Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Immunology and Infection

पहचान के लिए एक Allelotyping पीसीआर साल्मोनेला enterica Serovars Enteritidis, Hadar, हीडलबर्ग, और typhimurium

doi: 10.3791/3130 Published: July 22, 2011

Summary

हम साल्मोनेला enterica serovars Enteritidis, Hadar, हीडलबर्ग, और typhimurium के तेजी से पता लगाने के लिए एक मल्टीप्लेक्स पीसीआर का वर्णन करता है. विशिष्ट साल्मोनेला serovars एक जीन और हे प्रतिजन biosynthesis और एक दिया serovar के क्लस्टर flagellin अद्वितीय दृश्यों के लिए पीसीआर मल्टीप्लेक्स लक्ष्यीकरण द्वारा पहचाना जा सकता है. Serovar तो एक साल्मोनेला को सौंपा है अलग विशिष्ट आकार की (पीसीआर उत्पाद) amplicons लक्ष्य एलील के संगत की उपस्थिति पर आधारित है.

Abstract

वर्तमान साल्मोनेला लक्ष्य इस जीनस के लिए अद्वितीय जीन की पहचान करने के लिए वाणिज्यिक PCRs परीक्षण. हालांकि, वहाँ दो प्रजातियों, छह उप प्रजातियों, और 2,500 से अधिक विभिन्न साल्मोनेला serovars हैं, और नहीं सब उनके महत्व में सार्वजनिक स्वास्थ्य के लिए बराबर हैं. उदाहरण के लिए, एस ढूँढने enterica एक मेज अंडे परत खेत पर उपप्रजाति IIIa एरिज़ोना एस के अलगाव की तुलना में नगण्य है enterica उपप्रजाति मैं serovar Enteritidis, सलमोनेलोसिज़ के प्रमुख कारण तालिका अंडे की खपत से जुड़े. Serovars lipopolysaccharide में प्रतिजनी मतभेदों (LPS) (हे प्रतिजन) और flagellin (H1 और H2 प्रतिजनों) के आधार पर पहचाने जाते हैं. ये प्रतिजनी मतभेदों इस phenotype के साथ जुड़े जीन और जीन alleles की विविधता के जावक उपस्थिति हैं.

हम एक allelotyping विकसित मल्टीप्लेक्स पीसीआर है, कि चार प्रमुख एस के बीच आनुवंशिक अंतर पर चाबी enterica उपप्रजाति मैं serovars पोल्ट्री में पाया है और अमेरिका में महत्वपूर्ण मानव रोग के साथ जुड़े. पीसीआर प्राइमर जोड़े कुंजी जीन या एक विशिष्ट साल्मोनेला serovar के लिए अद्वितीय और दृश्यों कि जीन या एलील के लिए विशिष्ट आकार के साथ एक amplicon उत्पादन डिजाइन के लिए लक्षित थे साल्मोनेला serovar के लिए एक विशिष्ट LPS के लिए पीसीआर परीक्षण के परिणाम के संयोजन के आधार पर अलग सौंपा और flagellin जीन alleles. मल्टीप्लेक्स इस आलेख में वर्णित PCRs एस का पता लगाने के लिए विशिष्ट हैं उपप्रजाति मैं serovars Enteritidis enterica, Hadar, हीडलबर्ग, और साल्मोनेला.

यहाँ हम प्रदर्शन कैसे मल्टीप्लेक्स PCRs का उपयोग करने के लिए साल्मोनेला के लिए serovar पहचान अलग है.

Protocol

1. पीसीआर खाका तैयार

नोट: आदेश में पीसीआर carryover संदूषण को कम करने के लिए, यह महत्वपूर्ण है पीसीआर शारीरिक रूप से एक दूसरे से अलग में कई महत्वपूर्ण कदम रखने: टेम्पलेट) 1 (डीएनए) तैयारी, 2) पीसीआर सेटअप, और 3) जेल वैद्युतकणसंचलन . यह भी बाधा सुझावों का उपयोग pipetters की संस्कृति या अभिकर्मक के प्रदूषण को रोकने के क्रम में करने की सिफारिश की है.

  1. Luria Bertani शोरबा या साल्मोनेला के साथ अन्य जटिल मध्यम (ब्रेन हार्ट आसव, Superbroth, आदि) के 1 मिलीलीटर टीका लगाना एक एकल पृथक कॉलोनी से अलग. संस्कृति 37 पर रातोंरात सेते डिग्री सेल्सियस
  2. एक बाँझ, 1.5 मिलीलीटर क्षमता microfuge ट्यूब स्थानांतरण मिलीलीटर 1 ~ 2 मिनट के लिए 4,500 XG पर बैक्टीरिया कोशिका निलंबन अपकेंद्रित्र. गोली कोशिकाओं के लिए.
  3. छानना सतह पर तैरनेवाला, 10 मिनट के लिए 100% इथेनॉल और सेट के 1 मिलीलीटर में सेल गोली कमरे के तापमान पर resuspend. गोली से पहले (4500 XG, 2 मिनट है.) के रूप में कोशिकाओं, 1 मिलीलीटर पीबीएस में सतह पर तैरनेवाला और resuspend कोशिकाओं को हटा दें.
  4. अपकेंद्रित्र कोशिकाओं (4,500 XG, 2 मिनट), बाँझ DH 2 ओ के 1 मिलीलीटर में सतह पर तैरनेवाला और resuspend कोशिकाओं त्यागने
  5. DH 2 (5 μl/95 μl DH 2 हे) हे और दुकान -20 डिग्री सेल्सियस में अंतिम सेल निलंबन 1 / 20 पतला -20 डिग्री सेल्सियस पर पीसीआर टेम्पलेट के रूप में पूरे कोशिकाओं की शेल्फ जीवन एक महीने के बारे में है.

2. पीसीआर सेटअप

नोट: पीसीआर प्रतिक्रिया मिश्रण (टेम्पलेट, buffers, oligonucletoideprimers nucleotides और Taq डीएनए पोलीमरेज़) की तैयारी और वितरण के लिए एक शारीरिक रूप से अलग समर्पित और अधिमानतः एक पीसीआर / यूवी वर्कस्टेशन में किया कमरे में प्रदर्शन की जरूरत है .

नोट: पीसीआर ऊपर सेट कमरा भी पीसीआर अभिकर्मकों के भंडारण के लिए एक नामित -20 डिग्री सेल्सियस फ्रीजर (बफ़र्स, oligonucleotide प्राइमरों, और nucleotides), एंजाइमों और टेम्पलेट के साथ आत्म निहित होना चाहिए, समर्पित pipetter पीसीआर सेटअप, डिस्पोजेबल लाटेकस दस्ताने के लिए सेट , प्रयोगशाला कोट, बाधा सुझावों, प्लेटें microtiter, गिलास capillaries, microfuge ट्यूब है, और decontaminating सतहों के लिए 10% ब्लीच. एक समर्पित pipetter सेट (P10, P100, और P1000) का उपयोग करने के लिए पीसीआर अभिकर्मकों बांटना. यह विंदुक सेट वर्कस्टेशन सेट अप कभी नहीं छोड़ना चाहिए.

नोट: 1.5 मिलीलीटर क्षमता अपकेंद्रित्र ट्यूबों में आणविक जीव विज्ञान या पीसीआर ग्रेड DH 2 हे और 1 मिलीलीटर विभाज्य प्राप्त. प्रत्येक के लिए संभव पार संक्रमण से बचने के उपयोग के बाद aliquoted DH 2 हे बग़ैर . अन्य पीसीआर अभिकर्मकों के साथ एक समान दृष्टिकोण की सिफारिश की है.

नोट: यूवी रोशनी और / या नीचे 10% ब्लीच के साथ पोंछते सतहों के साथ का उपयोग करने से पहले कार्य क्षेत्र को शुद्ध करना. पीसीआर सेटअप प्रदर्शन में प्रयोगशाला कोट और लाटेकस दस्ताने पहनें. आगे और पीछे पीसीआर से यातायात न्यूनतम क्षेत्रों में जहां पीसीआर प्रतिक्रियाओं thermocylcer और पीसीआर उत्पादों (amplicons) agarose जैल पर अलग हो रहे हैं में incubated रहे हैं के लिए सेट अप. यदि आप पीसीआर क्षेत्र सेट - अप में वापस चले जाओ, आप वर्तमान में पहन रहे हैं और दस्ताने की एक नई जोड़ी पर डाल लाटेकस दस्ताने की जोड़ी के निपटान.

  1. 5x10 -4 एम. के एक एकाग्रता के लिए DH 2 ओ में एक मास्टर प्राइमर शेयर करें DH 2 हे (25 सुक्ष्ममापी 5 μl/95 μl DH 2 ओ) में 1 / 20 प्राइमरों पतला. प्रत्येक flagellin टाइपिंग प्राइमर के लिए oligonucleotide अनुक्रम तालिका 1 में वर्णित है.
  2. -20 डिग्री सेल्सियस फ्रीजर से पीसीआर अभिकर्मकों और टेम्पलेट को पुन: प्राप्त है, और अभिकर्मकों और नमूने पर बर्फ पिघलना अनुमति देते हैं. फ्रीजर में Taq डीएनए पोलीमरेज़ छोड़ दें जब तक की जरूरत है.
  3. Allelotyping पीसीआर प्रतिक्रिया के रूप में तालिका 1 में वर्णित मिश्रण के लिए अभिकर्मकों बग़ैर.
  4. पीसीआर प्रतिक्रिया मिश्रण के 10 दौर नीचे कुओं में से प्रत्येक में 9μl एक बाँझ 96 अच्छी तरह से, polystyrene microtiter प्लेट में बांटना स्तंभ (जैसे A1:) के शीर्ष पर शुरू और नीचे जाने के अगले के शीर्ष करने के लिए स्तंभ.
  5. पीसीआर मिश्रण (नहीं डीएनए नियंत्रण) के 9 μl पहली (A1:) अच्छी तरह से, सकारात्मक नियंत्रण टेम्पलेट्स (0.5μl DH 2 हे 1 μl जोड़ें मैं / जी, मीटर प्राइमरों typhimurium टाइपिंग और Enteritidis; r/z10 प्राइमरों हीडलबर्ग और Hadar टाइपिंग, और 1,2 / ई, n, x टाइपिंग प्राइमरों typhimurium और Hadar) 2 एन डी में पीसीआर अच्छी तरह से मिश्रण (B1) के 9 μl, और Escherichia कोलाई की एक μl K12 DH5α तीसरे कुएं में 9 पीसीआर मिश्रण के मिलीलीटर (C1).
  6. प्रत्येक अतिरिक्त अच्छी तरह के लिए (D1-H1, बी 2 A2,), पीसीआर प्रतिक्रिया मिश्रण के 9 μl thawed नमूना टेम्पलेट की एक μl जोड़ें. मैं / छ, मीटर allelotyping पीसीआर, एस के लिए enterica serovar (i) typhimurium और Enteritidis (छ, मीटर) सकारात्मक नियंत्रण के रूप में सेवा करते हैं, और साल्मोनेला serovars हीडलबर्ग (नि.) और Hadar (z10 के) r / z 10 allelotyping मल्टीप्लेक्स पीसीआर के लिए सकारात्मक नियंत्रण कर रहे हैं .
  7. 10 μl क्षमता गिलास capillaries Idaho प्रौद्योगिकी Rapidcycler (8) के लिए नामित धारकों में रखें.
  8. एक बार धारक में सुरक्षित लोड करने के लिए, प्रत्येक गिलास केशिका छू द्वारा पीसीआर प्रतिक्रिया मिश्रण के साथ केशिकाmicrotiter प्लेट के नीचे कुओं. तरल नीचे ट्यूब को स्थानांतरित करने के लिए और समाप्त होता है और गर्मी ब्यूटेन मशाल के साथ ग्लास ट्यूब सील capillaries के दोनों सिरों मुहर से पहले पीसीआर मिश्रण के बीच अंतरिक्ष प्रदान की अनुमति धारक झुकाएँ.
  9. Idaho प्रौद्योगिकी Rapidcycler में केशिका ट्यूब और धारक प्लेस और thermocycler विभिन्न allelotyping प्राइमरों के लिए तालिका 1 में वर्णित पीसीआर चलाने के कार्यक्रमों का उपयोग करें.
  10. जब thermocycler कार्यक्रम पूरा हो गया है जेल वैद्युतकणसंचलन कदम के लिए आगे बढ़ें.

3. जेल वैद्युतकणसंचलन

नोट: वैद्युतकणसंचलन प्रयोगशाला में उपयोग के लिए नामित एक अलग प्रयोगशाला कोट और प्रयोज्य लाटेकस दस्ताने की एक नई जोड़ी पहन लो .

नोट: यूवी सुरक्षात्मक आँख चश्मे या चेहरे के कवच पहनें और हमेशा दस्ताने थे जब ethidium ब्रोमाइड, विशेष रूप से agarose जैल से निपटने.

  1. 100 पिघला हुआ मिलीलीटर 1.5% (w / v) आणविक 1xTAE में जीव विज्ञान ग्रेड agarose (या 1X TBE) वैद्युतकणसंचलन बफर (7) बार - बार एक आवधिक दृश्य के साथ 2-5 मिनट के अंतराल के लिए 20% की सत्ता में निर्धारित माइक्रोवेव में agarose निलंबन हीटिंग द्वारा तैयार निरीक्षण. 60 डिग्री सेल्सियस पानी के स्नान में पिघला हुआ agarose सेट जब तक यह पानी के स्नान के तापमान के लिए equilibrates.
  2. पिघला हुआ agarose गिरने से पहले कंघी के साथ जेल मोल्ड सेट करें. नियंत्रण, नमूने, और कम से कम 3 समाप्त होता है और agarose जेल के बीच में अपने नियुक्तियों के लिए आणविक भार मानकों के लिए पर्याप्त कुओं का उत्पादन पर्याप्त दांत के साथ एक जेल कंघी चुनें.
  3. 100 मिलीलीटर ethidium ब्रोमाइड के 2 μl (10 मिलीग्राम / एमएल) जोड़ें पिघला हुआ 1.5% (w / v) 1xTAE में agarose (या TBE), धीरे ज़ुल्फ़ मिश्रण बोतल, बुलबुले के उत्पादन से बचने के लिए, और धीरे बोतल की सामग्री डाल 15 के लिए 10 सेमी agarose जेल द्वारा जेल आचारण के बीच में. टिशू पेपर या कागज तौलिया के किनारे का प्रयोग agarose जेल में किसी भी बुलबुले को दूर करने के लिए.
  4. जेल agarose solidifies (~ 30-45 मिनट) तक कमरे के तापमान पर सेट मोल्ड चलो. जेल और पनडुब्बी, क्षैतिज वैद्युतकणसंचलन 1X (या 1X TBE) वैद्युतकणसंचलन बफर TAE युक्त चैम्बर कंघी के साथ जेल ट्रे स्थानांतरण. धीरे agarose जेल से कंघी को हटा दें.
  5. कैथोड या वैद्युतकणसंचलन चैम्बर के सकारात्मक पोल के सापेक्ष यकीन है कि इस पोल जेल के नीचे है जेल ट्रे के स्थान की जाँच करें. नोट: कैथोड की दिशा में नकारात्मक आरोप लगाया डीएनए उत्प्रवासित (यानी, "लाल को चलाने के") याद रखें.
  6. Premix डीएनए 6X डीएनए लोड हो रहा है डाई के 40 μl के साथ वजन आणविक मार्करों (0.25 μg / μl) के 200 μl. प्रथम, मध्य और अंतिम कुओं premixed डीएनए आण्विक वजन मार्कर XIV 4.8 μl लोड.
  7. पीसीआर नमूने के प्रत्येक लोड 2 अच्छी तरह के साथ शुरू करने और प्रत्येक बाद अच्छी तरह से अग्रिम, बाएँ से सही करने के लिए आगे बढ़. आणविक भार मानक युक्त कुओं में से किसी में नमूना लोड हो रहा से बचें.
  8. प्रत्येक गिलास केशिका में निहित नमूने लोड करने के लिए:
    1. इसके धारक और एक ग्लास कटर के साथ केशिका के खोदना दोनों सिरों से प्रत्येक केशिका निकालें.
    2. प्लेस अंगूठे और केशिका ग्लास कटर द्वारा चिह्नित के दोनों ओर दोनों हाथों की तर्जनी और केशिका तस्वीर.
    3. पीसीआर प्रतिक्रिया मिश्रण के विपरीत अंत पर केशिका दवासाज़ प्लेस और धीरे धीरे बारी दक्षिणावर्त जब तक तरल ट्यूब के बहुत नीचे पर है सवार.
    4. लोड किया जा अच्छी तरह से में केशिका प्लेस और धीरे धीरे सवार Ficoll भारित अच्छी तरह agarose में नमूना बांटना दक्षिणावर्त बारी. केशिका या बहुत ज्यादा पिछले मोड़ जब तरल के पिछले केशिका पत्तियों के द्वारा अच्छी तरह से में एक हवाई बुलबुले परिचय के साथ अच्छी तरह से पंचर नहीं सावधान रहो.
  9. एक बार जब सभी नमूनों और मानकों लोड कर रहे हैं, 90 के लिए बिजली की आपूर्ति की निरंतर वोल्टेज सेट वी (9 / वोल्ट सेमी agarose जेल).
  10. वैद्युतकणसंचलन बंद एक बार पीला डाई सामने (Taurazine) जेल के नीचे से 1 सेमी है.
  11. एक बार वैद्युतकणसंचलन पूरा हो गया है, एक यूवी transilluminator जेल स्थानांतरण करने के लिए डीएनए टुकड़े और आणविक भार मानक कल्पना. या एक डिजिटल छवि के रूप में एक थर्मल प्रिंटर के साथ एक सीसीडी कैमरा और प्रिंट छवि का उपयोग कर: Polaroid फिल्म पर नारंगी कांच फिल्टर (2 x, और 4.5 y सेटिंग) के साथ एक Polaroid कैमरे का उपयोग कर छवि कैप्चर.
  12. 15-30 मिनट के लिए 10% ब्लीच में केशिका धारकों प्लेस. DH 2 हे और पीसीआर सेटअप कमरे में वापस शुष्क हवा करने के लिए जगह के साथ 3 बार कुल्ला करें.

4. प्रतिनिधि मल्टीप्लेक्स पीसीआर परिणाम

साल्मोनेला के allelotyping पीसीआर के लिए परिणाम आइसोलेट्स चित्रा 1 (12/03 गलियों) में 1-10 दिखाए जाते हैं और के रूप में निम्नानुसार व्याख्या. एक हे एलील पदनाम साल्मोनेला के लिए दिया जाता है अलग amplicon (पीसीआर उत्पाद) पीसीआर को नियंत्रित करने के लिए आकार में मिलान पर आधारित है और हे एलील प्राइमर के लिए भविष्यवाणी के रूप में इस्तेमाल किया (3) सेट: बी 560bp, C1-340bp, बीपी C2 400, D1-620 बीपी, और E1-280 बीपी. हे allelotyping (छवि 1A) पीसीआर, हम हे alleles बी (10 गलियों सौंपा के साथ परीक्षण आइसोलेट्स के लिए -13), C1 (7-9 गलियों), C2 (4 गलियों, 5), (3 लेन) D1, दस साल्मोनेला और E1 (6 लेन) आइसोलेट्स 3-12 गलियों में परीक्षण किया गया. ये वही साल्मोनेला आइसोलेट्स, चित्र के रूप में एक ही क्रम में परीक्षण किया गया. 1 ए, एच 1 alleles के लिए मैं, जी, मीटर, आर, और z10 के (छवि 1 बी, सी). फिर, एक H1 एलील प्रत्येक के लिए आवंटित एक पीसीआर को नियंत्रित करने के लिए आकार में मिलान amplicon की उपस्थिति पर निर्भर अलग है और 4 H1 एलील प्राइमर के लिए भविष्यवाणी के रूप में इस्तेमाल किया (3) सेट: i-510 बीपी (छवि 1B, 2 लेन ); जी, मीटर-310 बीपी (छवि 1B, लेन 2); r-170 बीपी (छवि 1C, लेन 2), और z10-360 बीपी (छवि 1C, लेन 2). H1 alleles के दस साल्मोनेला आइसोलेट्स के लिए सौंपा गया: मैं - 3 और 8 (छवि 1B, 5 एवं 10 गलियों) आइसोलेट्स, छ, 1 मीटर आइसोलेट्स और 5 (छवि 1B, 3 और 7 गलियों), आर आइसोलेट्स 6 और 9 (छवि 1C, गलियों 8 और 11), 2 आइसोलेट्स, 7, और 10 (छवि 1C, 4 गलियों, 9, और 12) और z10 के साल्मोनेला अलग 4 चार H1 alleles के परीक्षण के लिए नकारात्मक था . अंत में, साल्मोनेला आइसोलेट्स पीसीआर द्वारा H2 1,2 के साथ जुड़े alleles के लिए परीक्षण किया गया, 1,5, 1,6, 1,7 प्रतिजन जटिल और ई, n, x, ई, n, z15 प्रतिजन जटिल. 1,2 H2 के लिए प्राइमर सेट, 1,5, 1,6, 1,7 जटिल और H2 ई, n, x, ई, n, z15 जटिल 290 बीपी और 150 बीपी amplicons, क्रमशः (3) का उत्पादन. प्राइमर सेट या तो H2 प्रतिजन के भीतर विशिष्ट H2 alleles के लिए एक निश्चित एलील प्रकार, पूर्व असाइन जटिल भेद नहीं कर सकते हैं. 1,2, (3) साल्मोनेला आइसोलेट्स 4, 6, 8-10 H2 H2 1,2 के साथ जुड़े alleles के लिए सकारात्मक थे अलग, 1,5, 1,6, 1,7 प्रतिजन जटिल, जबकि 2 आइसोलेट्स और 7 H2 ई, n, x के साथ जुड़े alleles के लिए सकारात्मक थे, ई, n, z15 प्रतिजन जटिल (नहीं दिखाया डेटा है). हालांकि साल्मोनेला आइसोलेट्स 1, 3, और 5 दो H2 प्रतिजन परिसरों के लिए नकारात्मक रहे थे, केवल 1 और 5 आइसोलेट्स H2 flagellin के लिए नकारात्मक रहे थे, के रूप में एक सामान्य H2 flagellin (1) पीसीआर (दिखाने के लिए नहीं डेटा) का उपयोग करके निर्धारित है. इन परिणामों प्रकल्पित साल्मोनेला प्रत्येक अलग सौंपा serovar साथ तालिका 2 में संक्षेप हैं.

चित्रा 1
चित्रा 1. विशिष्ट हे और एच एस के साथ जुड़े alleles की पहचान के लिए मल्टीप्लेक्स पीसीआर enterica Serovars Enteritidis, Hadar, हीडलबर्ग, और typhimurium (ए) हे ऐल्लि मल्टीप्लेक्स पीसीआर. H1 (बी, सी) Flagellin alleles की पहचान के लिए ऐल्लि मल्टीप्लेक्स पीसीआर: मैं / जी, मीटर (बी) और r/z10 (सी). 13 1and लेन: बीपी 100 (Promega, मैडिसन, WI), सीढ़ी लेन 2: हे alleles के लिए मल्टीप्लेक्स पीसीआर नियंत्रण बी, C1, C2, D1, और ई (ए) के लिए H1 alleles / मैं जी, मीटर (बी), और H1 r/z10 alleles (सी), और गलियों 3-12: साल्मोनेला 1-10 (तालिका 2) आइसोलेट्स.

पीसीआर मास्टर मिक्स Thermocycler (Rapidcycler)
अभिकर्मकों / संरचना एकाग्रता मात्रा   पैरामीटर्स उम्मीद आकार
H1 / i जी, मीटर
DH 2 हे 63 μl Program 1 94 ° 1 मिनट के लिए सी
10X पीसीआर बफर 20 मिमी 2 MgCl 10 μl Program 2 94 ° 1 एस सी
500 mMTris PH8 55 ° 1 एस सी
2.5 मिलीग्राम / मिलीलीटर BSA 72 ° 20 के लिए एस सी
5% 400 Ficoll 40 चक्रों के लिए
10 mMTartrazine ढाल = 2.0
प्राइमर मैं (च) * AACGAAATCAACAACAACCTGC 2 μl 3 कार्यक्रम 72 ° C 4 मिनट के लिए 510 बीपी
प्राइमर मैं (नि.) * TAGCCATCTTTACCAGTTCCC 2 μl
प्राइमर जी, मीटर (च) * GCAGCAGCACCGGATAAAG 2 μl 310 बीपी
प्राइमर जी, मीटर (नि.) * CATTAACATCCGTCGCGCTAG 2 μl
DMSO 5 μl
dNTP 10 मिमी 2 μl
Taq 5 इकाइयों / μl 2 μl
90 μl
H1 r / 10 z
DH 2 हे 55 μl Program 1 94 ° 1 मिनट के लिए सी
10X पीसीआर बफर 30 मिमी 2 MgCl 10 μl Program 2 94 ° 1 एस सी
500 mMTris PH8 55 ° 1 एस सी
2.5 मिलीग्राम / मिलीलीटर BSA 72 ° 20 के लिए एस सी
5% 400 Ficoll 40 चक्रों के लिए
10 mMTartrazine ढाल = 2.0
प्राइमर (च) आर * CCTGCTATTACTGGTGATC 4μl 3 कार्यक्रम 72 ° C 4 मिनट के लिए 170 बीपी
प्राइमर (नि.) आर * GTTGAAGGGAAGCCAGCAG 4μl
Z (च) * 10 प्राइमर GCACTGGCGTTACTCAATCTC 4μl 360 बीपी
प्राइमर 10 z (नि.) * GCATCAGCAATACCACTCGC 4μl
DMSO 5 μl
dNTP 10 मिमी 2 μl
Taq 5 इकाइयों / μl 2 μl
90 μl
पीसीआर मास्टर मिक्स Thermocycler (Rapidcycler)
अभिकर्मकों / संरचना एकाग्रता मात्रा   पैरामीटर्स उम्मीद आकार
H2 1,2 / ई, n, x
DH 2 हे 63.6 μl Program 1 94 ° 1 मिनट के लिए सी
10X पीसीआर बफर 20 मिमी 2 MgCl 10 μl Program 2 94 ° 1 एस सी
500 mMTris PH8 55 ° 1 एस सी
2.5 मिलीग्राम / मिलीलीटर BSA 72 ° 20 के लिए एस सी
5% 400 Ficoll 40 चक्रों के लिए
10 mMTartrazine ढाल = 2.0
1,2 प्राइमर (च) * AGAAAGCGTATGATGTGAAA 2 μl 3 कार्यक्रम 72 ° C 4 मिनट के लिए 290 बीपी
1,2 प्राइमर (नि.) * ATTGTGGTTTTAGTTGCGCC 2 μl
प्राइमर ई, पता, एक्स (च) * TAACTGGCGATACATTGACTG 2 μl 150 बीपी
प्राइमर ई, पता, एक्स (नि.) 1 TAGCACCGAATGATACAGCC 2 μl
DMSO 5 μl
dNTP 10 मिमी 2 μl
Taq 5 इकाइयों / μl 2 μl
90 μl
जेनेरिक H2
DH 2 हे 72 μl Program 1 94 ° 1 मिनट के लिए सी
10X पीसीआर बफर 30 मिमी 2 MgCl 10 μl Program 2 94 ° C 10 के लिए
500 mMTris PH8 45 ° C 10 के लिए
2.5 मिलीग्राम / मिलीलीटर BSA 72 ° 35 के लिए एस सी
5% 400 Ficoll 40 चक्रों के लिए
10 mMTartrazine ढाल = 2.0
प्राइमर fljB (च) * CAAGTAATCAACACTAACAGTC 2 μl 3 कार्यक्रम 72 ° C 4 मिनट के लिए 1500 बीपी
प्राइमर fljB (नि.) * TTAACGTAACAGAGACAGCAC 2 μl
dNTP 10 मिमी 2 μl
Taq 5 इकाइयों / μl 2 μl
90 μl

तालिका 1. साल्मोनेला flagellinallelotyping पीसीआर के लिए प्रोटोकॉल: संरचना, स्थितियों, और उम्मीद परिणाम.

* काम पीसीआर oligonucleotide प्राइमरों के शेयर एकाग्रता 25 सुक्ष्ममापी है

पृथक हे ऐल्लि H1 ऐल्लि H2 ऐल्लि Serovar
  बी C1 C2 D1 मैं जी, मीटर r z10 1,2, 1,5, 1,6, 1,7 ई, n, x, ई, n, z15 एक जेनेरिक  
1 - - - + - - + - - - - - Enteritidis
2 - - + - - - - - + - + + Hadar / इस्तांबुल 3
3 - - + - - + - - - - - + केंटकी
4 - - - - + - - - - + - + अज्ञात
5 - + - - - - + - - - - - मोंटेवीडियो
6 - + - - - - - + - + - + Infantis या Virchow 2
7 - + - - - - - - + - + + मबंडाका
8 + - - - - + - - - + - + Typhimurium
9 + - - - - - - + - + - + हीडलबर्ग
10 + - - - - - - - + + - + हाइफ़ा

तालिका 2. Allelotyping पीसीआर परिणाम (1 छवि) और साल्मोनेला Serovar पदनाम हे, H1 और H2 alleles की पहचान के आधार पर

> 1 H2 पीसीआर सभी H2 flagellin रखने साल्मोनेला के लिए एक 1.5 केबी amplicon उत्पादन, H2 एलील (1) की परवाह किए बिना . यह पीसीआर biphasic साल्मोनेला से monophasic भेद करने के लिए प्रयोग किया जाता है.
1,5,, 1,6, 1,7 प्रतिजन जटिल (3) 2 H2 मल्टीप्लेक्स पीसीआर H2 1,2 के लिए अलग alleles के बीच भेद नहीं कर सकते हैं .
एस के 3 फेज रूपांतरण enterica serovar Hadar बदल LPS हे serovar इस्तांबुल उत्पादन प्रतिजन. हे allelotyping पीसीआर इन सूक्ष्म आनुवंशिक / प्रतिजनी परिवर्तन नहीं विचार कर सकते हैं.

1 Serovar हे ऐल्लि H1 ऐल्लि H2 ऐल्लि
  बी C1 C2 D1 मैं जी, मीटर r z10 1,2, 1,5, 1,6, 1,7 ई, n, x, ई, n, z15 2 जेनेरिक
कैलिफोर्निया + - - - - - + - - - - -
Typhimurium + - - - - + - - - + - +
हीडलबर्ग + - - - - - - + - + - +
हाइफ़ा + - - - - - - - + + - +
मोंटेवीडियो - + - - - - + - - + - +
Othmarschen - + - - - - + - - - - -
Athinai - + - - - + - - - - + +
Papuana - + - - - - - + - - + +
मबंडाका - + - - - - - - + - + +
Chincol - - + - - - + - - - + +
केंटकी - - + - - + - - - - - +
Hadar / इस्तांबुल 3 - - + - - - - - + - + +
Enteritidis - - - + - - + - - - - -
Seremban - - - + - + - - - + - +
Campinense - - - + - - - + - - + +
Lome - - - + - - - + - - - +
पोर्टलैंड - - - + - - - - + + - +
Ruanda - - - + - - - - + - + +
TREGUIER - - - + - - - - + - - +
सिमी - - - - + - - + - - + +
Weltevreden - - - - + - - + - - - +
Kristianstad - - - - + - - - + - + +
Biafra - - - - + - - - + - - +

टेबल 3. साल्मोनेला enterica Allelotyping पीसीआर द्वारा पहचाने Serovars

1 serovars बोल्ड में प्रकाश डाला और अधिक सामान्यतः निदान या खाद्य सूक्ष्मजीव विज्ञान प्रयोगशाला द्वारा सामना करना पड़ा वाले हैं.
2 H2 पीसीआर सभी H2 flagellin रखने साल्मोनेला के लिए एक 1.5 केबी amplicon उत्पादन, H2 एलील (1) की परवाह किए बिना . यह पीसीआर biphasic साल्मोनेला से monophasic भेद करने के लिए प्रयोग किया जाता है.
एस के 3 फेज रूपांतरण enterica serovar Hadar बदल LPS हे serovar इस्तांबुल उत्पादन प्रतिजन. हे allelotyping पीसीआर इन सूक्ष्म आनुवंशिक / प्रतिजनी परिवर्तन नहीं विचार कर सकते हैं.

Discussion

अधिकांश व्यावसायिक रूप से उपलब्ध साल्मोनेला लक्ष्य जीनस (उदा. invA) अद्वितीय जीन का पता लगाने के के लिए पीसीआर परीक्षण . हालांकि, नहीं सभी साल्मोनेला उनके लिए मनुष्य या जानवर आबादी में प्रसार में रोग पैदा करने की क्षमता में बराबर हैं. साल्मोनेला हे प्रतिजन LPS और flagellinH1 और H2 प्रतिजनों में प्रतिजनी मतभेदों के प्रारंभिक पहचान 2,500 से अधिक इन प्रतिजनी मतभेदों पर आधारित serovars में साल्मोनेला के भेदभाव करने के लिए नेतृत्व किया है. वहाँ 46 अलग हे प्रतिजनों और 86 अलग flagellin एंटीजन (एच) जीनस साल्मोनेला में पहचान कर रहे हैं साल्मोनेला (H1) या दो अलग अलग flagellins (H1 और H2) के अधिकारी हो सकता है. आज हे, H1 और H2 2500 साल्मोनेला serovars के लिए प्रतिजनों खाते के विभिन्न संयोजन को मान्यता दी . एक serovar प्रतिजनी व्यक्तिगत हे और एच प्रतिजनों की पहचान से व्युत्पन्न फार्मूला पर आधारित सौंपा है. हे प्रतिजनी सूत्र के रूप में लिखा है:: H1 H2, और कहाँ "" हे प्रतिजन के लिए नकारात्मक साल्मोनेला के लिए H1 H2 या flagellin और "NT" (गैर typeable) के अभाव के लिए संदर्भित करता है. उदाहरण के लिए, serovar typhimurium एक एस के लिए सौंपा है मैं: enterica प्रतिजनी सूत्र बी के साथ अलग 1,2 जबकि Enteritidis एक सूत्र D1 के साथ अलग करने के लिए दिया जाता है: जी, मीटर : -. साल्मोनेला आबादी में इस प्रतिजनी परिवर्तन nucleotide स्तर है कि इसलिए आसानी से पीसीआर द्वारा शोषण किया जा सकता है पर मतभेद की जावक अभिव्यक्ति है.

हम आनुवंशिक विशिष्ट हे और एच alleles के साथ जुड़े की पहचान एस के लिए एक allelotyping पीसीआर विकसित मतभेद की पहचान की है enterica serovars: Enteritidis, Hadar, हीडलबर्ग और typhimurium (3). Hadar (C2: z10 के: ई, एन, एक्स), Heidelberg (बी - H1: H2 Enteritidis प्रतिजनी सूत्र (D1:: जी, मीटर) सही और साल्मोनेला serovar का काम रिपोर्टिंग सब ओ के साथ जुड़े alleles के लिए परीक्षण की आवश्यकता r: 1,2), और typhimurium (बी: मैं: 1,2). हे एलील या प्रतिजन H1 जी की खोज के ज्ञान के बिना, मी एलील अकेले जरूरी अन्य साल्मोनेला serovars रूप Enteritidis के रूप में साल्मोनेला अलग पहचान नहीं करता है: Agona, कैलिफोर्निया, और मोंटेवीडियो, भी इसी एलील अधिकारी. जबकि allelotyping पीसीआर मूल का पता लगाने के लिए पहले साल्मोनेला serovars उल्लेख किया है डिजाइन किया गया था, इस परीक्षण के एक अतिरिक्त 19 serovars (3 टेबल) की पहचान कर सकते हैं. हमारे allelotyping पीसीआर मूल हे और एच alleles का पता लगाने के लिए डिजाइन किया गया था. अभ्यास में, यह और अधिक व्यावहारिक और लागत प्रभावी बन गया है हमारे लिए हे स्लाइड समूहन परीक्षण द्वारा प्रतिजन की पहचान करने के लिए, antisera हे विशिष्ट का उपयोग, के बजाय प्रदर्शन हे allelotyping पीसीआर जब पृथक साल्मोनेला संस्कृतियों के साथ काम कर रहे है. हालांकि, हम हे allelotyping पीसीआर का उपयोग कर की सिफारिश करते हैं अगर आपके प्रयोगशाला या साल्मोनेला मुक्त व्यापार समझौते कार्ड (6) पर प्रस्तुत आइसोलेट्स टाइपिंग के लिए एक स्क्रीन (2) के रूप में इस पीसीआर का उपयोग करता है, और शामिल एक साल्मोनेला विशिष्ट नमूनों की पहली स्क्रीन के साथ पीसीआर ( 4 ). कि साल्मोनेला के रूप में पीसीआर या जैव रासायनिक / प्रतिजनी परीक्षण के द्वारा की पहचान कर रहे हैं केवल उन नमूनों allelotyping PCRs सीमा.

इस आलेख में वर्णित प्रोटोकॉल Idaho प्रौद्योगिकी Rapidcycler, एक गर्म हवा thermocycler है कि एक नीचे पैमाने पर करने के लिए कई हीटिंग ब्लॉक thermocyclers से भी कम समय में प्रतिक्रिया मात्रा और रन स्थितियों की प्रतिक्रिया की अनुमति देता है के साथ प्रयोग के लिए ऑप्टिमाइज़ किया गया है. प्राइमर सांद्रता समायोजन;, या MgCl दो सांद्रता का समायोजन एक हीटिंग ब्लॉक thermocycler के साथ प्रयोग के लिए इस प्रोटोकॉल के अनुकूल स्थितियों की प्रतिक्रिया empirically कम / annealing तापमान बढ़ाने के द्वारा अनुकूलन की आवश्यकता हो सकती है. उदाहरण के लिए, हम एम.जे. PTC-200 thermocycler के रूप में इस प्रकार अनुसंधान के लिए प्रोटोकॉल अनुकूल पड़ा है. ही प्रतिक्रिया तालिका 1 में वर्णित संस्करणों के साथ कार्य करना, काम कर रहे स्टॉक concentrationof मैं प्राइमर सेट 2.5 सुक्ष्ममापी को पतला था, annealing तापमान 55 डिग्री सेल्सियस 45 ° कदम, सी और विकृतीकरण पर ऊष्मायन बार, annealing और विस्तार से उतारा गया मैं / जी, मीटर allelotyping पीसीआर के लिए 20 s से lengthened गया था. उपयुक्त सकारात्मक और नकारात्मक नियंत्रण होने प्रारंभिक शुरू और किसी भी पीसीआर के लिए अनुकूलन प्रकाशित प्रोटोकॉल सहित में आवश्यक हैं. हम ज्ञात साल्मोनेला serovars प्राप्त करने की सिफारिश, विशेष रूप से Anatum (E1: ई, ज: 1,6), (: जी, मीटर: D1 -) Enteritidis, Hadar (C2: z10 के: ई, n, x), Heidelberg (बी : r : 1,2), मोंटेवीडियो (C1: जी, मीटर, एस: 1,2,7) और typhimurium (बी: मैं: 1,2); आदि और एक प्रयोगशाला Escherichia कोलाई K12 (DH5α, LE393, तनाव JM109 ) क्रमशः allelotyping पीसीआर इस आलेख में वर्णित परीक्षण के लिए सकारात्मक और नकारात्मक नियंत्रण के रूप में. इन साल्मोनेला serovars के कई एलील जो परीक्षण किया है पर निर्भर करता है, या तो सकारात्मक या नकारात्मक नियंत्रण के रूप में सेवा करेंगे.

कुछ सावधानियों और दिशा निर्देशों के लिए पीछा किया जाना है जबकि इस और किसी भी अन्य नैदानिक ​​पीसीआर प्रदर्शन की जरूरत है. सबसे पहले, भौतिक जुदाईतैयारी के टेम्पलेट, पीसीआर सेट अप, और जेल वैद्युतकणसंचलन रोकने संभव पीसीआर संदूषण और झूठी सकारात्मक की गलत रिपोर्टिंग ध्वंसावशेष में महत्वपूर्ण है. इसके अलावा, उचित नियंत्रण के किसी भी दिनचर्या पीसीआर में शामिल होने आवश्यक है इन नियंत्रणों के रूप में समस्याओं की पहचान के रूप में वे उत्पन्न होती हैं और परिणाम की व्याख्या (5) करने में सहायता. सबसे महत्वपूर्ण बात, स्थिरता amplicon (पीसीआर उत्पाद) amplicon आकार का पता लगाने andestimation के लिए electrophoretic शर्तों के संबंध के साथ, विशेष रूप से आवश्यक है. इस बिंदु को वर्णन करने के लिए, हम जानबूझकर वैद्युतकणसंचलन पहले की तुलना में चित्रा 1A में करना निलंबित. आणविक भार मानकों (1 गलियों और 13) और सकारात्मक नियंत्रण (2 लेन) पर्याप्त के लिए सही आकार का अनुमान या डीएनए टुकड़े जहां वहाँ आकार में छोटे मतभेदों (~ 50 बीपी) की जुदाई का पालन करने के लिए अलग नहीं कर रहे हैं. डीएनए टुकड़े के पर्याप्त जुदाई, विशेष रूप से आणविक भार मानकों, सकारात्मक रिपोर्टिंग amplicon आकार और भेद से गैर विशिष्ट amplicons है कि कभी कभी किसी भी पीसीआर (5 के दैनिक चलाने में मनाया जाता है "सच सकारात्मक" का सटीक आकलन पर निर्भर करता है के रूप में आवश्यक है ). उदाहरण के लिए, वहाँ चित्रा 1B, 7 लेन (~ 700 बीपी आकार में) में एक गैर विशिष्ट amplicon है. अगर वैद्युतकणसंचलन बहुत जल्दी बंद कर दिया गया, जब डाई सामने agarose जेल में आधे रास्ते बिंदु पर ही था, वहाँ 500 बीपी और 700 बीपी डीएनए टुकड़े के बीच थोड़ा भेदभाव होगा. इसलिए, 7 गली में नमूना ग़लती से किया गया है दोनों मैं और जी, मीटर alleles के लिए के रूप में सकारात्मक रिपोर्ट.

अंत में, किसी भी परीक्षा के साथ जुड़े सीमाओं को पहचान करने की जरूरत है. 1,5,, 1,6, 1,7 प्रतिजन जटिल, ई, n, x / ई H1/H2 allelotyping पीसीआर के कई भेदभावपूर्ण alleles में सूक्ष्म आनुवंशिक मतभेद 1,2 H2 से संबंधित विचार की शक्ति नहीं है , पता, z15 प्रतिजन जटिल और H1 जी प्रतिजन जटिल है, जो जी, मीटर एलील शामिल है. एक या दो एमिनो एसिड परिवर्तन खाते के लिए अलग epitopes इन flagellar प्रतिजनों में मौजूद है. इसलिए यह हमारे लिए प्राइमरों कि flagellin जीन अनुक्रम (3) में ये कभी - कभी एकल आधार जोड़ी मतभेद का फायदा उठाने सकता है डिजाइन करने के लिए मुश्किल था. उदाहरण के लिए, साल्मोनेला serovars डबलिन (D1: जी, पी: -) और Berta (D1: टी - च, छ:) भी कर रहे हैं हमारे जी के साथ सकारात्मक पीसीआर, mallelotyping प्राइमरों . ब्रैडफोर्ड (r: B 1,5), Heidelberg (1,2 बी:: आर) (: मैं बी 1,5) लागोस से H2 allelotyping प्राइमरों typhimurium (: मैं बी 1,2) भेद नहीं कर सकते हैं, Winneba (r: B 1,6), या रेमो Glostrup (बी: r: 1,7) से (C2: z10 के: ई, n, z15), या (ई, n, x: z10 के C2) Hadar. जबकि इन serovars के कुछ का सामना करने की संभावना: लागोस, ब्रैडफोर्ड, Winneba, रेमो या Glustrup दूरस्थ है, यह एक संभावना है और या तो परीक्षण की सीमा या किसी अन्य पुष्टि परीक्षण पर अस्वीकरण प्रदान की आवश्यकता है.

अंत में, इस पीसीआर आधारित serotyping तेजी एस पहचानती है enterica serovars Enteritidis, Hadar हीडलबर्ग, और typhimurium, और हे, H1, H2 alleles 19 अतिरिक्त serovars के साथ जुड़े. इस परख एक तेजी से, लागत प्रभावी पारंपरिक serotyping साल्मोनेला के लिए सूक्ष्मजीवविज्ञानी दृष्टिकोण के लिए वैकल्पिक है .

Disclosures

ब्याज की कोई संघर्ष की घोषणा की.

Acknowledgments

यह काम USDA 1999-35212-8680 अनुदान, 2005-01378, और 2010-04288-01, USDA फार्मूला फंड और जॉर्जिया पशु चिकित्सा कृषि अनुसंधान अनुदान राज्य द्वारा समर्थित किया गया है. इस प्रकाशन में वर्णित प्रोटोकॉल स्नातक से नीचे के द्वारा निर्देशित अनुसंधान पाठ्यक्रम के हिस्से के रूप में उपयोग के लिए विकसित किया गया था: MIBO 4900L, जीन 4960H, 4960L BCMB, और जॉर्जिया विश्वविद्यालय में Biol 4960H और Maurer में कई आण्विक जानपदिक रोग विज्ञान अनुसंधान परियोजनाओं पर छात्रों द्वारा इस्तेमाल किया प्रयोगशाला. हम हमारे प्रयासों के अनुसंधान के साथ स्नातक अनुदेश एकीकृत का समर्थन करने के लिए कई स्नातक छात्रों जो Maurer ली और प्रयोगशालाओं में अनुसंधान का प्रदर्शन किया है, और हमारे विभाग की कुर्सी, जॉन Glisson धन्यवाद.

Materials

Name Company Catalog Number Comments
Luria Bertani Fisher Scientific (or any comparable source)
Microfuge tubes Fisher Scientific 1.5 ml capacity (or any comparable source)
Ethanol Fisher Scientific 200 proof (or any comparable source)
dH2O Sigma-Aldrich Molecular Biology Grade (or any comparable source; PCR only)
10 x PCR Buffer: Idaho Technologies 20 mM MgCl2 (buffer comes with BSA, Ficoll and Tartrazine)
30 mM MgCl2
40 mM MgCl2
PCR primers
DMSO
dNTP Roche Group (or any comparable source)
Taq DNA Polymerase Denville Scientific (or any comparable source)
Capillary pipettes Idaho Technologies 10 µl volume
Rapid Cycler Idaho Technologies
Agarose Bio-Rad Low EEO; Molecular Biology Grade (or any comparable source)
50 X TAE Buffer or 5X TBE Buffer Fisher Scientific (or any comparable source)
Ethidium bromide Bio-Rad (or any comparable source)
Horizontal, submersible gel electrophoresis chamber with gel mold Bio-Rad (or any comparable source)
Power supply Bio-Rad (or any comparable source)
Molecular Imager Gel Doc System Bio-Rad (or any comparable source)
Table 4. Materials

DOWNLOAD MATERIALS LIST

References

  1. Dauga, C., Zabrovskaia, A., Grimont, P. A. D. Restriction fragment length polymorphism analysis of some flagellin genes of Salmonella enterica. J. Clin. Microbiol. 36, 2835-2843 Forthcoming.
  2. Hong, Y., Liu, T., Lee, M. D., Hofacre, C. L., Maier, M., White, D. G., Ayers, S., Wang, L., Berghaus, R., Maurer, J. A rapid screen of broth enrichments for Salmonella enterica serovars Enteritidis, Hadar, Heidelberg, and Typhimurium using an allelotyping multiplex PCR that targets O and H antigen alleles. J. Food Prot. 72, 2198-2201 (2009).
  3. Hong, Y., Liu, T., Lee, H. ofacre, Maier, C. L., White, M., Ayers, D. G., Wang, S., Berghaus, L., R, M. aurer J.Rapid screening of Salmonella enterica serovars Enteritidis, Hadar, Heidelberg and Typhimurium using a serologically-correlative allelotyping PCR targeting the O and H antigen alleles. BMC Microbiol. (2008).
  4. Liu, T., Liljebjelke, K., Bartlett, E., Hofacre, C. L., Sanchez, S., Maurer, J. J. Application of nested PCR to detection of Salmonella in poultry environments. J. Food Prot. 65, 1227-1232 (2002).
  5. Maurer, J. J. Rapid detection and limitation of molecular techniques. Ann. Rev. Food Sci. Tech. 2, 259-279 (2011).
  6. Moscoso, H., Alvarado, I., Hofacre, C. L. Molecular analysis of infectious bursal disease virus from bursal tissues collected on FTA filter paper. Avian Dis. 50, 391-396 (2006).
  7. Sambrook, J., Fritsch, E. F., Maniatis, T. Molecular cloning: a laboratory. 2nd ed, Cold Spring Harbor Laboratory Press. Cold Spring Harbor, N.Y. (1989).
  8. Wittwer, C. T., Fillmore, G. C., Hillyard, D. R. Automated polymerase chain reaction capillary tubes with hot air. Nucleic Acids Res. 17, 4353-4357 (1989).
पहचान के लिए एक Allelotyping पीसीआर<em> साल्मोनेला enterica</em> Serovars Enteritidis, Hadar, हीडलबर्ग, और typhimurium
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Maurer, J. J., Lee, M. D., Cheng, Y., Pedroso, A. An Allelotyping PCR for Identifying Salmonella enterica serovars Enteritidis, Hadar, Heidelberg, and Typhimurium. J. Vis. Exp. (53), e3130, doi:10.3791/3130 (2011).More

Maurer, J. J., Lee, M. D., Cheng, Y., Pedroso, A. An Allelotyping PCR for Identifying Salmonella enterica serovars Enteritidis, Hadar, Heidelberg, and Typhimurium. J. Vis. Exp. (53), e3130, doi:10.3791/3130 (2011).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter