Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Immunology and Infection

Une PCR pour l'identification allélotypage Salmonella enterica Sérovars Enteritidis, Hadar, Heidelberg et Typhimurium

doi: 10.3791/3130 Published: July 22, 2011

Summary

Nous décrivons un multiplex pour la détection rapide de Salmonella enterica sérovars, Hadar, Heidelberg et Typhimurium PCR. Sérotypes de Salmonella les particuliers peuvent être identifiés, en ciblant un multiplex PCR pour les gènes et les séquences uniques à la grappe biosynthèse de l'antigène O et la flagelline d'un sérovar donné. Sérovar est affecté ensuite à une Salmonella isoler basé sur l'apparence des amplicons spécifiques de taille, (produit de PCR) correspondant à l'allèle cible.

Abstract

Commerciale actuelle des tests PCR pour identifier les gènes cibles Salmonella unique de ce genre. Cependant, il ya deux espèces, six sous-espèces, et plus de 2500 sérotypes de Salmonella les différents, et tous ne sont pas égaux dans leur signification pour la santé publique. Par exemple, trouver S. enterica sous-espèce de l'Arizona IIIa sur une ferme couche de table de l'œuf est insignifiant comparé à l'isolement de S. enterica sérotype Enteritidis, je sous-espèces, la principale cause de salmonellose liée à la consommation d'œufs de table. Sérovars sont identifiés sur la base des différences antigéniques des lipopolysaccharides (LPS) (antigène O) et la flagelline (H1 et H2 antigènes). Ces différences antigéniques sont l'aspect extérieur de la diversité des gènes et allèles du gène associé à ce phénotype.

Nous avons développé une allélotypage, la PCR multiplex que les touches sur les différences génétiques entre les quatre principaux S. enterica sous-espèce de sérovars j'ai trouvé dans la volaille et associés aux maladies humaines importantes aux États-Unis. Les paires d'amorces de PCR ont été ciblées pour les principaux gènes ou des séquences uniques d'un sérotype de Salmonella spécifique et destinée à produire un amplicon avec la taille spécifique pour ce gène ou allèle. Salmonella sérovar est attribué à un isolat basée sur la combinaison des résultats des tests PCR pour LPS spécifiques et allèles du gène flagelline. La PCR multiplex décrit dans cet article sont spécifiques pour la détection de S. enterica sous-espèce, je sérovars Enteritidis, Hadar, Heidelberg et Typhimurium.

Ici, nous montrent comment utiliser les PCR multiplex pour identifier sérovar Salmonella pour un isolé.

Protocol

1. Préparation du modèle PCR

Remarque: Afin de minimiser la contamination PCR report, il est important de conserver plusieurs étapes importantes dans la clé de la PCR physiquement séparés les uns des autres: 1) modèle (ADN) la préparation, 2) l'installation de PCR et l'électrophorèse sur gel 3). Il est également recommandé d'utiliser des conseils barrière afin d'empêcher la contamination de la culture ou de réactif de pipettes.

  1. Inoculer 1 ml de bouillon de Luria Bertani ou tout autre support complexe (Brain Heart Infusion, Superbroth, etc) avec Salmonella isoler une seule colonie isolée. Incuber une nuit de culture à 37 ° C.
  2. Transférer 1 ml d'une solution stérile, tube de 1,5 ml de microcentrifugation capacité, centrifugeuse la suspension de cellules bactériennes à 4500 xg pendant ~ 2 min. pour sédimenter les cellules.
  3. Décanter le surnageant, resuspendre le culot cellulaire dans 1 ml d'éthanol à 100% et mis à température ambiante pendant 10 min. Cellules Pellet comme avant (4500 xg, 2 min.), Éliminer les cellules surnageant et remettre en suspension dans 1 ml de PBS.
  4. Centrifuger les cellules (4500 xg, 2 min.), Jeter les cellules surnageant et resuspendre dans 1 ml de solution stérile O. DH 2
  5. Diluer la suspension cellulaire finale 1 / 20 dans dH 2 O (5 μl/95 ul dH 2 O) et conserver à -20 ° C. La durée de vie de l'ensemble des cellules en tant que modèle de PCR à -20 ° C est d'environ un mois.

2. PCR Setup

Note: La préparation et la distribution du mélange de réaction PCR (gabarit, les tampons, oligonucletoideprimers, nucléotides et l'ADN polymérase Taq) doit être effectuée dans une salle de séparer physiquement dédié et fait de préférence dans un poste de travail PCR / UV.

Remarque: Le PCR de place doit aussi être autonome avec un congélateur à -20 ° C désigné pour le stockage des réactifs de PCR (tampons, des amorces oligonucléotidiques, et nucléotides), les enzymes et le modèle, pipetteur dédié fixé pour l'installation de PCR, des gants en latex jetables , une blouse de laboratoire, embouts, des plaques de microtitration, capillaires en verre, des tubes de microcentrifugeuse, et l'eau de Javel à 10% pour les surfaces de décontamination. Utilisez un ensemble dédié pipetteur (P10, P100 et P1000) pour distribuer les réactifs de PCR. Cet ensemble pipette ne doit jamais quitter le poste de travail mis en place.

Remarque: Obtenir la biologie moléculaire ou PCR de grade dH 2 O et aliquote de 1 ml dans des tubes de 1,5 ml capacité de centrifugation. Distribuer aliquotés dH 2 O après chaque utilisation pour éviter les risques de contamination croisée. Une approche similaire est recommandée avec les réactifs de PCR autres.

Remarque: Décontaminer la zone de travail avant de l'utiliser avec une illumination UV et / ou essuyer les surfaces avec l'eau de Javel à 10%. Porter une blouse de laboratoire et des gants en latex dans l'exécution de l'installation de PCR. Minimiser les deux sens de circulation du PCR mise en place des zones où les réactions de PCR sont incubés dans le thermocylcer et produits de PCR (amplicons) sont séparés sur des gels d'agarose. Si vous retournez dans la mise en place de PCR région, éliminer de la paire de gants en latex que vous portez actuellement et mis sur une nouvelle paire de gants.

  1. Faire un stock primaire maître dans dH 2 O à une concentration de 5x10 -4 M. Diluer les amorces 1 / 20 dans dH 2 O (5 μl/95 ul dH 2 O; 25 pM). La séquence d'oligonucléotides pour chaque amorce tapant flagelline est décrit dans le tableau 1.
  2. Récupérer réactifs de PCR et le modèle de -20 ° C congélateur, et permettre des réactifs et des échantillons pour dégeler la glace. Laissez le Taq ADN polymérase dans le congélateur jusqu'à ce que nécessaire.
  3. Distribuer les réactifs pour mélanger allélotypage réaction PCR comme décrit dans le tableau 1.
  4. Distribuer des 9μl le mélange de PCR dans chacun des 10 puits à fond rond dans un stérile, 96 puits, plaque de microtitration en polystyrène, en commençant par le haut de la colonne (par exemple A1) et le déplacement vers le bas de la colonne au sommet de la suivante.
  5. Ajouter 1 pl de dH 2 O à l'ul 9 du mélange PCR (pas de contrôle ADN) dans le premier puits (A1), 0.5μl des modèles de contrôle positif (i / g, m tapant amorces-Typhimurium et Enteritidis; r/z10 tapant amorces-Heidelberg et Hadar, et 1,2 / e, n, x tapant amorces-Typhimurium et Hadar) à 9 ul du mélange de la PCR dans le 2 ème et (B1) et 1 pl de Escherichia coli K12 DH5a de la 9 ml de mélange de la PCR dans le troisième puits (C1).
  6. Pour chaque puits supplémentaire (D1-H1, A2, B2), ajouter 1 l de l'exemple de modèle dégelée à l'ul 9 du mélange de PCR. Pour le S. i / g, m allélotypage PCR, enterica sérotype Typhimurium (i) et Enteritidis (g, m) servent de témoins positifs, et Salmonella sérovars Heidelberg (r) et Hadar (Z10) sont les contrôles positifs pour la R / Z 10 multiplexe allélotypage PCR.
  7. Placer 10 ul verre d'une capacité capillaires dans détenteurs désignés pour la Rapidcycler Idaho Technology (8).
  8. fois sécurisé dans le support, la charge de chaque capillaire en verre avec le mélange de PCR en touchant le capillaire à l'puits en bas de la plaque de microtitration. Inclinez le support pour permettre au liquide de se déplacer le long du tube et de fournir un espace entre les extrémités et le mix PCR avant thermoscellage les tubes de verre avec une torche au butane pour sceller les deux extrémités des capillaires.
  9. Placer les tubes capillaires et support dans le Rapidcycler Idaho Technology et de l'utilisation des programmes thermocycleur décrits dans le tableau 1 pour les amorces allélotypage différents pour exécuter le PCR.
  10. Passez à l'étape électrophorèse sur gel lorsque le programme du thermocycleur est terminée.

3. Électrophorèse sur gel

Remarque: Porter une blouse de laboratoire différentes désigné pour être utilisé dans le laboratoire de l'électrophorèse et une nouvelle paire de gants en latex jetables.

Note: Porter des lunettes de protection UV des lunettes de protection ou un écran facial et ont toujours été des gants lorsque vous manipulez le bromure d'éthidium, en particulier les gels d'agarose.

  1. Préparer 100 ml fondue de 1,5% (p / v) de biologie moléculaire de grade agarose dans 1xTAE (ou 1X TBE) tampon d'électrophorèse (7) de façon répétée le chauffage de la suspension d'agarose dans un micro-ondes réglé à 20% de puissance pendant 2-5 min avec des intervalles périodiques visuelle d'inspection. Réglez l'agarose fondu dans le bain de 60 ° C l'eau jusqu'à ce qu'elle s'équilibre à la température de l'eau du bain.
  2. Mettre en place le moule du gel avec un peigne avant de couler l'agarose fondu. Choisissez un peigne avec des dents de gel suffisante pour produire assez de puits pour les contrôles, les échantillons, et au moins trois standards de poids moléculaire pour leurs placements aux extrémités et au milieu du gel d'agarose.
  3. Ajouter 2 ul de bromure d'éthidium (10 mg / ml) à 100 ml de liquide de 1,5% (p / v) agarose dans 1xTAE (ou TBE), une bouteille remuer doucement pour mélanger, d'éviter de produire des bulles, et versez doucement le contenu de la bouteille dans le milieu du moule de gel pour 15 par 10 cm de gel d'agarose. Utilisez le bord du papier de soie ou du papier absorbant pour enlever les bulles dans le gel d'agarose.
  4. Laissez le moule du gel fixé à température ambiante jusqu'à ce agarose se solidifie (~ 30-45 min). Transférer le plateau de gel avec du gel et peigne pour submersibles, chambre d'électrophorèse horizontale contenant 1X TAE (ou 1X TBE) tampon d'électrophorèse. Retirer délicatement le peigne du gel d'agarose.
  5. Vérifiez le positionnement du plateau de gel par rapport à la cathode ou pôle positif de la chambre d'électrophorèse pour être sûr de ce pôle se trouve au bas du gel. Note: N'oubliez pas l'ADN chargé négativement migre vers la cathode (ie, «courir au rouge»).
  6. Prémix 200 pi de marqueurs d'ADN de poids moléculaire (0,25 pg / pl) avec 40 pl de l'ADN Dye Chargement 6X. Charge 4,8 ul de l'ADN prémélangé Poids Moléculaire Marker XIV à la première, les puits de milieu et dernier.
  7. Chargez chacun des échantillons de PCR à partir d'puits 2 et progresser à chaque puits ultérieures, se déplaçant de gauche à droite. Évitez de charger l'échantillon dans l'un des puits contenant le standard de poids moléculaire.
  8. Pour charger des échantillons contenus dans chaque capillaire en verre:
    1. Retirez chaque capillaire de son support et etch les deux extrémités du capillaire avec un coupe-verre.
    2. Placez le pouce et l'index des deux mains de chaque côté du capillaire marqué par le coupe-verre et casser le capillaire.
    3. Placez le distributeur capillaire sur l'extrémité opposée du mélange réactionnel de PCR et tournez lentement le piston vers la droite jusqu'à ce que le liquide est au fond même du tube.
    4. Placer le capillaire dans le puits doit être chargé et tournez lentement le piston vers la gauche pour passer l'échantillon de Ficoll-pondérés dans le agarose bien. Attention à ne pas percer le bien avec le capillaire ou introduire une bulle d'air dans le puits en tournant trop de passé, quand le dernier des liquide quitte le capillaire.
  9. Une fois que tous les échantillons et les normes sont chargés, réglez la tension constante de l'alimentation de 90 V (9 volts / cm gel d'agarose).
  10. Cesser d'électrophorèse une fois le colorant jaune (Taurazine) avant est à 1 cm du bas du gel.
  11. Une fois l'électrophorèse est terminée, le transfert du gel pour un transilluminateur UV pour visualiser les fragments d'ADN et des standards de poids moléculaire. Capturer l'image sur un film Polaroid avec un appareil Polaroid avec orange filtre en verre (paramètres: 2 x, y et 4,5) ou comme une image numérique en utilisant une caméra CCD et l'image d'impression avec une imprimante thermique.
  12. Placez le porte-capillaire dans l'eau de Javel à 10% pour les 15-30 min. Rincer 3 fois avec dH 2 O et le lieu de retour dans la chambre de configuration PCR sécher à l'air.

4. Représentant Multiplex résultats de la PCR

Résultats pour allélotypage PCR des isolats de Salmonella 1-10 sont indiquées dans la figure 1 (voies 3-12) et interprété comme suit. Une désignation allèle O est donné à Salmonella isoler basée sur amplicon (produit de PCR) correspondant en taille à la PCR et de contrôle comme prévu pour l'amorce allèle O ensembles utilisés (3): B-560bp, C1-340 pb, C2-400 pb, D1-620 pb, et E1-280 pb. Pour les isolats testés avec la PCR O allélotypage (figure 1A), nous avons attribué O allèles B (voies 10 -13), C1 (pistes 7-9), C2 (lignes 4, 5), D1 (piste 3) et E1 (piste 6) de la salmonelle dix isolats testés dans les couloirs 3-12. Ces mêmes isolats de Salmonella ont été testés, dans le même ordre que la Fig. 1A, pour les allèles H1 i; g, m, r, et z10 (Fig. 1B, C). Encore une fois, un allèle H1 est attribué à chaque isolat dépend de la présence d'un amplicon correspondant en taille à la commande PCR et comme prévu pour l'amorce 4 H1 allèle ensembles utilisés (3): i-510 pb (Fig. 1B, 2 voies ); g, m-310 pb (Fig. 1B, piste 2), r-170 pb (figure 1C, piste 2) et Z10-360 pb (figure 1C, piste 2). Allèles H1 ont été assignés à l'un des dix isolats de Salmonella: i - isole 3 et 8 (Fig. 1B, pistes 5 et 10); g, m-isole 1 et 5 (Fig. 1B, pistes 3 ​​et 7), r pour isole 6 et 9 (Fig. 1C, pistes 8 et 11);. z10 et aux isolats 2, 7 et 10 (Fig. 1C, lignes 4, 9, & 12) Salmonella isoler 4 a été négatif pour les quatre allèles H1 testés. Enfin, les isolats de Salmonella ont été testés par PCR pour les allèles associés à l'H2 1,2; 1,5; 1,6; 1,7 complexe antigène et e, n, x, e, n, Z15 complexe antigène. Les ensembles d'amorces pour l'H2 1,2; 1,5; 1,6; 1,7 complexes et H2 e, n, x, e, n, Z15 complexes produisent 290 pb et 150 pb amplicons, respectivement (3). Les ensembles d'amorces spécifiques ne peuvent pas distinguer les allèles H2 dans les deux antigènes H2 complexes pour attribuer un type allèle définitive, ex. 1,2, à un isolat (3) des isolats de Salmonella 4, 6, 8-10 étaient positifs pour les allèles associés à H2 H2 1,2;. 1,5; 1,6; 1,7 complexe antigène, tandis que les isolats 2 et 7 ont été positifs pour les allèles H2 associé à e, n, x, e, n, Z15 complexe antigène (données non présentées). Alors que les isolats de Salmonella 1, 3 et 5 se sont révélés négatifs pour les deux complexes antigène H2, seuls les isolats 1 et 5 se sont révélés négatifs pour H2 flagelline, telle que déterminée en utilisant un générique H2 flagelline PCR (1) (les données montrent pas). Ces résultats sont résumés dans le tableau 2 avec le sérotype de Salmonella présomptive attribué à chaque isolat.

Figure 1
Figure 1. PCR multiplex pour l'identification spécifique O et H allèles associés à S. enterica sérovars Enteritidis, Hadar, Heidelberg et Typhimurium. (A) O Multiplex PCR allèle. (B, C) H1 Multiplex PCR pour l'identification des allèles Allèles flagelline: i / g, m (B) et r/z10 (C). Lanes 1et 13: 100 pb échelle (Promega, Madison, WI); piste 2: multiplexe contrôles PCR pour les allèles O B, C1, C2, D1, E (A), H1 allèles i / g, m (B), et allèles H1 r/z10 (C) et les voies 3-12: les isolats de Salmonella 1-10 (tableau 2).

PCR Master Mix Thermocycleur (Rapidcycler)
Réactifs Composition / concentration Montant   Paramètres Taille attendue
H1 i / g, m
dH 2 O 63 ul Programme 1 94 ° C pendant 1 min
10X tampon PCR 20 mM MgCl 2 10 ul Programme 2 94 ° C pendant 1 s
500 mMTris pH8 55 ° C pendant 1 s
2,5 mg / ml de BSA 72 ° C pendant 20 s
5% de Ficoll 400 Pour 40 cycles
10 mMTartrazine Pente = 2.0
Primer i (f) * AACGAAATCAACAACAACCTGC 2 pl Programme 3 72 ° C pendant 4 min 510 pb
Primer i (R) * TAGCCATCTTTACCAGTTCCC 2 pl
Primer G, m (f) * GCAGCAGCACCGGATAAAG 2 pl 310 pb
Primer G, M (r) * CATTAACATCCGTCGCGCTAG 2 pl
DMSO 5 pl
dNTP 10 mM 2 pl
Taq 5 unités / ul 2 pl
90 ul
H1 R / Z 10
dH 2 O 55 ul Programme 1 94 ° C pendant 1 min
10X tampon PCR 30 mM MgCl 2 10 ul Programme 2 94 ° C pendant 1 s
500 mMTris pH8 55 ° C pendant 1 s
2,5 mg / ml de BSA 72 ° C pendant 20 s
5% de Ficoll 400 Pour 40 cycles
10 mMTartrazine Pente = 2.0
Primer R (f) * CCTGCTATTACTGGTGATC 4μl Programme 3 72 ° C pendant 4 min 170 pb
Primer (r) * GTTGAAGGGAAGCCAGCAG 4μl
Primer z 10 (f) * GCACTGGCGTTACTCAATCTC 4μl 360 pb
Primer z 10 (r) * GCATCAGCAATACCACTCGC 4μl
DMSO 5 pl
dNTP 10 mM 2 pl
Taq 5 unités / ul 2 pl
90 ul
PCR Master Mix Thermocycleur (Rapidcycler)
Réactifs Composition / concentration Montant   Paramètres Taille attendue
H2 1,2 / e, n, x
dH 2 O 63,6 ul Programme 1 94 ° C pendant 1 min
10X tampon PCR 20 mM MgCl 2 10 ul Programme 2 94 ° C pendant 1 s
500 mMTris pH8 55 ° C pendant 1 s
2,5 mg / ml de BSA 72 ° C pendant 20 s
5% de Ficoll 400 Pour 40 cycles
10 mMTartrazine Pente = 2.0
Primer 1,2 (f) * AGAAAGCGTATGATGTGAAA 2 pl Programme 3 72 ° C pendant 4 min 290 pb
Primer 1,2 (R) * ATTGTGGTTTTAGTTGCGCC 2 pl
Primer e, n, x (f) * TAACTGGCGATACATTGACTG 2 pl 150 pb
Primer e, n, x (r) 1 TAGCACCGAATGATACAGCC 2 pl
DMSO 5 pl
dNTP 10 mM 2 pl
Taq 5 unités / ul 2 pl
90 ul
Génériques H2
dH 2 O 72 ul Programme 1 94 ° C pendant 1 min
10X tampon PCR 30 mM MgCl 2 10 ul Programme 2 94 ° C pendant 10 s
500 mMTris pH8 45 ° C pendant 10 s
2,5 mg / ml de BSA 72 ° C pendant 35 s
5% de Ficoll 400 Pour 40 cycles
10 mMTartrazine Pente = 2.0
Primer fljB (f) * CAAGTAATCAACACTAACAGTC 2 pl Programme 3 72 ° C pendant 4 min 1500 pb
Primer fljB (r) * TTAACGTAACAGAGACAGCAC 2 pl
dNTP 10 mM 2 pl
Taq 5 unités / ul 2 pl
90 ul

Tableau 1. Protocole pour Salmonella flagellinallelotyping PCR: la composition, les conditions et les résultats attendus.

* La concentration stock de travail des amorces oligonucléotidiques de PCR est de 25 uM

Isoler Allèle O Allèle H1 Allèle H2 Sérotype
  B C1 C2 D1 E i g, m r z10 1,2; 1,5; 1,6; 1,7 e, n, x, e, n, Z15 Générique 1  
1 - - - + - - + - - - - - Enteritidis
2 - - + - - - - - + - + + Hadar / Istanbul 3
3 - - + - - + - - - - - + Kentucky
4 - - - - + - - - - + - + Inconnue
5 - + - - - - + - - - - - Montevideo
6 - + - - - - - + - + - + Infantis ou Virchow 2
7 - + - - - - - - + - + + Mbandaka
8 + - - - - + - - - + - + Typhimurium
9 + - - - - - - + - + - + Heidelberg
10 + - - - - - - - + + - + Haïfa

Tableau 2. Allélotypage résultats de la PCR (Fig. 1) et Salmonella Sérotype désignation basée sur l'identification de O, H1, H2 et allèles

> 1 H2 PCR produit un amplicon de 1,5 kb pour tous les Salmonella possédant H2 flagelline, indépendamment de l'allèle H2 (1). Cette PCR est utilisée pour distinguer monophasique de la Salmonella biphasique.
2 multiplex PCR H2 ne peut pas distinguer entre les différents allèles pour le H2 1,2; 1,5; 1,6; 1,7 complexe antigène (3).
3 Conversion phages de S. enterica sérovar Hadar modifie LPS O antigène pour produire sérovar Istanbul. L'O allélotypage PCR ne peut pas discerner ces subtils changements génétiques / antigénique.

Sérotype 1 Allèle O Allèle H1 Allèle H2
  B C1 C2 D1 E i g, m r z10 1,2; 1,5; 1,6; 1,7 e, n, x, e, n, Z15 Générique 2
Californie + - - - - - + - - - - -
Typhimurium + - - - - + - - - + - +
Heidelberg + - - - - - - + - + - +
Haïfa + - - - - - - - + + - +
Montevideo - + - - - - + - - + - +
Othmarschen - + - - - - + - - - - -
Athinai - + - - - + - - - - + +
Papuana - + - - - - - + - - + +
Mbandaka - + - - - - - - + - + +
Chincol - - + - - - + - - - + +
Kentucky - - + - - + - - - - - +
Hadar / Istanbul 3 - - + - - - - - + - + +
Enteritidis - - - + - - + - - - - -
Seremban - - - + - + - - - + - +
Campinense - - - + - - - + - - + +
Lomé - - - + - - - + - - - +
Portland - - - + - - - - + + - +
Ruanda - - - + - - - - + - + +
Tréguier - - - + - - - - + - - +
Simi - - - - + - - + - - + +
Weltevreden - - - - + - - + - - - +
Kristianstad - - - - + - - - + - + +
Biafra - - - - + - - - + - - +

Tableau 3. Salmonella enterica sérovars identifiés par PCR allélotypage

1 Les sérovars en gras sont les plus couramment rencontrées par de diagnostic ou de laboratoire de microbiologie alimentaire.
2 H2 PCR produit un amplicon de 1,5 kb pour tous les Salmonella possédant H2 flagelline, indépendamment de l'allèle H2 (1). Cette PCR est utilisée pour distinguer monophasique de la Salmonella biphasique.
3 Conversion phages de S. enterica sérovar Hadar modifie LPS O antigène pour produire sérovar Istanbul. L'O allélotypage PCR ne peut pas discerner ces subtils changements génétiques / antigénique.

Discussion

La plupart disponibles dans le commerce des tests PCR pour la détection de gènes cibles Salmonella unique pour le genre (ex. invA). Cependant, tous les salmonelles sont égaux dans leur capacité à causer la maladie chez l'homme ou de la prévalence dans les populations animales. La reconnaissance précoce des différences antigéniques de Salmonella LPS O-antigène et flagellinH1 et les antigènes H2 a conduit à la différenciation de Salmonella dans plus de 2500 sérovars en fonction de ces différences antigéniques. Il ya 46 différents antigènes O et 86 distinctes flagelline (H) des antigènes identifiés dans le genre Salmonella. Salmonella peuvent posséder un (H1) ou de deux différentes (H1 et H2) flagellines. La combinaison différente de O, H1 et H2 antigènes compte des sérotypes de Salmonella les 2500 aujourd'hui reconnu. Un sérovar est attribué selon la formule antigénique dérivée de l'identification de l'individu antigènes O et H. La formule antigénique est écrit comme O: H1: H2, et où "-", se réfère à l'absence de H1 ou H2 flagelline et «NT» (non typables) pour Salmonella négatives pour l'antigène O. Par exemple, le sérovar Typhimurium est attribué à un S. enterica isoler avec la formule antigénique B: i: 1,2 alors que Enteritidis est donnée à un isolat avec la D1 la formule: g, m: -. Cette variation antigénique dans la population de Salmonella est la manifestation extérieure de différences au niveau des nucléotides qui peuvent donc être facilement exploitée par PCR.

Nous avons identifié les différences génétiques associés à des allèles O et H pour développer une PCR allélotypage pour identifier S. sérovars enterica: Enteritidis, Hadar, Heidelberg et Typhimurium (3). L'attribution correcte et les rapports de Salmonella sérotype nécessite des tests pour tous les allèles associés à O: H1: formules antigéniques H2 pour Enteritidis (D1: g, m: -), Hadar (C2: z10: e, n, x), Heidelberg (B : r: 1,2), et Typhimurium (B: i: 1,2). Sans la connaissance de l'allèle O ou antigène, la conclusion de la g H1, allèle m ne suffit pas nécessairement identifier les salmonelles isolat comme Enteritidis que d'autres sérotypes de Salmonella les: Agona, en Californie, et à Montevideo, possèdent également cette même allèle. Alors que la PCR allélotypage a été initialement conçu pour détecter l'avant mentionnés sérovars de Salmonella, ce test peut identifier 19 autres sérovars (tableau 3). Notre allélotypage PCR a été initialement conçu pour détecter les allèles O et H. En pratique, il est devenu plus pratique et rentable pour nous d'identifier les O-antigène par agglutination sur lame, en utilisant O antisérum spécifique, plutôt que d'effectuer l'O allélotypage PCR lorsque l'on travaille avec des cultures de Salmonella isolés. Cependant, nous ne recommandons d'utiliser l'O allélotypage PCR si votre laboratoire utilise cette PCR comme un écran (2) ou pour le typage des isolats de Salmonella soumis le FTA cartes (6), et comprennent une PCR Salmonella spécifique avec le premier écran d'échantillons (4 ). Limiter le PCR allélotypage aux seuls échantillons qui sont identifiées comme Salmonella par PCR ou tests biochimiques / antigénique.

Le protocole décrit dans cet article a été optimisé pour une utilisation avec le Rapidcycler Idaho Technology, un thermocycleur à air chaud qui permet de réduire les volumes de réaction et les conditions de réaction fonctionne en moins de temps que de nombreux thermocycleurs bloc de chauffage. Pour adapter ce protocole pour l'utilisation avec un thermocycleur bloc chauffant peut exiger l'optimisation des conditions de réaction empiriquement par l'abaissement / élévation des températures de recuit; ajustant concentrations d'amorces, ou ajuster les concentrations de MgCl 2. Par exemple, nous avons dû adapter le protocole pour le MJ Research PTC-200 thermocycleur comme suit. Travailler avec les volumes réaction décrite dans le tableau 1, le stock de travail concentrationof l'ensemble d'amorces i a été dilué à 2,5 uM, la température de recuit a été abaissé de 55 ° C à 45 ° C, temps d'incubation et à la dénaturation, d'hybridation et l'extension des mesures a été allongée à 20 s pour la PCR i / g, m allélotypage. Ayant les contrôles positifs et négatifs appropriés sont essentiels dans le démarrage initial et d'optimisation pour les PCR, y compris les protocoles publiés. Nous recommandons l'acquisition de sérotypes de Salmonella les connus, spécifiquement anatum (E1: E, H: 1,6), Enteritidis (D1: g, m: -), Hadar (C2: z10: e, n, x), Heidelberg (B: r : 1,2), Montevideo (C1: g, m, s: 1,2,7) et Typhimurium (B: i: 1,2) et un laboratoire d'Escherichia coli K12 (DH5a, LE393, JM109, etc ) comme contrôles positifs et négatifs, respectivement pour les tests de PCR allélotypage décrit dans cet article. Plusieurs de ces sérotypes de Salmonella les servira comme contrôles positifs ou négatifs, selon le allèle est testé.

Certaines précautions et les directives doivent être suivies tout en effectuant ceci et tout autre diagnostic par PCR. Tout d'abord, la séparation physiquede la préparation de modèles, PCR set-up, et électrophorèse sur gel est essentiel dans la prévention de possibles PCR report de contamination et de rapports erronés de faux positifs. En outre, l'inclusion de contrôles appropriés sont nécessaires dans toute routine PCR comme ces contrôles d'identifier les problèmes à mesure qu'ils surviennent et d'aider à l'interprétation des résultats (5). Surtout, la cohérence est essentielle, notamment en ce qui concerne les conditions d'électrophorèse pour les andestimation amplicon détection (produit PCR) de taille de l'amplicon. Pour illustrer ce point, nous avons délibérément suspendu électrophorèse plus tôt que prévu à la figure 1A. Les standards de poids moléculaire (voies 1 et 13) et le contrôle positif (piste 2) ne sont pas suffisamment séparés pour estimer avec précision tailles ou d'observer la séparation de fragments d'ADN où il ya des petites différences (~ 50 pb) dans les tailles. Une séparation adéquate des fragments d'ADN, en particulier les normes de poids moléculaire, est essentiel que les rapports positifs dépend de l'estimation précise de la taille amplicon et de distinguer «vrai positif» de la non-spécifiques amplicons qui sont parfois observés dans le fonctionnement quotidien de toute la PCR (5 ). Par exemple, il ya un amplicon non spécifiques à la figure 1B, piste 7 (~ 700 pb de taille). Avaient été abandonnées par électrophorèse trop tôt, quand le front de colorant a été seulement au point à mi-chemin dans le gel d'agarose, il y aurait peu de différenciation entre 500 pb et 700 pb des fragments d'ADN. Par conséquent, l'échantillon dans le couloir 7 aurait été indiqué à tort comme positive pour les deux i et g, m allèles.

Enfin, on doit reconnaître les limites associées à toute épreuve. Plusieurs des PCR H1/H2 allélotypage n'ont pas le pouvoir de discrimination subtile à discerner des différences génétiques dans allèles appartenant à l'H2 1,2; 1,5; 1,6; 1,7 complexe antigène; e, n, x / e , n, Z15 complexe antigène et le complexe antigène G H1, qui comprend le g, m allèle. Un ou deux changements d'acides aminés représentent les épitopes différents présents dans ces antigènes flagellaires. Il était donc difficile pour nous de concevoir des amorces qui pourraient exploiter ces différences, parfois seule paire de base dans la séquence du gène flagelline (3). Par exemple, Salmonella sérovars Dublin (D1: g, p: -) et Berta (D1: f, g, t: -) sont également positifs par PCR avec nos g, mallelotyping amorces. Les amorces H2 allélotypage ne peut pas distinguer Typhimurium (B: i: 1,2) de Lagos (B: i: 1,5), Heidelberg (B: r: 1,2) de Bradford (B: r: 1,5), Winneba (B: r: 1,6), ou Remo (B: r: 1,7), ou Hadar (C2: z10: e, n, x) de Glostrup (C2: z10: E, N, Z15). Alors que la probabilité de rencontrer certains de ces sérotypes: Lagos, Bradford, Winneba, Remo ou Glustrup est distant, c'est une possibilité et nécessite soit en fournissant disclaimer sur la limitation des essais »ou un autre test de confirmation.

En conclusion, cette sérotypage basé sur la PCR identifie rapidement S. enterica sérovars Enteritidis, Hadar, Heidelberg et Typhimurium, et O, H1, H2 et allèles associés à 19 sérovars supplémentaires. Ce dosage est rapide, efficace alternative à l'approche microbiologique traditionnelle à Salmonella sérotype.

Disclosures

Aucun conflit d'intérêt déclaré.

Acknowledgments

Ce travail a été soutenu par l'USDA 1999-35212-8680 subventions, de 2005 à 01378, et 2010-04288-01, USDA fonds à formule et l'État de Géorgie Subvention de recherche en médecine vétérinaire agricole. Le protocole décrit dans la présente publication a été développé pour une utilisation par les étudiants dans le cadre de cours de recherche dirigée: MIBO 4900L, GENE 4960H, BCMB 4960L et 4960H BIOL à l'Université de Géorgie et utilisés par les étudiants sur plusieurs projets de recherche en épidémiologie moléculaire dans l'Maurer laboratoire. Nous tenons à remercier les nombreux étudiants de premier cycle qui ont effectué des recherches dans les laboratoires de Maurer et Lee, et notre chef de département, John Glisson pour soutenir nos efforts pour intégrer l'enseignement de premier cycle à la recherche.

Materials

Name Company Catalog Number Comments
Luria Bertani Fisher Scientific (or any comparable source)
Microfuge tubes Fisher Scientific 1.5 ml capacity (or any comparable source)
Ethanol Fisher Scientific 200 proof (or any comparable source)
dH2O Sigma-Aldrich Molecular Biology Grade (or any comparable source; PCR only)
10 x PCR Buffer: Idaho Technologies 20 mM MgCl2 (buffer comes with BSA, Ficoll and Tartrazine)
30 mM MgCl2
40 mM MgCl2
PCR primers
DMSO
dNTP Roche Group (or any comparable source)
Taq DNA Polymerase Denville Scientific (or any comparable source)
Capillary pipettes Idaho Technologies 10 µl volume
Rapid Cycler Idaho Technologies
Agarose Bio-Rad Low EEO; Molecular Biology Grade (or any comparable source)
50 X TAE Buffer or 5X TBE Buffer Fisher Scientific (or any comparable source)
Ethidium bromide Bio-Rad (or any comparable source)
Horizontal, submersible gel electrophoresis chamber with gel mold Bio-Rad (or any comparable source)
Power supply Bio-Rad (or any comparable source)
Molecular Imager Gel Doc System Bio-Rad (or any comparable source)
Table 4. Materials

DOWNLOAD MATERIALS LIST

References

  1. Dauga, C., Zabrovskaia, A., Grimont, P. A. D. Restriction fragment length polymorphism analysis of some flagellin genes of Salmonella enterica. J. Clin. Microbiol. 36, 2835-2843 Forthcoming.
  2. Hong, Y., Liu, T., Lee, M. D., Hofacre, C. L., Maier, M., White, D. G., Ayers, S., Wang, L., Berghaus, R., Maurer, J. A rapid screen of broth enrichments for Salmonella enterica serovars Enteritidis, Hadar, Heidelberg, and Typhimurium using an allelotyping multiplex PCR that targets O and H antigen alleles. J. Food Prot. 72, 2198-2201 (2009).
  3. Hong, Y., Liu, T., Lee, H. ofacre, Maier, C. L., White, M., Ayers, D. G., Wang, S., Berghaus, L., R, M. aurer J.Rapid screening of Salmonella enterica serovars Enteritidis, Hadar, Heidelberg and Typhimurium using a serologically-correlative allelotyping PCR targeting the O and H antigen alleles. BMC Microbiol. (2008).
  4. Liu, T., Liljebjelke, K., Bartlett, E., Hofacre, C. L., Sanchez, S., Maurer, J. J. Application of nested PCR to detection of Salmonella in poultry environments. J. Food Prot. 65, 1227-1232 (2002).
  5. Maurer, J. J. Rapid detection and limitation of molecular techniques. Ann. Rev. Food Sci. Tech. 2, 259-279 (2011).
  6. Moscoso, H., Alvarado, I., Hofacre, C. L. Molecular analysis of infectious bursal disease virus from bursal tissues collected on FTA filter paper. Avian Dis. 50, 391-396 (2006).
  7. Sambrook, J., Fritsch, E. F., Maniatis, T. Molecular cloning: a laboratory. 2nd ed, Cold Spring Harbor Laboratory Press. Cold Spring Harbor, N.Y. (1989).
  8. Wittwer, C. T., Fillmore, G. C., Hillyard, D. R. Automated polymerase chain reaction capillary tubes with hot air. Nucleic Acids Res. 17, 4353-4357 (1989).
Une PCR pour l&#39;identification allélotypage<em> Salmonella enterica</em> Sérovars Enteritidis, Hadar, Heidelberg et Typhimurium
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Maurer, J. J., Lee, M. D., Cheng, Y., Pedroso, A. An Allelotyping PCR for Identifying Salmonella enterica serovars Enteritidis, Hadar, Heidelberg, and Typhimurium. J. Vis. Exp. (53), e3130, doi:10.3791/3130 (2011).More

Maurer, J. J., Lee, M. D., Cheng, Y., Pedroso, A. An Allelotyping PCR for Identifying Salmonella enterica serovars Enteritidis, Hadar, Heidelberg, and Typhimurium. J. Vis. Exp. (53), e3130, doi:10.3791/3130 (2011).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter