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter