Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Immunology and Infection

Una PCR para la identificación de Allelotyping Salmonella enterica Serotipos Enteritidis, Hadar, Heidelberg, y Typhimurium

doi: 10.3791/3130 Published: July 22, 2011

Summary

Se describe una técnica de PCR múltiple para la detección rápida de Salmonella enterica serovar Enteritidis, Hadar, Heidelberg, y Typhimurium. Serotipos de Salmonella específicos se pueden identificar por objetivo una PCR múltiple para los genes y las secuencias únicas para el grupo O-antígeno de la biosíntesis y la flagelina de un serotipo determinado. Serovar se le asignó a un aislamiento de Salmonella basado en la apariencia de los amplicones específicos de tamaño, (producto de PCR), correspondiente al alelo objetivo.

Abstract

Las pruebas actuales de terminación de proyecto comercial para la identificación de genes de Salmonella objetivo único de este género. Sin embargo, hay dos especies, subespecies y seis, y más de 2.500 serotipos de Salmonella diferentes, y no todos son iguales en su importancia para la salud pública. Por ejemplo, la búsqueda de S. enterica subespecie IIIa Arizona en una granja ponedora de huevos de mesa es insignificante en comparación con el aislamiento de S. enterica serovar Enteritidis subespecie I, la principal causa de salmonelosis asociados al consumo de huevos de mesa. Serotipos se identifican con base en las diferencias antigénicas de lipopolisacárido (LPS) (antígeno O) y flagelina (H1 y H2 antígenos). Estas diferencias antigénicas son la apariencia externa de la diversidad de los genes y alelos de genes asociados con este fenotipo.

Hemos desarrollado un allelotyping, PCR multiplex que las claves en las diferencias genéticas entre los cuatro principales S. enterica serovar subespecie que se encuentra en las aves de corral y se asocia con la enfermedad humana significativa en los EE.UU.. Las parejas de cebadores de PCR fueron dirigidos a genes o secuencias clave única de un serovar de Salmonella específico y diseñado para producir una amplificación con un tamaño específico para que el gen o alelo. Salmonella serovar se asigna a un aislamiento basado en la combinación de resultados de las pruebas de PCR para LPS específicos y flagelina alelos del gen. La PCR multiplex descrito en este artículo son específicos para la detección de S. enterica serovar Enteritidis subespecie I, Hadar, Heidelberg, y Typhimurium.

Aquí se demuestra cómo utilizar el multiplex PCR para identificar los serotipos de Salmonella para aislar.

Protocol

1. Preparación de la plantilla de PCR

Nota: A fin de minimizar la contaminación remanente PCR, es importante tener varios pasos importantes clave en la PCR físicamente separados entre sí: 1) plantilla (ADN) preparación, 2) configuración de PCR, y 3) electroforesis en gel. También se recomienda el uso de puntas de barrera para evitar la contaminación de la cultura o el reactivo de pipetas.

  1. Inocular 1 ml de caldo Luria Bertani u otro medio de complejos (infusión cerebro corazón, Superbroth, etc) con Salmonella aislado de una colonia aislada. Incubar cultivo de una noche a 37 ° C.
  2. Transferir 1 ml de una solución estéril, 1,5 ml tubo de microcentrífuga de capacidad, se centrifuga la suspensión celular de las bacterias a 4.500 xg durante 2 minutos en. para precipitar las células.
  3. Decantar el sobrenadante, resuspender el botón celular en 1 ml de etanol al 100% y establecer a temperatura ambiente durante 10 min. Precipitar las células como antes (4.500 xg, 2 min.), Eliminar el sobrenadante y resuspender las células en 1 ml de PBS.
  4. Centrifugar las células (4.500 xg, 2 min.), Descartar el sobrenadante y resuspender las células en 1 ml de agua estéril dH 2 O.
  5. Diluir la suspensión celular final 1 / 20 en dH 2 O (5 μl/95 l dH 2 O) y almacenar a -20 ° C. La vida útil de las células de todo como plantilla de PCR a -20 ° C es aproximadamente un mes.

2. PCR de configuración

Nota: La preparación y dispensación de la mezcla de reacción PCR (plantilla, tampones, oligonucletoideprimers, nucleótidos y Taq polimerasa) se debe realizar en una habitación separada físicamente y dedicada preferentemente en una estación de trabajo PCR / UV.

Nota: La PCR establecer habitación también debe ser auto-contenida con un designado congelador a -20 ° C para el almacenamiento de los reactivos de PCR (buffers, oligonucleótidos, y los nucleótidos), las enzimas y la plantilla, pipeteador dedicada conjunto para la configuración de PCR, guantes de látex desechables , bata de laboratorio, consejos barrera, placas de microtitulación, capilares de vidrio, tubos de microcentrífuga y lejía al 10% para descontaminar las superficies. Utilizar un conjunto dedicado pipeteador (P10, P100, P1000 y) para dispensar los reactivos PCR. Este conjunto de pipeta no debe salir de la estación de trabajo de puesta a punto.

Nota: Obtención de la biología molecular o PCR grado dH 2 O y la alícuota de 1 ml en tubos de 1,5 ml de capacidad centrífuga. Dispensar alícuotas dH 2 O después de cada uso para evitar una posible contaminación cruzada. Un enfoque similar se recomienda con los otros reactivos PCR.

Nota: Descontaminar el área de trabajo antes de su uso con iluminación UV y / o limpiar superficies con lejía al 10%. Utilizar una bata de laboratorio y guantes de látex en la realización de configuración de PCR. Minimizar el tráfico de ida y vuelta de PCR puesta a punto para las zonas donde la reacción de PCR se incuban en la thermocylcer y productos de la PCR (amplicones) son separados en geles de agarosa. Si nos remontamos en la PCR set-up área, deshacerse de los pares de guantes de látex que se está usando y se puso un nuevo par de guantes.

  1. Hacer una acción manual maestro en dH 2 O a una concentración de 5x10 -4 M. Diluir los cebadores 1 / 20 en dH 2 O (5 μl/95 l dH 2 O, 25 M). La secuencia de oligonucleótidos para cada primer escribiendo flagelina se describe en la Tabla 1.
  2. Recuperar los reactivos PCR y la plantilla del congelador a -20 ° C, y permitir que los reactivos y muestras para descongelar el hielo. Salir de la Taq ADN polimerasa en el congelador hasta que se necesite.
  3. Prescindir de los reactivos para la mezcla de reacción de PCR allelotyping como se describe en la Tabla 1.
  4. Prescindir 9μl de la mezcla de reacción de PCR en cada una de 10 pozos de fondo redondo en un recipiente estéril, de 96 pozos, placa de microtitulación de poliestireno, comenzando en la parte superior de la columna (por ejemplo, A1) y se extiende hacia la columna de la parte superior de la siguiente.
  5. Añadir 1 l de dH 2 O a la l 9 de PCR mezcla (sin control de ADN) para el primer pozo (A1), 0.5μl de las plantillas de control positivo (i / g, m escribiendo primers-Typhimurium y Enteritidis; r/z10 escribiendo primers-Heidelberg y Hadar, y 1,2 / e, n, x escribiendo primers-Typhimurium y Hadar) a 9 l de la mezcla de PCR en el 2 º y (B1), y 1 l de Escherichia coli K12 DH5a a la 9 ml de la mezcla de PCR en el tercer pozo (C1).
  6. Para cada pozo adicional (D1-H1, A2, B2), añadir 1 l de la plantilla de muestra descongelada a la l 9 de la mezcla de reacción de PCR. Para el S. i / g, m allelotyping PCR, enterica serovar Typhimurium (i) y Enteritidis (g, m) se utilizan como controles positivos, y Salmonella serovares Heidelberg (r) y Hadar (z10) son los controles positivos para el r / z 10 allelotyping multiplex PCR.
  7. Lugar 10 l de capacidad capilares de vidrio en los titulares designados por el Rapidcycler Idaho Tecnología (8).
  8. una vez conseguido en el soporte, la carga de cada vaso capilar con la mezcla de reacción de PCR al tocar el capilar a lapocillos de fondo de la placa de microtitulación. Incline el soporte para permitir que el líquido se mueve por el tubo y ofrecer un espacio entre los extremos y la mezcla de PCR antes de sellado térmico de los tubos de vidrio con un soplete de butano para sellar ambos extremos de los capilares.
  9. Coloque los tubos capilares y soporte en el Rapidcycler Idaho Tecnología y el uso de programas termociclador describen en la Tabla 1 para los primers allelotyping diferentes para ejecutar el PCR.
  10. Continúe con el paso de electroforesis en gel cuando el programa del termociclador se haya completado.

3. Electroforesis en gel

Nota: Utilizar una bata de laboratorio diferentes designado para su uso en el laboratorio de electroforesis y un nuevo par de guantes de látex desechables.

Nota: Usar gafas de protección UV o protector facial y siempre guantes cuando se manipule bromuro de etidio, especialmente en geles de agarosa.

  1. Preparar 100 ml fundido 1,5% (w / v) de la biología molecular grado de agarosa en 1xTAE (o 1X TBE) tampón de electroforesis (7) en varias ocasiones el calentamiento de la suspensión de agarosa en un microondas fija en el 20% de potencia durante 2-5 minutos, con intervalos periódicos visual inspección. Establecer la agarosa fundida en el baño de agua 60 ° C hasta que se equilibra con la temperatura del baño de agua.
  2. Configurar el molde de gel con peine antes de verter la agarosa fundida. Elija un peine con dientes gel suficiente para producir los pozos suficientes para los controles, las muestras, y al menos tres estándares de peso molecular para su colocación en los extremos y el centro de la gel de agarosa.
  3. Añadir 2 l de bromuro de etidio (10 mg / ml) a 100 ml de líquido de 1,5% (w / v) de agarosa en 1xTAE (TBE), con cuidado la botella agitar para mezclar, evitar la producción de burbujas, y con cuidado vierta el contenido de la botella en el centro del molde de gel de 15 por 10 cm de gel de agarosa. Utilice el borde de un pañuelo de papel o una toalla de papel para eliminar las burbujas en el gel de agarosa.
  4. Deje que el molde de gel de establecer a temperatura ambiente hasta que se solidifica de agarosa (~ 30-45 min). La transferencia de la bandeja de gel con gel y peine para sumergibles, cámara de electroforesis horizontal que contiene 1X TAE (o 1X TBE) tampón de electroforesis. Retire con cuidado el peine del gel de agarosa.
  5. Compruebe la colocación de la bandeja de gel en relación con el cátodo o polo positivo de la cámara de electroforesis para asegurarse de que este polo está en la parte inferior del gel. Nota: Recuerde que el ADN cargado negativamente migra hacia el cátodo (es decir, "correr al rojo").
  6. Premezcla de 200 l de marcadores de ADN de peso molecular (0,25 mg / l) con 40 l de colorante de carga 6X ADN. Carga 4,8 l de la premezcla peso molecular del ADN marcador XIV de los primeros pozos, segundo nombre y apellido.
  7. De carga cada una de las muestras de PCR a partir de 2 y así avanzar a cada pocillo posterior, de izquierda a derecha. Evitar la colocación de la muestra en cualquiera de los pozos que contienen los estándares de peso molecular.
  8. Para cargar las muestras contenidas en cada vaso capilar:
    1. Retire cada capilar de su soporte y grabar ambos lados del capilar con un cortador de vidrio.
    2. Coloque el pulgar y el dedo índice de ambas manos a ambos lados del capilar marcada por el cortador de vidrio y coloque el tubo capilar.
    3. Coloque el dispensador capilar en el extremo opuesto de la mezcla de reacción PCR y gire lentamente el émbolo de las agujas del reloj hasta que el líquido se encuentra en la parte inferior del tubo.
    4. Colocar los capilares en el pozo para ser cargados y gire lentamente el émbolo hacia la derecha para dispensar la muestra Ficoll-ponderada en la agarosa bien. Tenga cuidado de no perforar el pozo con el capilar o introducir una burbuja de aire en el pozo girando demasiado pasado, cuando el último de el líquido sale del capilar.
  9. Una vez que todas las muestras y estándares se cargan, ajustar la tensión constante de la fuente de alimentación de 90 V (9 volts / cm en gel de agarosa).
  10. Deje de electroforesis una vez que el colorante amarillo (Taurazine) frente es de 1 cm de la parte inferior del gel.
  11. Una vez se haya completado la electroforesis, el gel para la transferencia de un transiluminador UV para visualizar fragmentos de ADN y el estándar de peso molecular. Captura de imágenes en la película Polaroid usando una cámara Polaroid con naranja filtro de vidrio (configuración: 2 x, y y 4.5) o como una imagen digital con una cámara CCD y la imagen de impresión con una impresora térmica.
  12. Coloque los titulares de capilares en 10% de lejía durante 15-30 min. Enjuague tres veces con dH 2 O y vuelva a colocar en la habitación de la configuración de PCR se seque al aire.

4. Representante Multiplex PCR Resultados

Resultados para allelotyping PCR de aislamientos de Salmonella 10.01 se muestra en la Figura 1 (carriles 3-12) e interpretado de la siguiente manera. Una designación alelo S se da a aislar Salmonella basado en amplificación (producto de PCR) que coincida en tamaño con el control de PCR y como se había predicho para el primer alelo S conjuntos utilizados (3): B-560bp, 340bp-C1, C2-400 pb, D1-620 pb, pb y E1-280. De las cepas aisladas de la PCR O allelotyping (Fig. 1A), se ha asignado S alelos B (líneas 10 -13), C1 (carriles 7-9), C2 (calles 4, 5), D1 (calle 3) y E1 (calle 6) a las diez cepas aisladas de Salmonella en los carriles de 3.12. Estas cepas de Salmonella mismo se pusieron a prueba, en el mismo orden que en la figura. 1A, los alelos i H1; g, m, r, y z10 (Fig. 1B, C). Una vez más, un alelo H1 se asigna a cada aislamiento depende de la presencia de un amplicón de tamaño correspondiente al control de PCR y como se había predicho para el primer H1 alelo 4 juegos utilizados (3): i-510 pb (Fig. 1B, carril 2 ), g, m-310 pb (Fig. 1B, carril 2), R-170 pb (Fig. 1C, carril 2), y Z10-360 pb (Fig. 1C, carril 2). Alelos H1 fueron asignados a uno de los diez aislamientos de Salmonella: i - aislados de 3 y 8 (Fig. 1B, carriles 5 y 10), g, m-cepas 1 y 5 (fig. 1B, carriles 3 y 7), r aislados de 6 y 9 (Fig. 1C, calles 8 y 11);. z10 y aísla a 2, 7, y 10 (Fig. 1C, carriles 4, 9 y 12) Salmonella aislar 4 fue negativo para los cuatro alelos H1 prueba. Finalmente, los aislamientos de Salmonella fueron analizadas por PCR de los alelos asociados con el H2 1,2, 1,5, 1,6, 1,7 y complejo antígeno e, n, x, e, n, Z15 complejo antígeno. Los cebadores para el H2 1,2, 1,5, 1,6, 1,7 y complejo H2 e, n, x, e, n, Z15 complejo de producción de 290 pb y 150 pb amplicones, respectivamente (3). El primer sets no puede distinguir alelos específicos en cualquiera de antígeno H2 H2 complejo para asignar un tipo de alelo definitiva, ej. 1,2, a un aislamiento (3) los aislamientos de Salmonella 4, 6, 8-10 fueron positivos para los alelos asociados con H2 H2 1,2;. 1,5; 1,6; 1,7 complejo antígeno, mientras que los aislados 2 y 7 fueron positivas para los alelos asociados con H2 e, n, x, e, n, Z15 complejo antígeno (datos no mostrados). Mientras que los aislamientos de Salmonella 1, 3, y 5 fueron negativos para los dos complejos antígeno-H2, sólo cepas 1 y 5 fueron negativos para la flagelina H2, como se determina utilizando un genérico H2 flagelina PCR (1) (datos no muestran). Estos resultados se resumen en la Tabla 2, junto con el serovar de Salmonella presunto asignado a cada aislamiento.

Figura 1
Figura 1. PCR múltiple para la identificación específica de O y H alelos asociados con S. enterica serovares Enteritidis, Hadar, Heidelberg, y Typhimurium. (A) O alelos Multiplex PCR. (B, C) H1 Alelo Multiplex PCR para la identificación de alelos flagelina: i / g, m (B) y r/z10 (C). Carriles 1 y 13: escalera de 100 pb (Promega, Madison, WI), carril 2: multiplex PCR controles para los alelos S B, C1, C2, D1 y E (A), H1 alelos i / g, m (B), y alelos H1 r/z10 (C), y carriles de 3.12: los aislamientos de Salmonella 1-10 (Tabla 2).

PCR Master Mix Termociclador (Rapidcycler)
Reactivos Composición / concentración Cantidad   Parámetros Tamaño de espera
H1 i / g, m
dH 2 O 63 l Programa 1 94 ° C durante 1 minuto
10X PCR buffer 20 mM MgCl 2 10 l Programa 2 94 ° C durante 1 s
500 mMTris pH8 55 ° C durante 1 s
2,5 mg / ml de BSA 72 ° C durante 20 s
5% de Ficoll 400 Durante 40 ciclos
10 mMTartrazine Pendiente = 2,0
Primer i (f) * AACGAAATCAACAACAACCTGC 2 l Programa 3 72 ° C durante 4 minutos 510 pb
Primer i (r) * TAGCCATCTTTACCAGTTCCC 2 l
Primer g, m (f) * GCAGCAGCACCGGATAAAG 2 l 310 pb
Primer g, m (r) * CATTAACATCCGTCGCGCTAG 2 l
DMSO 5 l
dNTP 10 mM 2 l
Taq 5 unidades / l 2 l
90 l
H1 r / z 10
dH 2 O 55 l Programa 1 94 ° C durante 1 minuto
10X PCR buffer 30 mM MgCl 2 10 l Programa 2 94 ° C durante 1 s
500 mMTris pH8 55 ° C durante 1 s
2,5 mg / ml de BSA 72 ° C durante 20 s
5% de Ficoll 400 Durante 40 ciclos
10 mMTartrazine Pendiente = 2,0
Primer r (f) * CCTGCTATTACTGGTGATC 4μl Programa 3 72 ° C durante 4 minutos 170 pb
Primer r (r) * GTTGAAGGGAAGCCAGCAG 4μl
Primer z 10 (f) * GCACTGGCGTTACTCAATCTC 4μl 360 pb
Primer z 10 (r) * GCATCAGCAATACCACTCGC 4μl
DMSO 5 l
dNTP 10 mM 2 l
Taq 5 unidades / l 2 l
90 l
PCR Master Mix Termociclador (Rapidcycler)
Reactivos Composición / concentración Cantidad   Parámetros Tamaño de espera
H2 1,2 / e, n, x
dH 2 O 63,6 l Programa 1 94 ° C durante 1 minuto
10X PCR buffer 20 mM MgCl 2 10 l Programa 2 94 ° C durante 1 s
500 mMTris pH8 55 ° C durante 1 s
2,5 mg / ml de BSA 72 ° C durante 20 s
5% de Ficoll 400 Durante 40 ciclos
10 mMTartrazine Pendiente = 2,0
Primer 1,2 (f) * AGAAAGCGTATGATGTGAAA 2 l Programa 3 72 ° C durante 4 minutos 290 pb
Primer 1,2 (r) * ATTGTGGTTTTAGTTGCGCC 2 l
Primer e, n, x (f) * TAACTGGCGATACATTGACTG 2 l 150 pb
Primer e, n, x (r) 1 TAGCACCGAATGATACAGCC 2 l
DMSO 5 l
dNTP 10 mM 2 l
Taq 5 unidades / l 2 l
90 l
Genérico H2
dH 2 O 72 l Programa 1 94 ° C durante 1 minuto
10X PCR buffer 30 mM MgCl 2 10 l Programa 2 94 ° C durante 10 s
500 mMTris pH8 45 ° C durante 10 s
2,5 mg / ml de BSA 72 ° C durante 35 s
5% de Ficoll 400 Durante 40 ciclos
10 mMTartrazine Pendiente = 2,0
Primer fljB (f) * CAAGTAATCAACACTAACAGTC 2 l Programa 3 72 ° C durante 4 minutos 1.500 pb
Primer fljB (r) * TTAACGTAACAGAGACAGCAC 2 l
dNTP 10 mM 2 l
Taq 5 unidades / l 2 l
90 l

Tabla 1. Protocolo para la Salmonella flagellinallelotyping PCR: composición, condiciones y resultados esperados.

* La concentración de valores de trabajo de los oligonucleótidos de PCR es de 25 M

Aislar O alelos H1 alelos H2 alelos Serovar
  B C1 C2 D1 E yo g, m r z10 1,2, 1,5, 1,6, 1,7 e, n, x, e, n, Z15 Genérico 1  
1 - - - + - - + - - - - - Enteritidis
2 - - + - - - - - + - + + Hadar / Estambul 3
3 - - + - - + - - - - - + Kentucky
4 - - - - + - - - - + - + Desconocido
5 - + - - - - + - - - - - Montevideo
6 - + - - - - - + - + - + Infantis o Virchow 2
7 - + - - - - - - + - + + Mbandaka
8 + - - - - + - - - + - + Typhimurium
9 + - - - - - - + - + - + Heidelberg
10 + - - - - - - - + + - + Haifa

Tabla 2. Allelotyping resultados de la PCR (Fig. 1) y designación de Salmonella serovar basado en la identificación de la O, H1, H2 y los alelos

> 1 H2 PCR produce una amplificación de 1,5 kb para todos los serotipos poseen flagelina H2, H2, independientemente de los alelos (1). Esta PCR se utiliza para distinguir monofásica de la Salmonella bifásica.
2 H2 multiplex PCR no puede distinguir entre los diferentes alelos para el H2 1,2, 1,5, 1,6, 1,7 complejo antígeno (3).
3 Fago conversión de S. enterica serovar Hadar altera LPS O antígeno para producir serovar Estambul. El O allelotyping PCR no puede discernir estos sutiles cambios genéticos / antigénica.

Serotipo 1 O alelos H1 alelos H2 alelos
  B C1 C2 D1 E yo g, m r z10 1,2, 1,5, 1,6, 1,7 e, n, x, e, n, Z15 Genéricas 2
California + - - - - - + - - - - -
Typhimurium + - - - - + - - - + - +
Heidelberg + - - - - - - + - + - +
Haifa + - - - - - - - + + - +
Montevideo - + - - - - + - - + - +
Othmarschen - + - - - - + - - - - -
Athinai - + - - - + - - - - + +
Papuana - + - - - - - + - - + +
Mbandaka - + - - - - - - + - + +
Chincol - - + - - - + - - - + +
Kentucky - - + - - + - - - - - +
Hadar / Estambul 3 - - + - - - - - + - + +
Enteritidis - - - + - - + - - - - -
La Serena - - - + - + - - - + - +
Campinense - - - + - - - + - - + +
Lomé - - - + - - - + - - - +
Portland - - - + - - - - + + - +
Ruanda - - - + - - - - + - + +
Treguier - - - + - - - - + - - +
Simi - - - - + - - + - - + +
Weltevreden - - - - + - - + - - - +
Kristianstad - - - - + - - - + - + +
Biafra - - - - + - - - + - - +

Tabla 3. Salmonella enterica serovares identificados por PCR Allelotyping

Los serotipos 1 resaltados en negrita son los más comúnmente encontrados por diagnóstico o laboratorio de microbiología de los alimentos.
2 H2 PCR produce una amplificación de 1,5 kb para todos los serotipos poseen flagelina H2, H2, independientemente de los alelos (1). Esta PCR se utiliza para distinguir monofásica de la Salmonella bifásica.
3 Fago conversión de S. enterica serovar Hadar altera LPS O antígeno para producir serovar Estambul. El O allelotyping PCR no puede discernir estos sutiles cambios genéticos / antigénica.

Discussion

La mayoría de los disponibles en el mercado pruebas PCR para la detección de los objetivos de Salmonella único en el género (por ejemplo, invA) genes. Sin embargo, no todos los serotipos son iguales en su capacidad para causar enfermedades en humanos o la prevalencia en las poblaciones animales. El reconocimiento temprano de las diferencias antigénicas de Salmonella LPS O-antígeno y antígenos H2 flagellinH1 y ha dado lugar a la diferenciación de Salmonella en más de 2.500 serotipos sobre la base de estas diferencias antigénicas. Hay 46 diferentes antígenos O y 86 antígenos distintos flagelina (H) identificados en el género Salmonella. Salmonella puede poseer uno (H1) o de dos diferentes (H1 y H2) flagellins. La combinación diferente de O, H1, H2 y cuenta antígenos de los serotipos de Salmonella 2.500 reconocido hoy en día. Un serotipo es asignado sobre la base de la fórmula antigénica derivada de la identificación de la persona antígenos O y H. La fórmula antigénica se escribe como O: H1: H2, y donde "-", se refiere a la ausencia de flagelina H1 o H2 y "NT" (no tipificable) para Salmonella negativo para el antígeno-O. Por ejemplo, el serovar Typhimurium se asigna a una S. enterica aislada con la fórmula antigénica B: i: 1,2, mientras que Enteritidis se le da a un aislamiento con la fórmula D1: g, m: -. Esta variación antigénica en la población de Salmonella es la manifestación externa de las diferencias a nivel de nucleótidos que por lo tanto pueden ser fácilmente explotados por PCR.

Hemos identificado las diferencias genéticas específicas asociadas con los alelos S y H para desarrollar un PCR para la identificación de S. allelotyping enterica serovar: Enteritidis, Hadar, Heidelberg, y Typhimurium (3). La correcta asignación y presentación de informes de Salmonella serovar requiere una prueba para todos los alelos asociados con O: H1: H2 fórmulas antigénicas para Enteritidis (D1: g, m: -), Hadar (C2: z10: e, n, x), Heidelberg (B : r: 1,2) y Typhimurium (B: i: 1,2). Sin el conocimiento del alelo S o antígeno, el hallazgo de la g H1, el alelo m por sí sola no se identifica necesariamente la Salmonella Enteritidis en aislar como otros serotipos de Salmonella: Agona, California, y Montevideo, también poseen este mismo alelo. Mientras que la PCR allelotyping fue originalmente diseñado para detectar un primer plano mencionado serotipos de Salmonella, esta prueba puede identificar otros 19 serotipos (tabla 3). Nuestra allelotyping PCR fue diseñada originalmente para detectar alelos S y H. En la práctica, se ha vuelto más práctico y rentable para que podamos identificar el antígeno-O por la prueba de aglutinación, utilizando antisueros específicos O, en lugar de realizar el PCR allelotyping O cuando se trabaja con cultivos de Salmonella aisladas. Sin embargo, se recomienda utilizar el O allelotyping PCR si el laboratorio utiliza el PCR como una pantalla (2) o para la clasificación presentada en los aislamientos de Salmonella tarjetas FTA (6), e incluyen una PCR específica de Salmonella con la primera pantalla de las muestras (4 ). Limitar la PCR allelotyping a sólo aquellas muestras que se identifican como Salmonella por PCR o pruebas bioquímicas / antigénica.

El protocolo se describe en este artículo ha sido optimizado para su uso con el Rapidcycler Idaho Technology, un termociclador de aire caliente que permite a reducir los volúmenes de reacción y las condiciones de reacción se ejecuta en menos tiempo de lo que muchos termocicladores calefacción bloque. Para adaptar este protocolo para su uso con un termociclador un calentador pueden requerir la optimización de las condiciones de reacción empíricamente mediante la reducción / aumento de las temperaturas de recocido, el ajuste de concentración de los cebadores, o el ajuste de concentraciones de MgCl 2. Por ejemplo, hemos tenido que adaptar el protocolo para el MJ Research PTC-200 termociclador de la siguiente manera. Trabajar con los volúmenes misma reacción en la tabla 1, las acciones de trabajo concentrationof se diluyó el primer set i de 2,5 M, la temperatura de hibridación se redujo de 55 ° C a 45 ° C, y los tiempos de incubación en la desnaturalización, hibridación y extensión de las medidas se alargó a 20 s para el i / g, m allelotyping PCR. Tener el control, positivas y negativas son esenciales en la puesta en marcha inicial y la optimización de los PCR, incluyendo los protocolos publicados. Recomendamos adquirir conocido serotipos de Salmonella, especialmente Anatum (E1: e, h: 1,6), Enteritidis (D1: g, m: -), Hadar (C2: z10: e, n, x), Heidelberg (B: r : 1,2), Montevideo (C1: g, m, s: 1,2,7) y Typhimurium (B: i: 1,2), y un laboratorio de Escherichia coli K12 (DH5a, LE393, JM109, etc ) como controles positivos y negativos, respectivamente, para las pruebas de PCR allelotyping descrito en este artículo. Varios de estos serotipos de Salmonella servirá como control positivo o negativo, dependiendo de qué alelo se pone a prueba.

Ciertas precauciones y pautas se deben seguir al realizar esta y cualquier otro diagnóstico de PCR. En primer lugar, la separación físicade la preparación de la plantilla, PCR puesta en marcha, y la electroforesis en gel es fundamental en la prevención de posibles PCR traspaso de la contaminación y la información errónea de los falsos positivos. Además, la inclusión de los controles adecuados es necesario en cualquier rutina de PCR ya que estos controles identificar los problemas que puedan surgir y ayudar en la interpretación de los resultados (5). Lo más importante, la consistencia es esencial, especialmente en lo que respecta a las condiciones de electroforesis para la detección andestimation amplificación (PCR producto) de tamaño de amplificación. Para ilustrar este punto, a propósito de electroforesis suspendido antes de lo esperado en la figura 1A. Los patrones de peso molecular (calles 1 y 13) y el control positivo (carril 2), no están lo suficientemente separados para estimar con precisión los tamaños y observar la separación de fragmentos de ADN, donde hay pequeñas diferencias (~ 50 pb) en los tamaños. La adecuada separación de los fragmentos de ADN, especialmente los patrones de peso molecular, es fundamental la presentación de informes positivos depende de la estimación precisa del tamaño de amplificación y la distinción "verdaderos positivos" de no amplicones específicos que a veces se observan en el funcionamiento diario de cualquier PCR (5 ). Por ejemplo, hay una amplificación no específicos en la Figura 1B, carril 7 (~ 700 pb de tamaño). Electroforesis había sido descontinuado demasiado pronto, cuando el frente de colorante sólo en el punto a mitad de camino en el gel de agarosa, habría poca diferencia entre 500 pb y 700 pb fragmentos de ADN. Por lo tanto, muestra en la calle 7 que han sido erróneamente reportado como positivo para ambos i y g, m alelos.

Finalmente, es necesario reconocer las limitaciones asociadas a cualquier prueba. Varios de los PCR H1/H2 allelotyping no tiene el poder discriminatorio para distinguir sutiles diferencias genéticas en los alelos que pertenecen a la H2 1,2, 1,5, 1,6, 1,7 complejo antígeno, e, n, x / e , n, Z15 complejo antígeno y el complejo antígeno H1 G, que incluye la g, m alelo. Uno o dos cambios de aminoácidos en cuenta los diferentes epítopos presentes en estos antígenos flagelares. Por lo tanto, difícil para nosotros el diseño de cebadores que podría explotar estas diferencias de base en ocasiones de un solo par en la secuencia del gen de flagelina (3). Por ejemplo, Salmonella serovares Dublin (D1: g, p: -) y Berta (D1: f, g, t: -) también son positivas en la PCR con los g, mallelotyping primers. Los cebadores H2 allelotyping no puede distinguir Typhimurium (B: i: 1,2) de Lagos (B: i: 1,5), Heidelberg (B: r: 1,2) de Bradford (B: r: 1,5), Winneba (B: r: 1,6), o Remo (B: r: 1,7), o Hadar (C2: z10: e, n, x) de Glostrup (C2: z10: e, n, Z15). Mientras que la probabilidad de encontrar algunos de estos serotipos: Lagos, Bradford, Winneba, Remo o Glustrup es remota, es una posibilidad y requiere ya sea proporcionando aviso legal sobre la limitación de las pruebas o de otra prueba confirmatoria.

En conclusión, este serotipo basado en la PCR identifica rápidamente S. enterica serovar Enteritidis, Hadar, Heidelberg y Typhimurium, y O, H1, H2 y los alelos asociados con 19 serotipos adicionales. Este ensayo es una rápida y rentable alternativa al enfoque tradicional microbiológicos de Salmonella serotipo.

Disclosures

No hay conflictos de interés declarado.

Acknowledgments

Este trabajo ha sido subvencionado por el USDA 1999-35212-8680, 2005-01378, y 2010-04288-01, Fondos USDA Fórmula y el Estado de Beca de Investigación Veterinaria de Georgia Medicina Agrícola. El protocolo descrito en esta publicación se ha desarrollado para su uso por los estudiantes como parte de los cursos de investigación dirigido: MIBO 4900L, 4960H GENE, BCMB 4960L, y BIOL 4960H en la Universidad de Georgia y utilizados por los estudiantes en varios proyectos de investigación de epidemiología molecular en el Maurer laboratorio. Queremos agradecer a los muchos estudiantes de pregrado que se han realizado investigaciones en los laboratorios de Maurer y Lee, y nuestro jefe de departamento, John Glisson por apoyar nuestros esfuerzos para integrar la enseñanza de pregrado con la investigación.

Materials

Name Company Catalog Number Comments
Luria Bertani Fisher Scientific (or any comparable source)
Microfuge tubes Fisher Scientific 1.5 ml capacity (or any comparable source)
Ethanol Fisher Scientific 200 proof (or any comparable source)
dH2O Sigma-Aldrich Molecular Biology Grade (or any comparable source; PCR only)
10 x PCR Buffer: Idaho Technologies 20 mM MgCl2 (buffer comes with BSA, Ficoll and Tartrazine)
30 mM MgCl2
40 mM MgCl2
PCR primers
DMSO
dNTP Roche Group (or any comparable source)
Taq DNA Polymerase Denville Scientific (or any comparable source)
Capillary pipettes Idaho Technologies 10 µl volume
Rapid Cycler Idaho Technologies
Agarose Bio-Rad Low EEO; Molecular Biology Grade (or any comparable source)
50 X TAE Buffer or 5X TBE Buffer Fisher Scientific (or any comparable source)
Ethidium bromide Bio-Rad (or any comparable source)
Horizontal, submersible gel electrophoresis chamber with gel mold Bio-Rad (or any comparable source)
Power supply Bio-Rad (or any comparable source)
Molecular Imager Gel Doc System Bio-Rad (or any comparable source)
Table 4. Materials

DOWNLOAD MATERIALS LIST

References

  1. Dauga, C., Zabrovskaia, A., Grimont, P. A. D. Restriction fragment length polymorphism analysis of some flagellin genes of Salmonella enterica. J. Clin. Microbiol. 36, 2835-2843 Forthcoming.
  2. Hong, Y., Liu, T., Lee, M. D., Hofacre, C. L., Maier, M., White, D. G., Ayers, S., Wang, L., Berghaus, R., Maurer, J. A rapid screen of broth enrichments for Salmonella enterica serovars Enteritidis, Hadar, Heidelberg, and Typhimurium using an allelotyping multiplex PCR that targets O and H antigen alleles. J. Food Prot. 72, 2198-2201 (2009).
  3. Hong, Y., Liu, T., Lee, H. ofacre, Maier, C. L., White, M., Ayers, D. G., Wang, S., Berghaus, L., R, M. aurer J.Rapid screening of Salmonella enterica serovars Enteritidis, Hadar, Heidelberg and Typhimurium using a serologically-correlative allelotyping PCR targeting the O and H antigen alleles. BMC Microbiol. (2008).
  4. Liu, T., Liljebjelke, K., Bartlett, E., Hofacre, C. L., Sanchez, S., Maurer, J. J. Application of nested PCR to detection of Salmonella in poultry environments. J. Food Prot. 65, 1227-1232 (2002).
  5. Maurer, J. J. Rapid detection and limitation of molecular techniques. Ann. Rev. Food Sci. Tech. 2, 259-279 (2011).
  6. Moscoso, H., Alvarado, I., Hofacre, C. L. Molecular analysis of infectious bursal disease virus from bursal tissues collected on FTA filter paper. Avian Dis. 50, 391-396 (2006).
  7. Sambrook, J., Fritsch, E. F., Maniatis, T. Molecular cloning: a laboratory. 2nd ed, Cold Spring Harbor Laboratory Press. Cold Spring Harbor, N.Y. (1989).
  8. Wittwer, C. T., Fillmore, G. C., Hillyard, D. R. Automated polymerase chain reaction capillary tubes with hot air. Nucleic Acids Res. 17, 4353-4357 (1989).
Una PCR para la identificación de Allelotyping<em> Salmonella enterica</em> Serotipos Enteritidis, Hadar, Heidelberg, y Typhimurium
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Maurer, J. J., Lee, M. D., Cheng, Y., Pedroso, A. An Allelotyping PCR for Identifying Salmonella enterica serovars Enteritidis, Hadar, Heidelberg, and Typhimurium. J. Vis. Exp. (53), e3130, doi:10.3791/3130 (2011).More

Maurer, J. J., Lee, M. D., Cheng, Y., Pedroso, A. An Allelotyping PCR for Identifying Salmonella enterica serovars Enteritidis, Hadar, Heidelberg, and Typhimurium. J. Vis. Exp. (53), e3130, doi:10.3791/3130 (2011).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter