Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Immunology and Infection

Un Allelotyping PCR per l'identificazione Salmonella enterica Sierotipi Enteritidis, Hadar, Heidelberg, e Typhimurium

doi: 10.3791/3130 Published: July 22, 2011

Summary

Descriviamo un multiplex PCR per la rilevazione rapida di Salmonella enterica sierotipi Enteritidis, Hadar, Heidelberg, e Typhimurium. Sierotipi di Salmonella specifici possono essere identificati prendendo di mira un multiplex PCR di geni e sequenze uniche per l'O-antigene grappolo biosintesi e flagellina di un sierotipo dato. Sierotipo viene assegnato poi a isolare Salmonella in base alla comparsa di specifiche, ampliconi dimensioni (prodotto PCR) corrispondente al allele di destinazione.

Abstract

Gli attuali test commerciale PCR per l'identificazione dei geni bersaglio Salmonella unica di questo genere. Tuttavia, ci sono due specie, sei sottospecie, e oltre 2.500 diversi sierotipi di Salmonella, e non tutti sono uguali nel loro significato per la salute pubblica. Per esempio, trovare S. enterica sottospecie IIIa Arizona in una fattoria strato tavolo uovo è insignificante rispetto all'isolamento di S. sottospecie enterica sierotipo Enteritidis I, la principale causa di salmonellosi legato al consumo di uova da tavola. Sierotipi sono individuati sulla base di differenze antigeniche in lipopolisaccaride (LPS) (antigene O) e flagellina (H1 e H2 antigeni). Queste differenze antigeniche sono l'aspetto esteriore della diversità dei geni e alleli del gene associata a questo fenotipo.

Abbiamo sviluppato un allelotyping, PCR multiplex che le chiavi sulle differenze genetiche tra i quattro maggiori S. sottospecie enterica sierotipi che ho trovato nel pollame e associata a gravi malattie umane negli Stati Uniti. Le coppie di primer PCR sono stati mirati a geni chiave o sequenze uniche ad un sierotipo di Salmonella specifiche e destinate a produrre un amplicone con dimensioni specifiche per quel gene o allele. Salmonella sierotipo viene assegnato a un isolato basata sulla combinazione dei risultati dei test PCR per LPS specifico e flagellina alleli del gene. La PCR multiplex descritto in questo articolo sono specifici per la rilevazione di S. enterica sottospecie I sierotipi Enteritidis, Hadar, Heidelberg, e Typhimurium.

Qui mostriamo come utilizzare il PCR multiplex per identificare un sierotipo di Salmonella isolare.

Protocol

1. Preparazione del modello di PCR

Nota: Al fine di minimizzare la contaminazione PCR riporto, è importante mantenere alcuni passi importanti chiave nella PCR fisicamente separati gli uni dagli altri: 1) modello (DNA) preparazione, 2) preparazione della PCR, e 3) elettroforesi su gel. Si raccomanda inoltre di utilizzare punte barriera al fine di prevenire la contaminazione della cultura o reagente di pipetters.

  1. Seminare 1 ml di brodo Luria Bertani o altro supporto di complessi (Heart Infusion Cervello, Superbroth, ecc) con Salmonella isolare da una singola colonia isolata. Incubare cultura overnight a 37 ° C.
  2. Trasferire 1 ml ad una sterile, provetta da microcentrifuga 1,5 ml, centrifugare la sospensione batterica delle cellule a 4.500 xg per ~ 2 min. alle cellule pellet.
  3. Decantare il surnatante, risospendere il pellet cellulare in 1 ml di etanolo al 100% e fissato a temperatura ambiente per 10 min. Cellule pellet come prima (4.500 xg, 2 min.), Rimuovere le cellule supernatante e risospendere in 1 ml di PBS.
  4. Centrifugare le cellule (4.500 xg, 2 min.), Scartare il surnatante e risospendere le cellule in 1 ml di soluzione sterile dH 2 O.
  5. Diluire la sospensione definitiva delle cellule 1 / 20 in dH 2 O (5 μl/95 microlitri dH 2 O) e conservare a -20 ° C. La validità del modello di cellule intere, come la PCR a -20 ° C è di circa un mese.

2. PCR Setup

Nota: La preparazione e la distribuzione della miscela di reazione PCR (modello, tamponi, oligonucletoideprimers, nucleotidi e polimerasi Taq DNA) deve essere eseguita in un locale separato dedicato fisicamente e preferibilmente fatto in una stazione di lavoro PCR / UV.

Nota: L'impostazione della PCR camera deve essere autosufficiente con una designato congelatore -20 ° C per la conservazione di reagenti PCR (tamponi, primer oligonucleotidi, e nucleotidi), enzimi e modello, pipetter dedicato impostare per l'impostazione della PCR, guanti in lattice usa e getta , camice da laboratorio, consigli barriera, micropiastre, capillari di vetro, tubi microcentrifuga, e il 10% di candeggina per decontaminare superfici. Utilizzare un set dedicato pipetter (P10, P100, P1000 e) di dispensare i reagenti PCR. Questo set pipetta non deve mai lasciare il set-up della workstation.

Nota: Ottenere biologia molecolare o PCR grado dH 2 O e aliquote da 1 ml in provette da 1,5 ml centrifuga. Dispensare aliquotate dH 2 O dopo ogni uso per evitare possibili contaminazioni crociate. Un approccio simile è consigliato con i reagenti altri PCR.

Nota: Decontaminare l'area di lavoro prima dell'uso con illuminazione UV e / o pulire le superfici con il 10% di candeggina. Indossare camice da laboratorio e guanti in lattice nello svolgimento preparazione della PCR. Minimizzare avanti e indietro il traffico proveniente da PCR set-up per le aree in cui vengono incubate le reazioni PCR in thermocylcer e prodotti di PCR (ampliconi) sono separati su gel di agarosio. Se si va indietro nel set-up zona PCR, smaltire il paio di guanti in lattice che si sta indossando e messo su un nuovo paio di guanti.

  1. Fai uno stock fondo master in dH 2 o ad una concentrazione di 5x10 -4 M. Diluire il primer 1 / 20 in dH 2 O (5 μl/95 microlitri dH 2 °, 25 mM). La sequenza di oligonucleotidi per ciascun primer digitando flagellina è descritto nella tabella 1.
  2. Recuperare reagenti PCR e il modello da -20 ° C freezer, e permettere reagenti ei campioni a scongelare sul ghiaccio. Lasciare la DNA polimerasi Taq in freezer fino al momento dell'uso.
  3. Dispensare reagenti per mix allelotyping reazione PCR come descritto nella Tabella 1.
  4. Erogare 9μl della miscela di reazione PCR in ciascuno dei 10 pozzetti circolari in una sterile, a 96 pozzetti, piastra di microtitolazione in polistirene, a partire dalla parte superiore della colonna (es. A1) e spostando la colonna in alto di quella successiva.
  5. Aggiungere 1 ml di dH 2 O al microlitri 9 di PCR mix (nessun controllo del DNA) per il primo pozzo (A1), 0.5μl dei modelli di controllo positivo (i / g, m digitando primer-Enteritidis e Typhimurium; r/z10 digitando primer-Heidelberg e Hadar, e 1,2 / e, n, x digitando primer-e Typhimurium Hadar) a 9 ml di mix di PCR nel 2 ° e (B1) e 1 ml di Escherichia coli K12 DH5α al 9 ml di mix di PCR nel terzo pozzo (C1).
  6. Per ogni ulteriore bene (D1-H1; A2, B2), aggiungere 1 ml del modello campione scongelato al microlitri 9 della miscela di reazione PCR. Per i / g, m allelotyping PCR, S. enterica sierotipo Typhimurium (i) e Enteritidis (g, m) servono come controlli positivi, e sierotipi di Salmonella Heidelberg (r) e Hadar (z10) sono i controlli positivi per il r / z 10 allelotyping multiplex PCR.
  7. Place 10 microlitri capacità capillari in vetro titolari designati per la Tecnologia Idaho Rapidcycler (8).
  8. una volta fissato nel supporto, caricare ogni capillare di vetro con la miscela di reazione PCR toccando il capillare alpozzi fondo della micropiastra. Inclinare il supporto per consentire al liquido di spostare verso il basso il tubo e prevedere uno spazio tra le estremità e il mix di PCR prima termosaldatrici i tubi di vetro con una torcia butano per sigillare entrambe le estremità dei capillari.
  9. Posizionare i tubi capillari e supporto nel Tecnologia Idaho Rapidcycler e utilizzare programmi termociclatore descritte nella Tabella 1 per il primer allelotyping diversi per eseguire la PCR.
  10. Passare al punto gel elettroforesi quando il programma termociclatore è stato completato.

3. Gel elettroforesi

Nota: Indossare un camice diverso laboratorio designato per l'uso in laboratorio elettroforesi e un nuovo paio di guanti in lattice usa e getta.

Nota: Indossare occhiali di protezione UV o schermo protettivo e sempre sono stati i guanti quando si maneggiano bromuro di etidio, in particolare gel di agarosio.

  1. Preparare 100 ml fuso 1,5% (w / v) di biologia molecolare in grado di agarosio 1xTAE (o 1X TBE) buffer di elettroforesi (7) da riscaldamento ripetutamente la sospensione di agarosio nel forno a microonde fissato al 20% di potenza per 2-5 minuti con intervalli periodici visive ispezione. Impostare il fuso agarosio in 60 bagno ° C acqua fino a che equilibra la temperatura del bagno d'acqua.
  2. Impostare lo stampo gel con pettine prima di versare il fuso agarosio. Scegli un pettine a denti gel sufficiente a produrre abbastanza pozzi per i controlli, campioni, e almeno 3 standard di peso molecolare per i loro piazzamenti alle estremità e al centro del gel di agarosio.
  3. Aggiungere 2 ml di bromuro di etidio (10 mg / ml) a 100 ml di fuso 1,5% (w / v) agarosio in 1xTAE (o TBE), delicatamente bottiglia agitare, evitare di produrre bolle, e delicatamente versare il contenuto della bottiglia al centro dello stampo gel per 15 per 10 cm gel. Usare il bordo della carta velina o un fazzoletto di carta per rimuovere eventuali bolle nel gel di agarosio.
  4. Lasciatevi plasmare gel fissato a temperatura ambiente fino agarosio solidifica (~ 30-45 min). Trasferire il vassoio gel con gel e pettine per sommergibili, camera di elettroforesi orizzontale contenente 1X TAE (o 1X TBE) buffer di elettroforesi. Rimuovere delicatamente il pettine dal gel di agarosio.
  5. Verificare il posizionamento del vassoio gel rispetto al catodo o polo positivo della camera di elettroforesi per essere sicuri che questo polo si trova in fondo del gel. Nota: Ricordate il DNA, carico negativamente migra verso il catodo (cioè, "correre al rosso").
  6. Premix 200 ml di marcatori di peso molecolare del DNA (0,25 mg / mL) con 40 ml di Loading Dye 6X DNA. Carico di 4,8 microlitri della premiscelati peso molecolare del DNA Marker XIV al primo, pozzi e l'ultimo mezzo.
  7. Carico ciascuno dei campioni PCR a partire da ben 2 e avanzando in ogni pozzetto successivo, passando da sinistra a destra. Evitare di caricare il campione in uno dei pozzetti contenenti lo standard peso molecolare.
  8. Per caricare i campioni contenuti in ogni capillare di vetro:
    1. Rimuovere ogni capillare dal suo supporto e etch entrambe le estremità del capillare con un cutter di vetro.
    2. Posizionare il pollice e l'indice di entrambe le mani su entrambi i lati del capillare segnato dalla lama di vetro e far scattare il capillare.
    3. Posizionare il distributore capillare sul lato opposto fine della miscela di reazione PCR e ruotare lentamente il pistone in senso orario fino a quando il liquido si trovi sul fondo della provetta.
    4. Mettere il capillare nel pozzo da caricare e ruotare lentamente il pistone in senso orario per erogare il Ficoll-ponderata campione nel agarosio bene. Fare attenzione a non forare il bene con il capillare o introdurre una bolla d'aria nel pozzo girando troppo passato, quando l'ultimo dei liquidi lascia il capillare.
  9. Una volta che tutti i campioni e gli standard sono stati caricati, impostare la tensione costante del sistema di alimentazione a 90 V (9 volts / cm gel).
  10. Interrompere l'elettroforesi una volta che il colorante giallo (Taurazine) frontale è di 1 cm dal fondo del gel.
  11. Una volta completata l'elettroforesi, trasferire il gel per un transilluminatore UV per visualizzare frammenti di DNA e standard di peso molecolare. Blocchi l'immagine su pellicola Polaroid utilizzando una macchina fotografica Polaroid con arancia vetro filtro (impostazioni: 2 x, y e 4,5) o come immagine digitale utilizzando una telecamera CCD e l'immagine stampata con una stampante termica.
  12. Posizionare i titolari capillare nel 10% di candeggina per 15-30 min. Lavare 3 volte con dH 2 O e il luogo di nuovo in camera preparazione della PCR asciugare all'aria.

4. Rappresentante PCR multiplex Risultati

Risultati per allelotyping PCR di isolati di Salmonella 1-10 sono mostrati in figura 1 (corsie 3-12) e interpretato nel modo seguente. Una designazione allele O è dato a isolare Salmonella in base amplicone (prodotto PCR) corrispondenti per dimensioni a controllo PCR e come previsto per il primer allele O set utilizzati (3): B-560bp, C1-340bp, C2-400 bp, D1-620 bp, e E1-280 bp. Per isolati testati con il allelotyping O PCR (Fig. 1A), abbiamo assegnato O alleli B (corsia 10 -13), C1 (corsie 7-9), C2 (corsie 4, 5), D1 (corsia 3), ed E1 (corsia 6) per la Salmonella dieci isolati testati in corsie 3-12. Questi isolati di Salmonella stessi sono stati testati, nello stesso ordine di fig. 1A, per alleli H1 i; g, m, r, e z10 (Fig. 1B, C). Ancora una volta, un allele H1 è assegnato a ciascun isolare dipende dalla presenza di un amplicone di corrispondenza di dimensioni al controllo PCR e come previsto per il primer allele 4 H1 set utilizzati (3): i-510 bp (Fig. 1B, corsia 2 ), g, m-310 bp (Fig. 1B, corsia 2), r-170 bp (Fig. 1C, corsia 2) e z10-360 bp (Fig. 1C, corsia 2). Alleli H1 sono stati assegnati ad uno dei dieci isolati di Salmonella: i - isola 3 e 8 (Fig. 1B, corsie 5 e 10), g, m-isola 1 e 5 (Fig. 1B, corsie 3 e 7), r per isola 6 e 9 (Fig. 1C, corsie 8 e 11);. z10 e agli isolati 2, 7, e 10 (Fig. 1C, corsie 4, 9, e 12) Salmonella isolare 4 è stata negativa per i quattro alleli H1 testati. Infine, isolati di Salmonella sono stati testati con PCR per H2 alleli associati al 1,2, 1,5, 1,6, 1,7 e complessi antigene e, n, x, e, n, Z15 complesso antigene. Il primer set per l'H2 1,2, 1,5, 1,6, 1,7 complesso e H2 e, n, x, e, n, Z15 complesso producono 290 bp e 150 bp amplificati, rispettivamente (3). I set di fondo non può distinguere specifici alleli H2 all'interno dell'uno o antigene H2 complesso di assegnare un tipo di allele definitiva, ex. 1,2, a un isolato (3) isolati di Salmonella 4, 6, 8-10 sono risultati positivi per gli alleli associati a H2 H2 1,2;. 1,5, 1,6, 1,7 complesso antigene, mentre isola 2 e 7 sono risultati positivi per gli alleli associati a H2 e, n, x, e, n, Z15 complessi antigene (dati non riportati). Mentre isolati di Salmonella 1, 3 e 5 sono risultati negativi per i due complessi antigene H2, isola solo 1 e 5 sono risultati negativi per H2 flagellina, come determinato mediante un generico H2 flagellina PCR (1) (dati non dimostrano). Questi risultati sono riassunti nella Tabella 2, nonché il sierotipo di Salmonella presuntivo assegnato a ogni isolato.

Figura 1
Figura 1. Multiplex PCR per identificare specifici O e H alleli associati con S. enterica sierotipi Enteritidis, Hadar, Heidelberg, e Typhimurium. (A) O alleliche Multiplex PCR. (B, C) H1 alleliche Multiplex PCR per identificare gli alleli flagellina: i / g, m (B) e r/z10 (C). Corsie 1 e 13: 100 scala bp (Promega, Madison, WI), corsia 2: controlli multiplex PCR per alleli O B, C1, C2, D1 e E (A), H1 alleli i / g, m (B), e alleli H1 r/z10 (C) e corsie 3-12: isolati di Salmonella 1-10 (Tabella 2).

PCR Master Mix Termociclatore (Rapidcycler)
Reagenti Composizione / concentrazione Quantità   Parametri Dimensione attesi
H1 i / g, m
dH 2 O 63 microlitri Programma 1 94 ° C per 1 min
10X PCR buffer di 20 mM MgCl 2 10 microlitri Programma 2 94 ° C per 1 s
500 mMTris pH8 55 ° C per 1 s
2,5 mg / ml di BSA 72 ° C per 20 s
5% Ficoll 400 Per 40 cicli
10 mMTartrazine Pendenza = 2,0
Primer i (t) * AACGAAATCAACAACAACCTGC 2 microlitri Programma 3 72 ° C per 4 min 510 bp
Primer i (r) * TAGCCATCTTTACCAGTTCCC 2 microlitri
Primer G, M (f) * GCAGCAGCACCGGATAAAG 2 microlitri 310 bp
Primer G, M (r) * CATTAACATCCGTCGCGCTAG 2 microlitri
DMSO 5 microlitri
dNTP 10 mM 2 microlitri
Taq 5 unità / mL 2 microlitri
90 microlitri
H1 r / z 10
dH 2 O 55 microlitri Programma 1 94 ° C per 1 min
10X PCR buffer di 30 mM MgCl 2 10 microlitri Programma 2 94 ° C per 1 s
500 mMTris pH8 55 ° C per 1 s
2,5 mg / ml di BSA 72 ° C per 20 s
5% Ficoll 400 Per 40 cicli
10 mMTartrazine Pendenza = 2,0
Primer r (f) * CCTGCTATTACTGGTGATC 4μl Programma 3 72 ° C per 4 min 170 bp
Primer r (r) * GTTGAAGGGAAGCCAGCAG 4μl
Primer z 10 (f) * GCACTGGCGTTACTCAATCTC 4μl 360 bp
Primer z 10 (r) * GCATCAGCAATACCACTCGC 4μl
DMSO 5 microlitri
dNTP 10 mM 2 microlitri
Taq 5 unità / mL 2 microlitri
90 microlitri
PCR Master Mix Termociclatore (Rapidcycler)
Reagenti Composizione / concentrazione Quantità   Parametri Dimensione attesi
H2 1,2 / e, n, x
dH 2 O 63,6 microlitri Programma 1 94 ° C per 1 min
10X PCR buffer di 20 mM MgCl 2 10 microlitri Programma 2 94 ° C per 1 s
500 mMTris pH8 55 ° C per 1 s
2,5 mg / ml di BSA 72 ° C per 20 s
5% Ficoll 400 Per 40 cicli
10 mMTartrazine Pendenza = 2,0
Primer 1,2 (f) * AGAAAGCGTATGATGTGAAA 2 microlitri Programma 3 72 ° C per 4 min 290 bp
Primer 1,2 (r) * ATTGTGGTTTTAGTTGCGCC 2 microlitri
Primer e, n, x (f) * TAACTGGCGATACATTGACTG 2 microlitri 150 bp
Primer e, n, x (r) 1 TAGCACCGAATGATACAGCC 2 microlitri
DMSO 5 microlitri
dNTP 10 mM 2 microlitri
Taq 5 unità / mL 2 microlitri
90 microlitri
Generico H2
dH 2 O 72 microlitri Programma 1 94 ° C per 1 min
10X PCR buffer di 30 mM MgCl 2 10 microlitri Programma 2 94 ° C per 10 s
500 mMTris pH8 45 ° C per 10 s
2,5 mg / ml di BSA 72 ° C per 35 s
5% Ficoll 400 Per 40 cicli
10 mMTartrazine Pendenza = 2,0
Primer fljB (f) * CAAGTAATCAACACTAACAGTC 2 microlitri Programma 3 72 ° C per 4 min 1.500 bp
Primer fljB (r) * TTAACGTAACAGAGACAGCAC 2 microlitri
dNTP 10 mM 2 microlitri
Taq 5 unità / mL 2 microlitri
90 microlitri

Tabella 1. Protocollo per Salmonella flagellinallelotyping PCR: composizione, condizioni, e risultati attesi.

* La concentrazione di borsa che lavorano di primer oligonucleotidi PCR è di 25 mM

Isolare O alleliche H1 alleliche H2 alleliche Sierotipo
  B C1 C2 D1 E Io g, m r z10 1,2, 1,5, 1,6, 1,7 e, n, x, e, n, Z15 Generico 1  
1 - - - + - - + - - - - - Enteritidis
2 - - + - - - - - + - + + Hadar / Istanbul 3
3 - - + - - + - - - - - + Kentucky
4 - - - - + - - - - + - + Sconosciuto
5 - + - - - - + - - - - - Montevideo
6 - + - - - - - + - + - + Infantis o Virchow 2
7 - + - - - - - - + - + + Mbandaka
8 + - - - - + - - - + - + Typhimurium
9 + - - - - - - + - + - + Heidelberg
10 + - - - - - - - + + - + Haifa

Tabella 2. Allelotyping Risultati PCR (Fig. 1) e Salmonella serovar Designazione Sulla base di Identificazione di O, H1, H2 e alleli

> 1 H2 PCR produce un amplicone 1,5 kb per tutti Salmonella in possesso di H2 flagellina, indipendentemente allele H2 (1). Questo PCR è utilizzato per distinguere monofasici dalla Salmonella bifasica.
2 H2 PCR multiplex non può distinguere tra i diversi alleli per l'H2 1,2, 1,5, 1,6, 1,7 complesso antigene (3).
3 Phage conversione di S. enterica serovar Hadar altera LPS O antigene per produrre sierotipo Istanbul. L'O allelotyping PCR non può discernere queste sottili variazioni genetiche / antigenica.

Sierotipo 1 O alleliche H1 alleliche H2 alleliche
  B C1 C2 D1 E Io g, m r z10 1,2, 1,5, 1,6, 1,7 e, n, x, e, n, Z15 Generico 2
California + - - - - - + - - - - -
Typhimurium + - - - - + - - - + - +
Heidelberg + - - - - - - + - + - +
Haifa + - - - - - - - + + - +
Montevideo - + - - - - + - - + - +
Othmarschen - + - - - - + - - - - -
Athinai - + - - - + - - - - + +
Papuana - + - - - - - + - - + +
Mbandaka - + - - - - - - + - + +
Chincol - - + - - - + - - - + +
Kentucky - - + - - + - - - - - +
Hadar / Istanbul 3 - - + - - - - - + - + +
Enteritidis - - - + - - + - - - - -
Seremban - - - + - + - - - + - +
Campinense - - - + - - - + - - + +
Lome - - - + - - - + - - - +
Portland - - - + - - - - + + - +
Ruanda - - - + - - - - + - + +
Treguier - - - + - - - - + - - +
Simi - - - - + - - + - - + +
Weltevreden - - - - + - - + - - - +
Kristianstad - - - - + - - - + - + +
Biafra - - - - + - - - + - - +

Tabella 3. Salmonella enterica sierotipi identificati dal Allelotyping PCR

1 Il sierotipi evidenziati in grassetto sono quelli più comunemente incontrati dai diagnostici o di laboratorio microbiologia alimentare.
2 H2 PCR produce un amplicone 1,5 kb per tutti Salmonella in possesso di H2 flagellina, indipendentemente allele H2 (1). Questo PCR è utilizzato per distinguere monofasici dalla Salmonella bifasica.
3 Phage conversione di S. enterica serovar Hadar altera LPS O antigene per produrre sierotipo Istanbul. L'O allelotyping PCR non può discernere queste sottili variazioni genetiche / antigenica.

Discussion

La maggior parte dei test disponibili in commercio PCR per l'individuazione dei geni Salmonella obiettivi unici al genere (es. invasioni). Tuttavia, non tutti Salmonella sono uguali nella loro capacità di causare malattie nell'uomo o prevalenza nelle popolazioni animali. Il riconoscimento precoce delle differenze antigeniche in Salmonella LPS O-antigene e flagellinH1 e gli antigeni H2 ha portato alla differenziazione di Salmonella in oltre 2.500 sierotipi sulla base di queste differenze antigeniche. Ci sono 46 diversi antigeni O e 86 distinte flagellina (H) antigeni identificati nel genere Salmonella. Salmonella può possedere uno (H1) o due diversi (H1 e H2) flagellins. La diversa combinazione di O, H1 e H2 conto antigeni per i sierotipi di Salmonella 2.500 riconosciuto oggi. Un sierotipo viene assegnato sulla base della formula antigenica derivato dalla identificazione dei singoli antigeni O e H. La formula antigenica è scritto come O: H1: H2, e dove "-", si riferisce all'assenza di H1 o H2 flagellina e "NT" (non tipizzabile) per la salmonella negativo per l'O-antigene. Ad esempio, il sierotipo Typhimurium è assegnato ad una S. enterica isolare con la formula antigenica B: i: 1,2 mentre Enteritidis è dato a un isolato con la formula D1: g, m: -. Questa variazione antigenica nella popolazione Salmonella è la manifestazione esteriore delle differenze a livello di nucleotidi che possono quindi essere facilmente sfruttato da PCR.

Abbiamo identificato le differenze genetiche associate con specifici alleli O e H di sviluppare un allelotyping PCR per l'individuazione S. enterica sierotipi: Enteritidis, Hadar, Heidelberg, e Typhimurium (3). La corretta assegnazione e la segnalazione di Salmonella serovar richiede test per tutti gli alleli associati a O: H1: formule antigeniche H2 per Enteritidis (D1: g, m: -), Hadar (C2: Z10: e, n, x), Heidelberg (B : r: 1,2), e Typhimurium (B: i: 1,2). Senza la conoscenza della allele O o antigene, il ritrovamento del g H1, allele m da solo non necessariamente identificare il isolare Salmonella Enteritidis come come gli altri sierotipi di Salmonella: Agona, California, e Montevideo, anche in possesso di questo stesso allele. Mentre la PCR allelotyping è stato originariamente progettato per rilevare il succitato sierotipi di Salmonella, questo test può identificare un ulteriore periodo di 19 sierotipi (Tabella 3). Il nostro allelotyping PCR è stato originariamente progettato per rilevare gli alleli O e H. In pratica, è diventato più pratico e conveniente per di identificare l'O-antigene mediante test di agglutinazione su vetrino, con O-specifici antisieri, anziché eseguire l'O allelotyping PCR quando si lavora con le culture Salmonella isolati. Tuttavia, si sconsiglia l'uso del O allelotyping PCR se il laboratorio utilizza questo PCR come uno schermo (2) o per la tipizzazione isolati di Salmonella presentato in sede di FTA carte (6), e comprendono una Salmonella specifico PCR con la prima schermata dei campioni (4 ). Limitare la PCR allelotyping solo a quei campioni che sono identificati come Salmonella mediante PCR o test biochimici / antigenica.

Il protocollo descritto in questo articolo è stato ottimizzato per l'utilizzo con la tecnologia Idaho Rapidcycler, ad aria calda termociclatore che permette di far ridurre la quantità di reazione e le condizioni di reazione viene eseguito in meno tempo di quanto molti termociclatori blocco riscaldante. Per adattare questo protocollo per l'utilizzo con un termociclatore blocco riscaldante può richiedere l'ottimizzazione delle condizioni di reazione empiricamente abbassando / alzando la temperatura di ricottura; regolare le concentrazioni di fondo, oppure regolando MgCl2 concentrazioni. Per esempio, abbiamo dovuto adattare il protocollo per la Ricerca MJ termociclatore PTC-200 come segue. Lavorare con i volumi stessa reazione descritta nella tabella 1, lo stock di lavoro concentrationof è stato diluito il set fondo ho a 2,5 micron, la temperatura di annealing è stata abbassata da 55 ° C a 45 ° C, e tempi di incubazione alla denaturazione, appaiamento ed estensione passi è stato allungato a 20 s per i / g, m allelotyping PCR. Avendo gli opportuni controlli positivi e negativi sono essenziali nella start up iniziale e di ottimizzazione per qualsiasi PCR, inclusi i protocolli pubblicati. Si consiglia di acquisire i sierotipi di Salmonella noto, in particolare Anatum (E1: e, h: 1,6), Enteritidis (D1: g, m: -), Hadar (C2: Z10: e, n, x), Heidelberg (B: r : 1,2), Montevideo (C1: g, m, s: 1,2,7) e Typhimurium (B: i: 1,2), e un laboratorio di Escherichia coli K12 ceppo (DH5α, LE393, JM109, ecc ) come controlli positivi e negativi rispettivamente per il test PCR allelotyping descritto in questo articolo. Molti di questi sierotipi di Salmonella serviranno come controlli positivo o negativo, a seconda di quale allele è testato.

Alcune precauzioni e le linee guida devono essere seguite durante l'esecuzione di questo e qualsiasi altra diagnostico PCR. In primo luogo, la separazione fisicadi preparazione modello, PCR set-up, e l'elettroforesi su gel è fondamentale nel prevenire possibili PCR riporto contaminazione e segnalazione erronea di falsi positivi. Inoltre, l'inclusione di controlli adeguati è necessario in ogni routine PCR come questi controlli identificare i problemi che si presentano e facilitare l'interpretazione dei risultati (5). Più importante, la coerenza è fondamentale, soprattutto per quanto riguarda le condizioni elettroforetica per amplicone (PCR prodotto) andestimation rilevamento di dimensioni amplicone. Per illustrare questo punto, abbiamo volutamente sospeso elettroforesi prima di quanto previsto nella Figura 1A. Gli standard di peso molecolare (corsie 1 e 13) e il controllo positivo (corsia 2) non sono sufficientemente separati da stimare con precisione le dimensioni o osservare la separazione di frammenti di DNA dove ci sono piccole differenze (~ 50 pb) in dimensioni. Un'adeguata separazione di frammenti di DNA, in particolare gli standard di peso molecolare, è essenziale come report positivi dipende stima accurata della dimensione amplicone e distintivi "vero positivo" da non specifici ampliconi che vengono a volte osservata nella gestione quotidiana di una PCR (5 ). Ad esempio, vi è un non-specifico amplicone in Figura 1B, corsia 7 (~ 700 bp nel formato). Aveva elettroforesi stato interrotto troppo presto, quando il fronte del colorante è stato solo nel punto a metà strada nel gel di agarosio, ci sarebbero differenze sono minime tra i 500 bp e 700 bp frammenti di DNA. Pertanto, campione in corsia 7 sarebbe stato erroneamente riportato come positivo sia per i e g, m alleli.

Infine, bisogna riconoscere i limiti associati a qualsiasi prova. Molti dei allelotyping H1/H2 PCR non hanno il potere discriminatorio di discernere sottili differenze genetiche in alleli appartenenti al H2 1,2; 1,5, 1,6, 1,7 complesso antigene, e, n, x / e , n, Z15 complesso antigene e l'antigene H1 G complesso, che comprende l', allele g m. Uno o due cambiamenti di aminoacidi rappresentano gli epitopi diversi presenti in questi antigeni flagellari. Era quindi difficile per noi a progettare primers in grado di sfruttare queste differenze a volte singolo paia di basi della sequenza del gene flagellina (3). Per esempio, sierotipi di Salmonella Dublin (D1: g, p: -) e Berta (D1: f, g, t: -) sono positivi alla PCR con la nostra g, mallelotyping primer. I primer allelotyping H2 non può distinguere Typhimurium (B: i: 1,2) da Lagos (B: i: 1,5), Heidelberg (B: r: 1,2) da Bradford (B: r: 1,5), Winneba (B: r: 1,6), o Remo (B: r: 1,7), o Hadar (C2: Z10: e, n, x) da Glostrup (C2: Z10: e, n, Z15). Mentre la probabilità di incontrare alcuni di questi sierotipi: Lagos, Bradford, Winneba, Remo o Glustrup è remoto, è una possibilità e richiede uno provvedendo disclaimer sulla limitazione dei test 'o in un altro test di conferma.

In conclusione, questo PCR-based sierotipizzazione identifica rapidamente S. enterica sierotipi Enteritidis, Hadar, Heidelberg e Typhimurium, e O, H1, H2 e gli alleli associati con 19 sierotipi aggiuntivi. Questo test è un rapido e conveniente alternativa al tradizionale approccio microbiologico sierotipizzazione di Salmonella.

Disclosures

Nessun conflitto di interessi dichiarati.

Acknowledgments

Questo lavoro è stato supportato da sovvenzioni USDA 1999-35212-8680, 2005-01378, e 2010-04288-01, USDA Fondi Formula e dello Stato della Georgia di Medicina Veterinaria di Grant ricerca agricola. Il protocollo descritto in questa pubblicazione è stata sviluppata per l'uso da studenti universitari come parte di corsi di ricerca diretto: MIBO 4900L, GENE 4960H, BCMB 4960L e 4960H BIOL presso l'Università della Georgia e utilizzate dagli studenti su progetti diversi epidemiologia molecolare di ricerca nel Maurer laboratorio. Desideriamo ringraziare i numerosi studenti universitari che hanno svolto attività di ricerca in Maurer e laboratori Lee, e il nostro reparto di sedia, John Glisson per supportare i nostri sforzi per integrare l'istruzione universitaria con la ricerca.

Materials

Name Company Catalog Number Comments
Luria Bertani Fisher Scientific (or any comparable source)
Microfuge tubes Fisher Scientific 1.5 ml capacity (or any comparable source)
Ethanol Fisher Scientific 200 proof (or any comparable source)
dH2O Sigma-Aldrich Molecular Biology Grade (or any comparable source; PCR only)
10 x PCR Buffer: Idaho Technologies 20 mM MgCl2 (buffer comes with BSA, Ficoll and Tartrazine)
30 mM MgCl2
40 mM MgCl2
PCR primers
DMSO
dNTP Roche Group (or any comparable source)
Taq DNA Polymerase Denville Scientific (or any comparable source)
Capillary pipettes Idaho Technologies 10 µl volume
Rapid Cycler Idaho Technologies
Agarose Bio-Rad Low EEO; Molecular Biology Grade (or any comparable source)
50 X TAE Buffer or 5X TBE Buffer Fisher Scientific (or any comparable source)
Ethidium bromide Bio-Rad (or any comparable source)
Horizontal, submersible gel electrophoresis chamber with gel mold Bio-Rad (or any comparable source)
Power supply Bio-Rad (or any comparable source)
Molecular Imager Gel Doc System Bio-Rad (or any comparable source)
Table 4. Materials

DOWNLOAD MATERIALS LIST

References

  1. Dauga, C., Zabrovskaia, A., Grimont, P. A. D. Restriction fragment length polymorphism analysis of some flagellin genes of Salmonella enterica. J. Clin. Microbiol. 36, 2835-2843 Forthcoming.
  2. Hong, Y., Liu, T., Lee, M. D., Hofacre, C. L., Maier, M., White, D. G., Ayers, S., Wang, L., Berghaus, R., Maurer, J. A rapid screen of broth enrichments for Salmonella enterica serovars Enteritidis, Hadar, Heidelberg, and Typhimurium using an allelotyping multiplex PCR that targets O and H antigen alleles. J. Food Prot. 72, 2198-2201 (2009).
  3. Hong, Y., Liu, T., Lee, H. ofacre, Maier, C. L., White, M., Ayers, D. G., Wang, S., Berghaus, L., R, M. aurer J.Rapid screening of Salmonella enterica serovars Enteritidis, Hadar, Heidelberg and Typhimurium using a serologically-correlative allelotyping PCR targeting the O and H antigen alleles. BMC Microbiol. (2008).
  4. Liu, T., Liljebjelke, K., Bartlett, E., Hofacre, C. L., Sanchez, S., Maurer, J. J. Application of nested PCR to detection of Salmonella in poultry environments. J. Food Prot. 65, 1227-1232 (2002).
  5. Maurer, J. J. Rapid detection and limitation of molecular techniques. Ann. Rev. Food Sci. Tech. 2, 259-279 (2011).
  6. Moscoso, H., Alvarado, I., Hofacre, C. L. Molecular analysis of infectious bursal disease virus from bursal tissues collected on FTA filter paper. Avian Dis. 50, 391-396 (2006).
  7. Sambrook, J., Fritsch, E. F., Maniatis, T. Molecular cloning: a laboratory. 2nd ed, Cold Spring Harbor Laboratory Press. Cold Spring Harbor, N.Y. (1989).
  8. Wittwer, C. T., Fillmore, G. C., Hillyard, D. R. Automated polymerase chain reaction capillary tubes with hot air. Nucleic Acids Res. 17, 4353-4357 (1989).
Un Allelotyping PCR per l&#39;identificazione<em> Salmonella enterica</em> Sierotipi Enteritidis, Hadar, Heidelberg, e Typhimurium
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Maurer, J. J., Lee, M. D., Cheng, Y., Pedroso, A. An Allelotyping PCR for Identifying Salmonella enterica serovars Enteritidis, Hadar, Heidelberg, and Typhimurium. J. Vis. Exp. (53), e3130, doi:10.3791/3130 (2011).More

Maurer, J. J., Lee, M. D., Cheng, Y., Pedroso, A. An Allelotyping PCR for Identifying Salmonella enterica serovars Enteritidis, Hadar, Heidelberg, and Typhimurium. J. Vis. Exp. (53), e3130, doi:10.3791/3130 (2011).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter