Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Immunology and Infection

Uma PCR Allelotyping para Identificar Salmonella enterica Sorovares Enteritidis, Hadar, Heidelberg, e Typhimurium

doi: 10.3791/3130 Published: July 22, 2011

Summary

Nós descrevemos um multiplex PCR para a detecção rápida de Salmonella enterica sorotipos Enteritidis, Hadar, Heidelberg, e Typhimurium. Sorovares de Salmonella específicos podem ser identificados por alvo um multiplex PCR para os genes e as seqüências exclusivas para o cluster biossíntese O antígeno-flagelina e de um sorovar dado. Sorovar é atribuída então a uma Salmonella isolar baseado na aparência de amplicons específicos, o tamanho (produto de PCR) correspondente ao alelo alvo.

Abstract

Comercial atual testes PCR para identificação de genes-alvo Salmonella exclusivo para este gênero. No entanto, existem duas espécies, seis subespécies, e mais de 2.500 sorotipos de Salmonella diferentes, e nem todos são iguais em sua importância para a saúde pública. Por exemplo, encontrar S. enterica subespécie IIIa Arizona em uma fazenda camada tabela de ovos é insignificante comparado com o isolamento de S. enterica subespécie I serovar Enteritidis, a principal causa de salmonelose relacionados ao consumo de ovos de mesa. Sorovares são identificados com base nas diferenças antigênicas de lipopolissacarídeo (LPS) (antígeno O) e flagelina (H1 e H2 antígenos). Essas diferenças antigênicas são a aparência externa da diversidade de genes e alelos do gene associado a este fenótipo.

Nós desenvolvemos um allelotyping, multiplex PCR que as chaves sobre as diferenças genéticas entre os quatro grandes S. sorovares enterica subespécie I encontrados em aves domésticas e associados com doenças humanas significativas em os EUA. Os pares de primers de PCR foram direcionados para os principais genes ou seqüências únicas para um sorotipo Salmonella específicas e destinadas a produzir um amplicon com tamanho específico para o gene ou alelo. Salmonella sorovar é atribuída a um isolado com base na combinação dos resultados dos testes de PCR para LPS específicas e alelos do gene flagelina. Os PCRs multiplex descritos neste artigo são específicos para a detecção de S. enterica subespécie I sorovares Enteritidis, Hadar, Heidelberg, e Typhimurium.

Aqui demonstramos como usar o PCRs multiplex para identificar serovar Salmonella para uma isolar.

Protocol

1. Preparação de modelos PCR

Nota: A fim de minimizar PCR contaminações, é importante manter vários passos importantes na PCR fisicamente separados um do outro: 1) a preparação de modelo (DNA), 2) PCR setup, e 3) eletroforese em gel. Também é recomendado o uso de dicas de barreira para evitar que a cultura ou a contaminação do reagente pipetters.

  1. Inocular 1 ml de caldo de Luria Bertani ou meio complexo demais (Infusão de cérebro, coração Superbroth, etc) com Salmonella isolado de uma única colônia isolada. Incubar a cultura durante a noite a 37 ° C.
  2. Transferir 1 ml para um estéril de 1,5 ml, tubo de microcentrífuga, capacidade de centrifugação da suspensão de células bacterianas a 4.500 xg por ~ 2 min. para as células da pelota.
  3. Decantar o sobrenadante, ressuspender o pellet celular em 1 ml de etanol 100% e fixada em temperatura ambiente por 10 min. Células pelota como antes (4.500 xg, 2 min.), Remover as células sobrenadante e ressuspender em 1 ml de PBS.
  4. Células de centrifugação (4500 xg, 2 min.), Descartar o sobrenadante e ressuspender as células em 1 ml de estéril dH 2 O.
  5. Diluir a suspensão celular final 1 / 20 em dH 2 O (5 mL μl/95 dH 2 O) e armazenar a -20 ° C. O prazo de validade das células inteiro como modelo de PCR a -20 ° C é de cerca de um mês.

2. PCR Setup

Nota: A preparação e distribuição da mistura de reacção da PCR (modelo, buffers, oligonucletoideprimers, nucleotídeos e Taq DNA polimerase) precisa ser realizada em uma sala separada fisicamente dedicada e, de preferência feito em uma estação de trabalho PCR / UV.

Nota: A PCR configurar sala também deve ser auto-suficiente com um freezer -20 ° C designado para o armazenamento de reagentes PCR (buffers, primers, e nucleotídeos), enzimas e modelo, pipeta dedicada definido para PCR setup, luvas descartáveis ​​de látex , laboratório casaco, dicas de barreira, placas de microtitulação, capilares de vidro, tubos e lixívia a 10% para superfícies de descontaminação. Use um conjunto pipeta dedicado (P10, P100 e P1000) para dispensar reagentes PCR. Este conjunto de pipeta nunca deve deixar a estação de trabalho de configuração.

Nota: Obter biologia molecular ou PCR grau dH 2 O e alíquota de 1 ml em 1,5 ml tubos de centrífuga de capacidade. Dispense alíquotas dH 2 O após cada utilização para evitar possível contaminação cruzada. Uma abordagem semelhante é recomendado com o outros reagentes PCR.

Nota: Descontaminar a área de trabalho antes do uso com iluminação UV e / ou limpar as superfícies com água sanitária a 10%. Usar bata de laboratório e luvas de látex na realização de instalação PCR. Minimizar frente e para trás o tráfego de PCR set-up para áreas onde as reações de PCR são incubados na thermocylcer e produtos de PCR (amplicons) são separados em gel de agarose. Se você voltar para a área de PCR set-up, descarte o par de luvas de látex que você está usando e colocar um novo par de luvas.

  1. Faça um estoque primário mestre em dH 2 o a uma concentração de 5x10 -4 M. Diluir o primers 20/01 em dH 2 O (5 mL μl/95 dH 2 o, 25 mM). A seqüência de oligonucleotídeos para cada primer digitando flagelina é descrito na Tabela 1.
  2. Recuperar reagentes PCR e modelo de -20 ° C freezer, e permitir que os reagentes e amostras para descongelar em gelo. Deixe a Taq DNA polimerase em freezer até ser necessário.
  3. Dispensar reagentes para allelotyping mistura da PCR, conforme descrito na Tabela 1.
  4. Dispense 9μl da mistura da PCR em cada um dos 10 poços de fundo redondo em uma placa de microtitulação estéreis, de 96 poços, poliestireno, começando no topo da coluna (por exemplo, A1) e descendo a coluna para o topo da próxima.
  5. Adicionar 1 ml de dH 2 O à mL 9 de PCR mix (sem controle de DNA) para o primeiro poço (A1), 0.5μl dos modelos de controle positivo (i / g, m digitando primers-Typhimurium e Enteritidis; r/z10 digitando primers-Heidelberg e Hadar, e 1,2 / e, n, x digitando primers-Typhimurium e Hadar) a 9 mL da mistura da PCR em 2 º bem (B1), e 1 ml de Escherichia coli K12 DH5α ao 9 ml da mistura de PCR no terceiro poço (C1).
  6. Para cada poço adicional (D1-H1; A2, B2), adicionar 1 ml de amostra do modelo descongelado à mL 9 da mistura de reacção da PCR. Para o S. i / g, m allelotyping PCR, enterica serovar Typhimurium (i) e Enteritidis (g, m) servem como controles positivos e Salmonella sorovares Heidelberg (r) e Hadar (z10) são os controles positivos para a r / z 10 allelotyping multiplex PCR.
  7. Coloque 10 ml de capacidade em capilares de vidro titulares designados para a Tecnologia de Idaho Rapidcycler (8).
  8. uma vez garantido no suporte, a carga de cada capilar de vidro com a mistura da PCR, tocando o capilar aopoços de fundo da placa de microtitulação. Incline o titular deixe o líquido mover para baixo o tubo e fornecer o espaço entre as extremidades ea mistura PCR antes calor de vedação dos tubos de vidro com uma tocha butano para selar ambas as extremidades dos capilares.
  9. Coloque os tubos capilares e suporte na tecnologia Idaho Rapidcycler e usar programas termociclador descrito na Tabela 1 para os primers allelotyping diferentes para executar o PCR.
  10. Vá para a etapa de eletroforese em gel quando o programa estiver concluído termociclador.

3. Eletroforese em gel

Nota: Usar um jaleco diferentes designado para uso em laboratório de eletroforese e um novo par de luvas de látex descartáveis.

Nota: Usar óculos de proteção UV olho de proteção ou viseira e sempre foram luvas ao manusear brometo de etídio, gel especialmente agarose.

  1. Prepare 100 ml de fundição de 1,5% (w / v) de biologia molecular na grade agarose 1xTAE (ou 1X TBE) tampão de eletroforese (7) por várias vezes o aquecimento da suspensão agarose no microondas fixado em poder de 20% para 2-5 min com intervalos visuais periódicas inspeção. Definir a agarose fundida em banho-maria 60 ° C até que equilibra a temperatura do banho-maria.
  2. Configurar o molde gel com pente antes de derramar a agarose fundida. Escolha um pente com dentes de gel suficiente para produzir o suficiente para poços controles, amostras e, pelo menos, três padrões de peso molecular de suas colocações nas extremidades e no meio do gel de agarose.
  3. Adicione 2 mL de brometo de etídio (10 mg / ml) para 100 ml de fundição de 1,5% (w / v) de agarose em 1xTAE (ou TBE), gentilmente garrafa agite para misturar, evitar a produção de bolhas, e gentilmente despeje o conteúdo do frasco para o meio do molde gel por 15 por 10 cm de agarose gel. Use a borda do papel de tecido ou papel toalha para remover quaisquer bolhas no gel de agarose.
  4. Deixe o molde gel fixado em temperatura ambiente até agarose solidifica (~ 30-45 min). Transferir o tabuleiro de gel com gel e pente para submersíveis, câmara de eletroforese horizontal contendo 1X TAE (ou 1X TBE) tampão de eletroforese. Remova cuidadosamente o pente do gel de agarose.
  5. Verificar o posicionamento da bandeja de gel em relação ao catodo ou pólo positivo da câmara de eletroforese para ter certeza este pólo é na parte inferior do gel. Nota: Lembre-se do DNA carregados negativamente migra para o cátodo (ou seja, "correr para o vermelho").
  6. Premix 200 mL de marcadores de peso molecular do DNA (0,25 mcg / mL) com 40 mL de tintura 6X DNA Carregando. Load 4,8 mL do pré-misturado DNA Peso Molecular marcador XIV à primeira, poços e meio passado.
  7. Carga cada uma das amostras PCR começando com dois bem e avançando a cada poço subseqüente, se movendo da esquerda para a direita. Evitar o carregamento da amostra em qualquer um dos poços contendo o padrão de peso molecular.
  8. Para carregar amostras contidas em cada capilar de vidro:
    1. Retire cada capilar a partir de seu titular e etch ambas as extremidades do capilar com um cortador de vidro.
    2. Coloque o polegar eo indicador das duas mãos em cada lado do capilar marcado pelo cortador de vidro e encaixe do capilar.
    3. Coloque o dispenser capilar na extremidade oposta da mistura de reacção da PCR e vire lentamente o êmbolo no sentido horário até que o líquido está na parte inferior do tubo.
    4. Coloque o capilar dentro do poço a ser carregado e vire lentamente o êmbolo no sentido horário para dispensar a amostra Ficoll-ponderada para a agarose bem. Tenha cuidado para não perfurar o poço com o capilar ou introduzir uma bolha de ar no poço girando muito passado, quando o último do líquido sai do capilar.
  9. Uma vez que todas as amostras e os padrões são carregados, definir a tensão constante da fonte de alimentação de 90 V (9 volts / cm agarose gel).
  10. Descontinuar a eletroforese quando o corante amarelo frente (Taurazine) é de 1 cm da parte inferior do gel.
  11. Uma vez que a eletroforese é concluída, transferir o gel para um transiluminador UV para visualizar fragmentos de DNA e padrão de peso molecular. Captura de imagem em filme Polaroid usando uma câmera Polaroid com laranja filtro de vidro (configurações: 2 x, y e 4,5) ou como uma imagem digital com uma câmera CCD e impressão com uma impressora térmica.
  12. Coloque os detentores capilar em lixívia a 10% por 15-30 min. Lave 3 vezes com dH 2 O e coloque de volta na sala de PCR de instalação para ar seco.

4. Representante Resultados Multiplex PCR

Resultados para allelotyping PCR de Salmonella isolados de 10-10 são mostrados na Figura 1 (faixas 3-12) e interpretado como se segue. O alelo uma designação é dada para isolar Salmonella com base no amplicon (produto de PCR) correspondente em tamanho para o controle de PCR e, como previsto para o primer alelo O utilizados grupos (3): B-560bp, C1-340bp, C2-400 pb, D1-620 bp, e E1-280 bp. Para isolados testados com o allelotyping O PCR (Fig. 1A), atribuímos O alelos B (faixas de 10 -13), C1 (faixas 7-9), C2 (faixas 4, 5), D1 (faixa 3) e E1 (faixa 6) para a Salmonella dez isolados testados em pistas 12/03. Esses isolados foram testados Salmonella mesmo, na mesma ordem como Figo. 1A, para alelos H1 i; g, m; r; e z10 (Fig. 1B, C). Mais uma vez, um alelo H1 é atribuído a cada isolado dependente da presença de um amplicon de correspondência em tamanho para o controle de PCR e, como previsto para o primer alelo 4 H1 utilizados grupos (3): i-510 pb (Fig. 1B, pista 2 ); g, m-310 pb (Fig. 1B, pista 2); r-170 pb (Fig. 1C, pista 2) e z10-360 pb (Fig. 1C, pista 2). Alelos H1 foram atribuídos a um dos dez isolados Salmonella: i - os isolados 3 e 8 (Fig. 1B, pistas 5 e 10); g, m-os isolados 1 e 5 (Fig. 1B, faixas 3 e 7), para r isola 6 e 9 (Fig. 1C, faixas 8 e 11);. z10 e para os isolados 2, 7, e 10 (Fig. 1C, faixas 4, 9 e 12) isolar Salmonella 4 foi negativa para os quatro alelos H1 testados. Finalmente, os isolados de Salmonella foram testadas por PCR para alelos H2 associado com o 1,2, 1,5; 1,6; 1,7 complexo antígeno-e e, n, x; e, n, z15 complexo antígeno. O primer sets para o H2 1,2; 1,5; 1,6; 1,7 complexo e H2 e, n, x; e, n, z15 complexo produzir 290 bp e 150 bp amplicons, respectivamente (3). Os conjuntos de primer não é possível distinguir os alelos específicos dentro de H2 H2 antígeno complexo para atribuir um tipo de alelo definitiva, ex. 1,2, a um isolado (3) Salmonella isolados de 4, 6, 8-10 foram positivos para os alelos associados com H2 H2 1,2;. 1,5; 1,6; 1,7 complexo antígeno, enquanto que isolados 2 e 7 foram positivos para alelos H2 associados e, n, x; e, n, z15 complexo antígeno (dados não mostrados). Enquanto Salmonella isolados 1, 3 e 5 foram negativas para os dois complexos antígeno H2, apenas os isolados 1 e 5 foram negativas para flagelina H2, como determinado usando um genérico flagelina H2 PCR (1) (dados não mostram). Estes resultados são resumidos na Tabela 2, juntamente com o sorotipo Salmonella presuntivo atribuído a cada isolado.

Figura 1
Figura 1. Multiplex PCR para identificação O Alelos específicos e H Associado com S. enterica Sorovares Enteritidis, Hadar, Heidelberg, e Typhimurium. (A) O alelo Multiplex PCR. (B, C) Alelo H1 Multiplex PCR para identificação de Alelos flagelina: i / g, m (B) e r/z10 (C). Pistas 1 e 13: 100 bp ladder (Promega, Madison, WI); pista 2: controles multiplex PCR para alelos O B, C1, C2, D1 e E (A), H1 alelos i / g, m (B), e alelos H1 r/z10 (C); e pistas 12/03: Salmonella isolados de 1-10 (Tabela 2).

PCR Master Mix Termociclador (Rapidcycler)
Reagentes Composição / concentração Quantidade   Parâmetros Tamanho esperado
H1 i / g, m
dH 2 O 63 mL Programa 1 94 ° C por 1 min
Tampão PCR 10X 20 mM MgCl 2 10 ml Programa 2 94 ° C por 1 s
500 mMTris PH8 55 ° C por 1 s
2,5 mg / ml BSA 72 ° C por 20 s
5% Ficoll 400 Para 40 ciclos
10 mMTartrazine Slope = 2,0
Primer i (f) * AACGAAATCAACAACAACCTGC 2 l Programa 3 72 ° C por 4 min 510 bp
Primer i (r) * TAGCCATCTTTACCAGTTCCC 2 l
Primer g, m (f) * GCAGCAGCACCGGATAAAG 2 l 310 bp
Primer g, m (r) * CATTAACATCCGTCGCGCTAG 2 l
DMSO 5 mL
dNTP 10 mM 2 l
Taq 5 unidades / mL 2 l
90 mL
H1 r / z 10
dH 2 O 55 mL Programa 1 94 ° C por 1 min
Tampão PCR 10X 30 mM MgCl 2 10 ml Programa 2 94 ° C por 1 s
500 mMTris PH8 55 ° C por 1 s
2,5 mg / ml BSA 72 ° C por 20 s
5% Ficoll 400 Para 40 ciclos
10 mMTartrazine Slope = 2,0
Primer r (f) * CCTGCTATTACTGGTGATC 4μl Programa 3 72 ° C por 4 min 170 bp
Primer r (r) * GTTGAAGGGAAGCCAGCAG 4μl
Primer z 10 (f) * GCACTGGCGTTACTCAATCTC 4μl 360 bp
Primer z 10 (r) * GCATCAGCAATACCACTCGC 4μl
DMSO 5 mL
dNTP 10 mM 2 l
Taq 5 unidades / mL 2 l
90 mL
PCR Master Mix Termociclador (Rapidcycler)
Reagentes Composição / concentração Quantidade   Parâmetros Tamanho esperado
H2 1,2 / e, n, x
dH 2 O 63,6 mL Programa 1 94 ° C por 1 min
Tampão PCR 10X 20 mM MgCl 2 10 ml Programa 2 94 ° C por 1 s
500 mMTris PH8 55 ° C por 1 s
2,5 mg / ml BSA 72 ° C por 20 s
5% Ficoll 400 Para 40 ciclos
10 mMTartrazine Slope = 2,0
Primer 1,2 (f) * AGAAAGCGTATGATGTGAAA 2 l Programa 3 72 ° C por 4 min 290 bp
Primer 1,2 (r) * ATTGTGGTTTTAGTTGCGCC 2 l
Primer e, n, x (f) * TAACTGGCGATACATTGACTG 2 l 150 pb
Primer e, n, x (r) 1 TAGCACCGAATGATACAGCC 2 l
DMSO 5 mL
dNTP 10 mM 2 l
Taq 5 unidades / mL 2 l
90 mL
Genéricos H2
dH 2 O 72 mL Programa 1 94 ° C por 1 min
Tampão PCR 10X 30 mM MgCl 2 10 ml Programa 2 94 ° C por 10 s
500 mMTris PH8 45 ° C por 10 s
2,5 mg / ml BSA 72 ° C por 35 s
5% Ficoll 400 Para 40 ciclos
10 mMTartrazine Slope = 2,0
Primer fljB (f) * CAAGTAATCAACACTAACAGTC 2 l Programa 3 72 ° C por 4 min 1500 pb
Primer fljB (r) * TTAACGTAACAGAGACAGCAC 2 l
dNTP 10 mM 2 l
Taq 5 unidades / mL 2 l
90 mL

Tabela 1. Protocolo para Salmonella flagellinallelotyping PCR: composição, condições e resultados esperados.

* A concentração de ações de trabalho de primers PCR é de 25 mM

Isolar O alelo Alelo H1 Alelo H2 Sorovar
  B C1 C2 D1 E Eu g, m r z10 1,2; 1,5; 1,6; 1,7 e, n, x; e, n, z15 Genérico 1  
1 - - - + - - + - - - - - Enteritidis
2 - - + - - - - - + - + + Hadar / Istambul 3
3 - - + - - + - - - - - + Kentucky
4 - - - - + - - - - + - + Desconhecido
5 - + - - - - + - - - - - Montevidéu
6 - + - - - - - + - + - + Infantis ou Virchow 2
7 - + - - - - - - + - + + Mbandaka
8 + - - - - + - - - + - + Typhimurium
9 + - - - - - - + - + - + Heidelberg
10 + - - - - - - - + + - + Haifa

Tabela 2. Resultados Allelotyping PCR (Fig. 1) e Designação Salmonella Serovar Baseado em Identificação de O, H1, H2 e Alelos

> 1 H2 PCR produz um amplicon 1,5 kb para todos Salmonella possuindo flagelina H2, independentemente do alelo H2 (1). Este PCR é usado para distinguir monofásico da Salmonella bifásico.
2 multiplex PCR H2 não pode distinguir entre os diferentes alelos para o H2 1,2; 1,5; 1,6; 1,7 complexo antígeno (3).
3 Phage conversão de S. enterica sorovar Hadar altera LPS antígeno O de produzir serovar Istambul. O allelotyping a PCR não pode discernir estas sutis mudanças genéticas / antigênica.

Sorovar 1 O alelo Alelo H1 Alelo H2
  B C1 C2 D1 E Eu g, m r z10 1,2; 1,5; 1,6; 1,7 e, n, x; e, n, z15 Genérica 2
Califórnia + - - - - - + - - - - -
Typhimurium + - - - - + - - - + - +
Heidelberg + - - - - - - + - + - +
Haifa + - - - - - - - + + - +
Montevidéu - + - - - - + - - + - +
Othmarschen - + - - - - + - - - - -
Atenas - + - - - + - - - - + +
Papuana - + - - - - - + - - + +
Mbandaka - + - - - - - - + - + +
Chincol - - + - - - + - - - + +
Kentucky - - + - - + - - - - - +
Hadar / Istambul 3 - - + - - - - - + - + +
Enteritidis - - - + - - + - - - - -
Seremban - - - + - + - - - + - +
Campinense - - - + - - - + - - + +
Lome - - - + - - - + - - - +
Portland - - - + - - - - + + - +
Ruanda - - - + - - - - + - + +
Treguier - - - + - - - - + - - +
Simi - - - - + - - + - - + +
Weltevreden - - - - + - - + - - - +
Kristianstad - - - - + - - - + - + +
Biafra - - - - + - - - + - - +

Tabela 3. Salmonella enterica Sorovares identificados por PCR Allelotyping

1 Os sorovares destaque em negrito são as mais comumente encontradas por diagnóstico ou de laboratório da microbiologia alimentar.
2 H2 PCR produz um amplicon 1,5 kb para todos Salmonella possuindo flagelina H2, independentemente do alelo H2 (1). Este PCR é usado para distinguir monofásico da Salmonella bifásico.
3 Phage conversão de S. enterica sorovar Hadar altera LPS antígeno O de produzir serovar Istambul. O allelotyping a PCR não pode discernir estas sutis mudanças genéticas / antigênica.

Discussion

Comercialmente disponíveis os testes de PCR para a detecção de genes alvos Salmonella exclusivo para o gênero (ex. inva). No entanto, nem todos são iguais Salmonella em sua capacidade de causar doenças em seres humanos ou prevalência em populações animais. O reconhecimento precoce das diferenças antigênicas em Salmonella LPS O antígeno e flagellinH1 e antígenos H2 levou à diferenciação de Salmonella em mais de 2.500 sorotipos com base nessas diferenças antigênicas. Há 46 diferentes antígenos O e 86 distintas flagelina (H) antígenos identificados no gênero Salmonella. Salmonella pode possuir um (H1) ou dois diferentes (H1 e H2) flagellins. A combinação diferente de O, H1, H2 e conta antígenos para os sorovares Salmonella 2500 reconheceu hoje. A sorovar é atribuída com base na fórmula antigênica derivada da identificação do Ó individuais e antígenos H. A fórmula antigênica é escrito como O: H1: H2, e onde "-", refere-se à ausência de H1 ou H2 flagelina e "NT" (não-tipáveis) para Salmonella negativo para o antígeno O-. Por exemplo, o sorovar Typhimurium é atribuído a um S. enterica isolar com a fórmula antigênica B: i: 1,2, enquanto Enteritidis é dado a um isolado com o D1 fórmula: g, m: -. Essa variação antigênica na população Salmonella é a manifestação exterior de diferenças no nível de nucleotídeos que podem, portanto, ser facilmente explorada por PCR.

Nós identificamos as diferenças genéticas associadas com O alelos específicos e H para desenvolver um PCR para a identificação de S. allelotyping enterica sorotipos: Enteritidis, Hadar, Heidelberg, e Typhimurium (3). A atribuição correta e comunicação de Salmonella sorovar requer testes para todos os alelos associados com O: H1: fórmulas antigênicas H2 para Enteritidis (D1: g, m: -), Hadar (C2: z10: e, n, x), Heidelberg (B : r: 1,2), e Typhimurium (B: i: 1,2). Sem o conhecimento de O alelo ou antígeno, a conclusão do g H1, m alelo por si só não significa necessariamente identificar a Salmonella Enteritidis como isolar como outros sorovares de Salmonella: Agona, Califórnia, e Montevidéu, também possuem este mesmo alelo. Enquanto a PCR allelotyping foi originalmente concebido para detectar a tona mencionado sorovares de Salmonella, este teste pode identificar um adicional de 19 sorovares (Tabela 3). Nosso allelotyping PCR foi originalmente concebido para detectar alelos S e H. Na prática, tornou-se mais prático e de custo eficaz para identificar a O antígeno pelo teste de aglutinação, utilizando anti-soros específicos O-, ao invés de executar o allelotyping O PCR quando se trabalha com culturas de Salmonella isoladas. No entanto, nós recomendamos o uso do allelotyping O PCR se o seu laboratório utiliza esta PCR como uma tela (2) ou para a digitação Salmonella isolados submetidos em FTA cards (6), e incluem uma PCR Salmonella específicas com a primeira tela de amostras (4 ). Limitar os PCRs allelotyping apenas aquelas amostras que são identificados como Salmonella pela PCR ou testes bioquímicos / antigênica.

O protocolo descrito neste artigo foi otimizado para uso com a tecnologia Idaho Rapidcycler, um termociclador de ar quente que permite que um de reduzir volumes de reação e as condições de reação corre em menos tempo do que muitos termocicladores bloco de aquecimento. Para adaptar este protocolo para uso com um termociclador bloco de aquecimento pode exigir otimização das condições de reação empiricamente através da redução / elevando a temperatura do recozimento; ajustar as concentrações de primer; ou ajustar MgCl 2 concentrações. Por exemplo, tivemos de adaptar o protocolo para a Pesquisa MJ PTC-200 termociclador como se segue. Trabalhando com a mesma reação volumes descritos na Tabela 1, o estoque de trabalho concentrationof o conjunto de primers i foi diluído a 2,5 mM, a temperatura de recozimento foi reduzida de 55 ° C a 45 ° C, tempos e incubação na desnaturação, anelamento e extensão passos foi alongado para 20 s para o i / g, m allelotyping PCR. Tendo os controles apropriados positivos e negativos são essenciais para o arranque inicial para cima e otimização para qualquer PCR, incluindo protocolos publicados. Recomendamos a aquisição de sorovares de Salmonella conhecidos, especificamente Anatum (E1: e, h: 1,6), Enteritidis (D1: g, m: -), Hadar (C2: z10: e, n, x), Heidelberg (B: r : 1,2), Montevidéu (C1: g, m, s: 1,2,7) e Typhimurium (B: i: 1,2), e um laboratório de Escherichia coli K12 tensão (DH5α, LE393, JM109, etc ) como controles positivos e negativos, respectivamente, para os testes de PCR allelotyping descrito neste artigo. Vários desses sorovares Salmonella servirá como controle positivo ou negativo, dependendo de qual alelo é testada.

Certas precauções e diretrizes precisam ser seguidas durante a realização deste e de qualquer outro meio de diagnóstico PCR. Primeiro, a separação físicamodelo de preparação, PCR set-up, e eletroforese em gel é fundamental na prevenção da PCR possibilidade de reporte de contaminação e geração de relatórios errôneos de falso-positivos. Além disso, a inclusão de controles adequados é necessário em qualquer PCR de rotina como esses controles identificar problemas que possam surgir e ajudar na interpretação dos resultados (5). Mais importante ainda, a consistência é essencial, especialmente no que diz respeito às condições eletroforéticas para amplicon andestimation detecção (PCR produto) de tamanho amplicon. Para ilustrar este ponto, nós propositadamente suspenso eletroforese anteriormente que o previsto na Figura 1A. Os padrões de peso molecular (faixas 1 e 13) e controle positivo (pista 2) não são suficientemente separadas para estimar com precisão tamanhos ou observar a separação de fragmentos de DNA onde existem pequenas diferenças (~ 50 pb) em tamanhos. Separação adequada dos fragmentos de DNA, especialmente os padrões de peso molecular, é essencial como relatórios positivos é dependente da estimativa precisa do tamanho do amplicon e distinguindo "verdadeiro positivo" de não-específica amplicons que às vezes são observadas no cotidiano de qualquer PCR (5 ). Por exemplo, há um amplicon não-específicas na Figura 1B, pista 7 (~ 700 pb de tamanho). Eletroforese tinha sido interrompido cedo demais, quando a frente de corante foi somente no ponto a meio caminho do gel de agarose, haveria pouca diferenciação entre 500 pb e 700 pb fragmentos de DNA. Portanto, a amostra na pista 7 teria sido erroneamente reportados como positivos para ambos os alelos i e g, m.

Finalmente, é preciso reconhecer as limitações associadas a qualquer teste. Vários dos allelotyping H1/H2 PCR não tem o poder discriminatório para discernir sutis diferenças genéticas na alelos pertencentes à H2 1,2; 1,5; 1,6; 1,7 complexo antígeno; e, n, x / e , n, z15 complexo antígeno ea H1 complexo antígeno-G, que inclui a g, m alelo. Uma ou duas mudanças de aminoácidos para a conta de epítopos presentes em diferentes esses antígenos flagelar. Foi, portanto, difícil para nós, para projetar primers que poderiam explorar essas diferenças de base, por vezes único par na seqüência do gene da flagelina (3). Por exemplo, Salmonella sorovares Dublin (D1: g, p: -) e Berta (D1: f, g, t: -) são também PCR positivos com o nosso g, mallelotyping primers. Os primers H2 allelotyping não pode distinguir Typhimurium (B: i: 1,2) de Lagos (B: i: 1,5), Heidelberg (B: r: 1,2) de Bradford (B: r: 1,5), Winneba (B: r: 1,6), ou Remo (B: r: 1,7), ou Hadar (C2: z10: e, n, x) de Glostrup (C2: z10: e, n, z15). Enquanto a probabilidade de encontrar alguns desses sorovares: Lagos, Bradford, Winneba, Remo ou Glustrup é remota, é uma possibilidade e requer o fornecimento de aviso sobre a limitação dos testes ou outro teste confirmatório.

Em conclusão, este sorotipagem baseados em PCR identifica rapidamente S. enterica sorotipos Enteritidis, Hadar, Heidelberg e Typhimurium, e O, H1, H2 e alelos associados com 19 sorotipos adicionais. Este ensaio é uma resposta rápida, alternativa de baixo custo para abordagem microbiológica tradicional para Salmonella sorotipagem.

Disclosures

Não há conflitos de interesse declarados.

Acknowledgments

Este trabalho foi suportado pelo USDA Grants 1999-35212-8680, 2005-01378, e 2010-04288-01, Fundos USDA Formula eo Estado de Veterinária da Geórgia Grant Pesquisa Agrícola Medicina. O protocolo descrito no presente publicação foi elaborada para uso por alunos de graduação como parte de cursos de pesquisa dirigida: MIBO 4900L, GENE 4960H, BCMB 4960L e 4960H Biol da Universidade da Geórgia e utilizados pelos alunos em vários projetos de pesquisa em epidemiologia molecular na Maurer laboratório. Queremos agradecer os muitos estudantes de graduação que realizaram pesquisas em laboratórios Maurer e Lee, e nosso chefe de departamento, John Glisson para apoiar os nossos esforços para integrar ensino de graduação com a pesquisa.

Materials

Name Company Catalog Number Comments
Luria Bertani Fisher Scientific (or any comparable source)
Microfuge tubes Fisher Scientific 1.5 ml capacity (or any comparable source)
Ethanol Fisher Scientific 200 proof (or any comparable source)
dH2O Sigma-Aldrich Molecular Biology Grade (or any comparable source; PCR only)
10 x PCR Buffer: Idaho Technologies 20 mM MgCl2 (buffer comes with BSA, Ficoll and Tartrazine)
30 mM MgCl2
40 mM MgCl2
PCR primers
DMSO
dNTP Roche Group (or any comparable source)
Taq DNA Polymerase Denville Scientific (or any comparable source)
Capillary pipettes Idaho Technologies 10 µl volume
Rapid Cycler Idaho Technologies
Agarose Bio-Rad Low EEO; Molecular Biology Grade (or any comparable source)
50 X TAE Buffer or 5X TBE Buffer Fisher Scientific (or any comparable source)
Ethidium bromide Bio-Rad (or any comparable source)
Horizontal, submersible gel electrophoresis chamber with gel mold Bio-Rad (or any comparable source)
Power supply Bio-Rad (or any comparable source)
Molecular Imager Gel Doc System Bio-Rad (or any comparable source)
Table 4. Materials

DOWNLOAD MATERIALS LIST

References

  1. Dauga, C., Zabrovskaia, A., Grimont, P. A. D. Restriction fragment length polymorphism analysis of some flagellin genes of Salmonella enterica. J. Clin. Microbiol. 36, 2835-2843 Forthcoming.
  2. Hong, Y., Liu, T., Lee, M. D., Hofacre, C. L., Maier, M., White, D. G., Ayers, S., Wang, L., Berghaus, R., Maurer, J. A rapid screen of broth enrichments for Salmonella enterica serovars Enteritidis, Hadar, Heidelberg, and Typhimurium using an allelotyping multiplex PCR that targets O and H antigen alleles. J. Food Prot. 72, 2198-2201 (2009).
  3. Hong, Y., Liu, T., Lee, H. ofacre, Maier, C. L., White, M., Ayers, D. G., Wang, S., Berghaus, L., R, M. aurer J.Rapid screening of Salmonella enterica serovars Enteritidis, Hadar, Heidelberg and Typhimurium using a serologically-correlative allelotyping PCR targeting the O and H antigen alleles. BMC Microbiol. (2008).
  4. Liu, T., Liljebjelke, K., Bartlett, E., Hofacre, C. L., Sanchez, S., Maurer, J. J. Application of nested PCR to detection of Salmonella in poultry environments. J. Food Prot. 65, 1227-1232 (2002).
  5. Maurer, J. J. Rapid detection and limitation of molecular techniques. Ann. Rev. Food Sci. Tech. 2, 259-279 (2011).
  6. Moscoso, H., Alvarado, I., Hofacre, C. L. Molecular analysis of infectious bursal disease virus from bursal tissues collected on FTA filter paper. Avian Dis. 50, 391-396 (2006).
  7. Sambrook, J., Fritsch, E. F., Maniatis, T. Molecular cloning: a laboratory. 2nd ed, Cold Spring Harbor Laboratory Press. Cold Spring Harbor, N.Y. (1989).
  8. Wittwer, C. T., Fillmore, G. C., Hillyard, D. R. Automated polymerase chain reaction capillary tubes with hot air. Nucleic Acids Res. 17, 4353-4357 (1989).
Uma PCR Allelotyping para Identificar<em> Salmonella enterica</em> Sorovares Enteritidis, Hadar, Heidelberg, e Typhimurium
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Maurer, J. J., Lee, M. D., Cheng, Y., Pedroso, A. An Allelotyping PCR for Identifying Salmonella enterica serovars Enteritidis, Hadar, Heidelberg, and Typhimurium. J. Vis. Exp. (53), e3130, doi:10.3791/3130 (2011).More

Maurer, J. J., Lee, M. D., Cheng, Y., Pedroso, A. An Allelotyping PCR for Identifying Salmonella enterica serovars Enteritidis, Hadar, Heidelberg, and Typhimurium. J. Vis. Exp. (53), e3130, doi:10.3791/3130 (2011).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter