Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Immunology and Infection

Allelotyping ПЦР для выявления Salmonella enterica Сероваров Enteritidis, Хадар, Гейдельберг, и Typhimurium

doi: 10.3791/3130 Published: July 22, 2011

Summary

Мы описываем мультиплексной ПЦР для быстрого обнаружения сальмонеллы enterica сероваров Enteritidis, Хадар, Гейдельберг, и Typhimurium. Конкретные сероваров сальмонелл могут быть идентифицированы путем охвата мультиплексной ПЦР на гены и последовательности уникальны для О-антиген кластера биосинтеза и флагеллин данного серовар. Серовар присваивается затем Salmonella изолировать на основе появления конкретных, размер ампликонов (ПЦР продукта), соответствующей целевой аллеля.

Abstract

Текущий промышленные испытания ПЦР для выявления сальмонеллы генов-мишеней уникальных для этого рода. Тем не менее, Есть два вида, шесть подвидов и более 2500 различных сероваров сальмонелл, и не все равны по своему значению для общественного здоровья. Например, нахождение С. enterica подвидов IIIa Аризона на слое фермы яйца таблице незначительна по сравнению с изоляцией С. enterica подвидов я серовар Enteritidis, основной причиной сальмонеллеза, связанного с потреблением столового яйца. Сероваров опознаются по антигенные различия в липополисахарида (ЛПС) (О антиген) и флагеллин (H1 и H2 антигены). Эти антигенные различия внешнего вида разнообразия генов и аллелей генов, связанных с этим фенотипом.

Мы разработали allelotyping, мультиплексной ПЦР, что клавиши на генетические различия между четырьмя основными С. enterica подвидов я сероваров обнаружены в домашней птице и связаны со значительными заболевания человека в США. Пары праймеров ПЦР были ориентированы на ключевых генов или последовательностей уникальна для конкретного серовар сальмонеллы и предназначена для производства ампликона с размером конкретного для этого гена или аллеля. Сальмонеллы серовар присваивается изоляции основана на сочетании результатов ПЦР для конкретных LPS и аллелей гена флагеллин. Мультиплексный ПЦР, описанные в этой статье, являются специфичными для обнаружения С. enterica подвидов я сероваров Enteritidis, Хадар, Гейдельберг, и Typhimurium.

Здесь показано, как использовать мультиплекс ПЦР для выявления серовар для сальмонелл изолировать.

Protocol

1. Подготовка шаблона ПЦР

Примечание: Для того, чтобы свести к минимуму ПЦР переноса загрязнения, важно держать несколько важных ключевых шагов в ПЦР физически отделены друг от друга: 1) шаблон (ДНК) подготовка, 2) ПЦР-установки, и 3) гель-электрофореза. Кроме того, рекомендуется использовать барьерный советы для того, чтобы предотвратить культуры или реагента загрязнения pipetters.

  1. Привить 1 мл Лурия Бертани бульона или других сложных среды (сердечно-мозговой Infusion, Superbroth и т.д.), Salmonella выделить из одной изолированной колонии. Инкубируйте культуру ночи при 37 ° C.
  2. Передача 1 мл в стерильный, 1,5 мл трубки микроцентрифужную потенциал, центрифуги бактериальной суспензии клеток при 4500 мкг в течение ~ 2 мин. для осаждения клеток.
  3. Декантировать супернатант, ресуспендируют осадок клеток в 1 мл 100% этанола и установить при комнатной температуре в течение 10 мин. Гранул клетки как и раньше (4500 мкг, 2 мин.), Удалите супернатант и ресуспендируйте клеток в 1 мл PBS.
  4. Центрифуга клеток (4500 мкг, 2 мин.), Отказаться от супернатанта и ресуспендирования клеток в 1 мл стерильного дН 2 O.
  5. Развести окончательного суспензии клеток 1 / 20 в дН 2 O (5 μl/95 мкл дН 2 O) и хранят при температуре -20 ° C. Срок хранения целых клеток в качестве шаблона ПЦР при температуре -20 ° С составляет около одного месяца.

2. ПЦР-установки

Примечание: подготовка и выдача смеси ПЦР-реакции (шаблон, буферы, oligonucletoideprimers, нуклеотидов и Taq-ДНК-полимеразы) должен быть выполнен в физически отдельной комнате и, желательно, посвященный сделано в рабочей станции ПЦР / UV.

Примечание: ПЦР создана комната должна быть самодостаточным с назначенными от -20 ° C морозильника для хранения ПЦР реагентов (буферы, олигонуклеотидных праймеров и нуклеотидов), ферменты и шаблон, посвященный pipetter набор для ПЦР-установки, одноразовые латексные перчатки , лабораторный халат, защитные советы, микротитровальных пластин, стеклянные капилляры, микроцентрифужную трубы, и 10% хлорной извести для обеззараживания поверхностей. Используйте выделенный набор pipetter (P10, P100 и P1000) освободить ПЦР реагентов. Этот набор пипетки никогда не должны оставлять настройки рабочей станции.

Примечание: Получить молекулярной биологии или ПЦР класса дН 2 O и аликвоту 1 мл в 1,5 мл пробирок мощность центрифуг. Распределите аликвоты дН 2 O после каждого использования, чтобы избежать возможного перекрестного заражения. Аналогичный подход рекомендуется с другими реагентами ПЦР.

Примечание: обеззараживать рабочую зону перед использованием УФ-освещенности и / или протирки поверхностей с 10% отбеливателя. Одежда пальто лаборатории и латексные перчатки при проведении ПЦР-установки. Свернуть туда и обратно трафик с ПЦР настройки в районы, где ПЦР инкубировали в thermocylcer и ПЦР-продуктов (ампликонов) разделены на агарозном гелях. Если вы вернетесь в ПЦР набор площадь, распоряжаться пары латексных перчаток вы в настоящее время носит и надеть новую пару перчаток.

  1. Сделайте запас мастер грунт в дН 2 ° до концентрации 5х10 -4 М. Развести грунтовки 1 / 20 в дН 2 O (5 μl/95 мкл дН 2 °, 25 мкМ). Олигонуклеотидные последовательности для каждого праймера набрав флагеллин описана в таблице 1.
  2. Получить ПЦР реактивы и шаблоны от -20 ° C морозильник, и позволяют реагенты к оттепели на льду. Оставьте полимеразы Taq ДНК в морозильной камере, пока это необходимо.
  3. Внесите реагентов для ПЦР allelotyping реакционной смеси, как описано в таблице 1.
  4. Внесите 9μl смеси ПЦР в каждую из 10 круглых скважин дно в стерильной, 96-а, планшет полистирола, начиная с верхней части колонны (например, А1) и двигаться вниз колонку в начало следующего.
  5. Добавить 1 мкл дН 2 O в 9 мкл ПЦР-смеси (без ДНК контроля) до первой скважины (A1), 0.5μl положительного шаблонов управления (я / г, м набрав грунтовки-Typhimurium и Enteritidis; r/z10 набрав грунтовки-Хайдельберг и Адар, а также 1,2 / е, п, х набрав грунтовки-Typhimurium и Адар) до 9 мкл смеси ПЦР во 2-м и (B1), и 1 мкл кишечной палочки K12 DH5α к 9 мл смеси ПЦР в третьей скважины (C1).
  6. Для каждого дополнительного хорошо (D1-H1, A2, B2), добавить 1 мкл талой образец шаблона для 9 мкл смеси ПЦР. Для я / г, м allelotyping ПЦР, С. enterica серовар Typhimurium (я) и Enteritidis (д, м) служат в качестве положительного контроля, а также сальмонелл сероваров Гейдельберге (г) и Адар (z10) являются положительными управления для R / Z 10 allelotyping мультиплексной ПЦР.
  7. Место 10 мкл мощностью стеклянных капилляров в назначенными держателями для Айдахо технологии Rapidcycler (8).
  8. как только закреплены в держателе, загрузки каждого стеклянный капилляр с смешивать реакции ПЦР, прикоснувшись к капиллярнойдно лунки планшет. Наклоните держатель позволяет жидкости двигаться вниз по трубе и обеспечить расстояние между концами и смесь ПЦР перед заварены стеклянных трубок с бутан факел, чтобы запечатать обоих концах капилляров.
  9. Место капилляров и держатель в Айдахо технологии Rapidcycler и использовать амплификаторе программ, описанных в таблице 1 для различных праймеров allelotyping запустить ПЦР.
  10. Переходите к шагу гель-электрофореза, когда программа амплификаторе завершена.

3. Гель-электрофореза

Примечание: Использовать различные халате, предназначенных для использования в лаборатории и электрофореза новую пару одноразовых латексных перчаток.

Примечание: Носите защитные очки УФ глаз или маску и всегда были перчатки при работе с этидий бромид, особенно агарозном гелях.

  1. Подготовка 100 мл расплавленного 1,5% (м / о) молекулярной биологии классе в агарозном 1xTAE (или 1X TBE) электрофореза буфер (7), неоднократно отопления подвески агарозы в микроволновой печи установлен на уровне 20% мощности в течение 2-5 минутные интервалы с периодическим визуальным инспекции. Установить расплавленной агарозы в 60 ° С водяной бане, пока она уравновешивает до температуры водяной бане.
  2. Настройка гель формы с расческой перед заливкой расплавленного агарозы. Выберите гель расческой с достаточной зубы, чтобы производить достаточное количество скважин для контроля, образцы, и по крайней мере 3 молекулярные стандарты веса для их размещения на концах и середине агарозном геле.
  3. Добавить 2 мкл бромистого этидия (10 мг / мл) к 100 мл расплавленного 1,5% (м / о) в агарозном 1xTAE (или КЭ), мягко водоворот бутылка для смешивания, избегать производству пузырей, и осторожно вылейте содержимое бутылки в середине пресс-формы для геля 15 х 10 см агарозном геле. Используйте краю бумаги ткань или бумажное полотенце, чтобы удалить пузырьки в агарозном геле.
  4. Пусть гель формы набора при комнатной температуре до агарозном затвердевает (~ 30-45 мин). Передача гель поднос с гелем и гребень, погружные, горизонтальные камеры электрофореза содержащие 1X TAE (или 1X TBE) электрофорез буфера. Аккуратно удалите гребень из агарозном геле.
  5. Проверьте размещение гель лоток относительно катода или положительный полюс электрофореза камере, чтобы убедиться, этот полюс находится в нижней части геля. Примечание: Помните, отрицательно заряженные ДНК мигрирует к катоду (то есть, "бежать на красный").
  6. Премикс 200 мкл ДНК-маркеры молекулярного веса (0,25 мкг / мкл) с 40 мкл 6X Dye Загрузка ДНК. Нагрузка 4,8 мкл предварительно смешанные ДНК молекулярный вес маркера XIV к первой, второй и скважин.
  7. Нагрузка каждого из образцов, начиная с ПЦР также 2 и продвижении к каждому последующему хорошо, двигаясь слева направо. Избегайте загрузки образца в любой из скважин содержащих молекулярные стандартного веса.
  8. Для загрузки образцов, содержащихся в каждом стеклянный капилляр:
    1. Удалить каждого капилляра его из держателя и травления обоих концах капилляра с стеклорез.
    2. Место большим пальцем и указательным пальцами обеих рук по обе стороны от капиллярной отмечен стеклорез и оснастки капилляра.
    3. Место капиллярной диспенсер на краю, противоположном смесь реакции ПЦР и медленно поверните поршень по часовой стрелке, пока жидкость находится в самой нижней части трубы.
    4. Место капиллярных в колодец должен быть загружен и медленно поверните поршень по часовой стрелке, чтобы обойтись Ficoll-взвешенный образец в агарозном хорошо. Будьте осторожны, чтобы не проколоть хорошо с капиллярной или вводить воздушный пузырь в колодец, повернув слишком много прошлого, когда последний из жидкого листьев капилляра.
  9. После того как все образцы и стандарты, которые загружаются, установить постоянное напряжение питания 90 В (9 вольт / см агарозном гель).
  10. Прекратите электрофореза раз желтого красителя (Taurazine) спереди составляет 1 см от дна геля.
  11. После завершения электрофореза, передача гель УФ transilluminator визуализировать фрагменты ДНК и молекулярных стандартного веса. Захват изображения на пленке Polaroid с помощью камеры Polaroid с оранжевыми стеклянный фильтр (настройки: 2 и 4,5 г) или в виде цифрового изображения с помощью ПЗС-камеры и печатать изображения с тепловым принтером.
  12. Место капиллярной владельцам в 10% отбеливателя в течение 15-30 мин. Промыть 3 раза дН 2 O и место еще в комнате установки ПЦР высохнуть на воздухе.

4. Представитель Мультиплекс ПЦР Результаты

Результаты allelotyping ПЦР сальмонеллы изолирует 1-10 показаны на рисунке 1 (дорожки 3-12) и интерпретировать следующим образом. Обозначение вывода аллель уделяется Salmonella изоляции на основе ампликона (ПЦР продукта) соответствующий по размеру контроль ПЦР и, как предсказано для грунтовки аллель O наборов использовались (3): B-560bp, C1-340bp, С2-400 б.п., D1-620 б.п., и E1-280 бп. Для изолирует протестированы с O allelotyping ПЦР (рис. 1А), мы присвоили O аллели B (полосы 10 -13), С1 (дорожки 7-9), С2 (дорожки 4, 5), D1 (дорожка 3) и E1 (дорожка 6) на десять Salmonella изолирует протестированы в переулках 3-12. Эти же штаммов сальмонеллы были проверены, в том же порядке, как на рис. 1A, за 1 полугодие аллелей я, G, M, R, и z10 (рис. 1В, С). Опять же, H1 аллель присваивается каждому изоляции зависит от наличия ампликона соответствующий по размеру контроль ПЦР и, как предсказано в 4 грунтовки аллель H1 наборов использовались (3): я-510 б.п. (рис. 1В, полоса 2 ), G, M-310 б.п. (рис. 1В, полоса 2), г-170 б.п. (рис. 1С, переулок 2); и z10-360 б.п. (рис. 1С, переулок 2). H1 аллели были отнесены к одной из десяти штаммов сальмонелл: я - изолирует 3 и 8 (рис. 1Б, дорожки 5 и 10); г, м-изоляты 1 и 5 (рис. 1В, полосы 3 и 7), г до изолирует 6 и 9 (рис. 1С, переулков 8 и 11);. z10 и в изолирует 2, 7, и 10 (рис. 1С, дорожки 4, 9, и 12) сальмонеллы изолировать 4 была отрицательной для четырех H1 аллелей испытания. Наконец, сальмонелла изолятов были проверены методом ПЦР на аллелей H2 связанных с 1,2, 1,5, 1,6, 1,7 комплекс антиген и е, п, ж, е, п, Z15 антиген. Грунтовка наборы для Н2 1,2; 1,5; 1,6; 1,7 сложный и Н2 е, п, ж, е, п, Z15 комплекса производят 290 б.п. и 150 б.п. ампликонов соответственно (3). Грунтовка множества не могут различить конкретных аллелей H2 в любой антиген Н2 комплекса назначить окончательное типа аллеля, напр. 1,2, чтобы изолировать (3) сальмонеллы изолирует 4, 6, 8-10 были положительными аллелей H2 связанные с Н2 1,2;. 1,5; 1,6; 1,7 антиген комплекса, в то время как изоляты 2 и 7 были положительными аллелей H2 связанные с е, п, ж, е, п, Z15 комплекс антиген (данные не приведены). Хотя Salmonella штаммов 1, 3 и 5 были отрицательными для двух комплексов антиген Н2, только изолирует 1 и 5 были отрицательными для H2 флагеллин, определяемые с помощью универсального H2 флагеллин ПЦР (1) (данные не показывают). Эти результаты представлены в таблице 2, а также предполагаемого серовар Salmonella присваивается каждому изолировать.

Рисунок 1
Рисунок 1. Мультиплекс ПЦР для выявления конкретных О и Н аллели, связанные с С. enterica сероваров Enteritidis, Хадар, Гейдельберг, и Typhimurium. () O аллелей Мультиплекс ПЦР. (В, С) H1 аллелей Мультиплекс ПЦР для выявления флагеллин аллели: я / г, т (В) и r/z10 (С). Дорожки 1 и 13: 100 б.п. лестницы (Promega, Madison, WI), переулок 2: мультиплексной ПЦР управления для аллели O B, C1, C2, D1 и E (A), H1 аллелей я / г, т (В), и H1 аллелей r/z10 (С); и переулков 3-12: Salmonella изолирует 1-10 (табл. 2).

PCR Master Mix Термоциклер (Rapidcycler)
Реагенты Состав / концентрации Количество   Параметры Ожидаемый размер
H1 я / г, м
дН 2 O 63 мкл Программа 1 94 ° С в течение 1 мин
10X буфера ПЦР 20 мМ MgCl 2 10 мкл Программа 2 94 ° С в течение 1 с
500 mMTris PH8 55 ° С в течение 1 с
2,5 мг / мл BSA 72 ° C в течение 20 с
5% Ficoll 400 В течение 40 циклов
10 mMTartrazine Наклон = 2,0
Грунтовка я (F) * AACGAAATCAACAACAACCTGC 2 мкл Программа 3 72 ° С в течение 4 минут 510 б.п.
Primer (г) * TAGCCATCTTTACCAGTTCCC 2 мкл
Primer G, M (F) * GCAGCAGCACCGGATAAAG 2 мкл 310 б.п.
Primer G, М (г) * CATTAACATCCGTCGCGCTAG 2 мкл
ДМСО 5 мкл
дНТФ 10 мМ 2 мкл
Taq 5 ед / мкл 2 мкл
90 мкл
H1 R / Z 10
дН 2 O 55 мкл Программа 1 94 ° С в течение 1 мин
10X буфера ПЦР 30 мМ MgCl 2 10 мкл Программа 2 94 ° С в течение 1 с
500 mMTris PH8 55 ° С в течение 1 с
2,5 мг / мл BSA 72 ° C в течение 20 с
5% Ficoll 400 В течение 40 циклов
10 mMTartrazine Наклон = 2,0
Грунтовка R (F) * CCTGCTATTACTGGTGATC 4μl Программа 3 72 ° С в течение 4 минут 170 б.п.
Грунтовка г (г) * GTTGAAGGGAAGCCAGCAG 4μl
Грунтовка г 10 (F) * GCACTGGCGTTACTCAATCTC 4μl 360 б.п.
Грунтовка г 10 (г) * GCATCAGCAATACCACTCGC 4μl
ДМСО 5 мкл
дНТФ 10 мМ 2 мкл
Taq 5 ед / мкл 2 мкл
90 мкл
PCR Master Mix Термоциклер (Rapidcycler)
Реагенты Состав / концентрации Количество   Параметры Ожидаемый размер
H2 1,2 / е, п, х
дН 2 O 63,6 мкл Программа 1 94 ° С в течение 1 мин
10X буфера ПЦР 20 мМ MgCl 2 10 мкл Программа 2 94 ° С в течение 1 с
500 mMTris PH8 55 ° С в течение 1 с
2,5 мг / мл BSA 72 ° C в течение 20 с
5% Ficoll 400 В течение 40 циклов
10 mMTartrazine Наклон = 2,0
Грунтовка 1,2 (F) * AGAAAGCGTATGATGTGAAA 2 мкл Программа 3 72 ° С в течение 4 минут 290 б.п.
Грунтовка 1,2 (г) * ATTGTGGTTTTAGTTGCGCC 2 мкл
Грунтовка е, п, X (F) * TAACTGGCGATACATTGACTG 2 мкл 150 б.п.
Грунтовка е, п, х (г) 1 TAGCACCGAATGATACAGCC 2 мкл
ДМСО 5 мкл
дНТФ 10 мМ 2 мкл
Taq 5 ед / мкл 2 мкл
90 мкл
Generic H2
дН 2 O 72 мкл Программа 1 94 ° С в течение 1 мин
10X буфера ПЦР 30 мМ MgCl 2 10 мкл Программа 2 94 ° С в течение 10 с
500 mMTris PH8 45 ° C в течение 10 с
2,5 мг / мл BSA 72 ° С в течение 35 с
5% Ficoll 400 В течение 40 циклов
10 mMTartrazine Наклон = 2,0
Грунтовка fljB (F) * CAAGTAATCAACACTAACAGTC 2 мкл Программа 3 72 ° С в течение 4 минут 1500 б.п.
Грунтовка fljB (г) * TTAACGTAACAGAGACAGCAC 2 мкл
дНТФ 10 мМ 2 мкл
Taq 5 ед / мкл 2 мкл
90 мкл

Таблица 1. Протокол Salmonella flagellinallelotyping ПЦР: состав, условия и ожидаемые результаты.

* Рабочий запас концентрации праймеров ПЦР олигонуклеотид 25 мкМ

Изолировать О аллелей H1 аллелей H2 аллелей Серологический вариант
  B C1 C2 D1 E я г, м т z10 1,2; 1,5; 1,6; 1,7 е, п, ж, е, п, Z15 Общий 1  
1 - - - + - - + - - - - - Enteritidis
2 - - + - - - - - + - + + Хадар / Стамбул 3
3 - - + - - + - - - - - + Кентукки
4 - - - - + - - - - + - + Неизвестный
5 - + - - - - + - - - - - Монтевидео
6 - + - - - - - + - + - + Инфантис или Вирхов 2
7 - + - - - - - - + - + + Мбандака
8 + - - - - + - - - + - + Typhimurium
9 + - - - - - - + - + - + Гейдельберг
10 + - - - - - - - + + - + Хайфа

Таблица 2. Allelotyping ПЦР результаты (рис. 1) и назначение Salmonella серовар на основе определения вывода, H1, H2 и аллелей

> 1 H2 ПЦР производит 1,5 кб ампликона для всех сальмонелл обладающих H2 флагеллин, независимо от H2 аллель (1). Это ПЦР используется, чтобы отличить от монофазных двухфазный сальмонеллы.
2 H2 мультиплексной ПЦР не может различать различные аллели для Н2 1,2, 1,5, 1,6, 1,7 антиген (3).
3 Фаг преобразования С. enterica серовар Хадар изменяет ЛПС O антиген для производства серовар Стамбуле. О allelotyping ПЦР не может различить эти тонкие генетические / антигенных изменений.

Серовар 1 О аллелей H1 аллелей H2 аллелей
  B C1 C2 D1 E я г, м т z10 1,2; 1,5; 1,6; 1,7 е, п, ж, е, п, Z15 Generic 2
Калифорния + - - - - - + - - - - -
Typhimurium + - - - - + - - - + - +
Гейдельберг + - - - - - - + - + - +
Хайфа + - - - - - - - + + - +
Монтевидео - + - - - - + - - + - +
Othmarschen - + - - - - + - - - - -
Афины - + - - - + - - - - + +
Papuana - + - - - - - + - - + +
Мбандака - + - - - - - - + - + +
Chincol - - + - - - + - - - + +
Кентукки - - + - - + - - - - - +
Хадар / Стамбул 3 - - + - - - - - + - + +
Enteritidis - - - + - - + - - - - -
Серембан - - - + - + - - - + - +
Campinense - - - + - - - + - - + +
Ломе - - - + - - - + - - - +
Портленд - - - + - - - - + + - +
Руанда - - - + - - - - + - + +
Трэгуиэр - - - + - - - - + - - +
Сими - - - - + - - + - - + +
Weltevreden - - - - + - - + - - - +
Kristianstad - - - - + - - - + - + +
Биафра - - - - + - - - + - - +

Таблица 3. Сальмонеллы enterica сероваров идентифицируемый Allelotyping ПЦР

1 сероваров, выделенные жирным шрифтом те, чаще сталкиваются диагностических или пищевой микробиологии лабораторию.
2 H2 ПЦР производит 1,5 кб ампликона для всех сальмонелл обладающих H2 флагеллин, независимо от H2 аллель (1). Это ПЦР используется, чтобы отличить от монофазных двухфазный сальмонеллы.
3 Фаг преобразования С. enterica серовар Хадар изменяет ЛПС O антиген для производства серовар Стамбуле. О allelotyping ПЦР не может различить эти тонкие генетические / антигенных изменений.

Discussion

Большинство имеющихся в продаже тестов PCR для обнаружения сальмонеллы цели генов уникальны для рода (например, Инва). Однако, не все Salmonella равны в их способности вызывать заболевания людей или распространенность в популяции животных. Раннее распознавание антигенных различий в Salmonella ЛПС О-антиген и flagellinH1 и H2 антигенов привела к дифференциации сальмонелл в более 2500 сероваров на основе этих антигенных различий. Есть 46 различных антигенов O и 86 различных флагеллин (H) антигены, определенные в роду Salmonella. Сальмонеллы могут иметь один (H1) или двух разных (H1 и H2) flagellins. Различные комбинации O, H1, H2 и антигенов составляет 2500 сероваров сальмонелл признал сегодня. Серовар присваивается на основании антигенной формулой, выведенной из идентификации отдельных O и H антигенов. Антигенной формулой записывается как O: H1: Н2, а где "-", ссылается на отсутствие H1 или H2 флагеллин и "NT" (не typeable) для сальмонелл отрицательной О-антиген. Например, Typhimurium серовар назначен С. enterica изолировать с антигенной формулой B: я: 1,2 в то время как Enteritidis уделяется изоляции с формулой D1: г, м: -. Это изменение антигенного Salmonella населения внешнее проявление различий в нуклеотидных уровня, который может быть легко взломано с помощью ПЦР.

Мы выявили генетические различия, связанные с конкретными О и Н аллелей развивать allelotyping ПЦР для выявления С. enterica сероваров: Enteritidis, Хадар, Гейдельберг, и Typhimurium (3). Правильное назначение и отчетности сальмонеллы серовар требует тестирования для всех аллелей связанных с O: H1: H2 антигенной формулы для Enteritidis (D1: г, м: -), Адар (C2: z10: е, п, х), Гейдельберга (B : г: 1,2) и Typhimurium (B: я: 1,2). Без знания о аллель или антиген, нахождение H1 G, M аллелей само по себе не обязательно будет определяться Salmonella изолировать как Enteritidis других сероваров сальмонелл: Агона, штат Калифорния, и Монтевидео, также обладают этим же аллель. Хотя allelotyping ПЦР был первоначально предназначен для обнаружения сальмонеллы Поэтому упомянутые сероваров, этот тест может определить дополнительные 19 сероваров (табл. 3). Наши allelotyping ПЦР был первоначально предназначен для обнаружения О и Н аллелей. На практике, он стал более практичным и экономически эффективным для нас, для определения О-антигена слайд агглютинации, используя О-специфической антисыворотки, а не выполнять O allelotyping ПЦР при работе с изолированными культур сальмонелл. Однако, мы рекомендуем использовать O allelotyping ПЦР, если ваша лаборатория использует эту ПЦР в качестве экрана (2) или для набора Salmonella штаммов представлены на FTA карты (6), и включают в себя Salmonella-специфической ПЦР с первым экраном образцов (4 ). Предельная allelotyping ПЦР только те образцы, которые определены как Salmonella методом ПЦР или биохимических / антигенные тесты.

Протокол, описанный в этой статье, была оптимизирована для использования с Айдахо технологии Rapidcycler, горячего воздуха амплификаторе, что позволяет уменьшать реакцию объемах и условиях проходит реакция за меньшее время, чем многие thermocyclers блока нагрева. Чтобы адаптировать этот протокол для использования с амплификаторе блок отопления может потребовать оптимизации условий реакции эмпирическим путем снижения / повышения температуры отжига; настройки грунтовки концентрации; или корректировке MgCl 2 концентрациях. Например, нам пришлось адаптировать протокол для MJ Research PTC-200 амплификаторе следующим образом. Работа с тех же объемах реакции, описанные в таблице 1, работающий фондовый concentrationof набор я грунтовку разбавляют до 2,5 мкм, температура отжига была снижена с 55 ° C до 45 ° С и времени инкубации при денатурации, отжига и расширение шаги была увеличена до 20 с для в / г, м allelotyping ПЦР. Имея соответствующие положительные и отрицательные контроли имеют важное значение в начальной до начала и оптимизацию для любого ПЦР, в том числе опубликованных протоколов. Мы рекомендуем приобретение известных сероваров сальмонелл, в частности Anatum (E1: е, ч: 1,6), Enteritidis (D1: г, м: -), Адар (C2: z10: е, п, х), Гейдельберга (B: г : 1,2), Монтевидео (C1: G, M, S: 1,2,7) и Typhimurium (B: я: 1,2), а палочка Escherichia K12 лаборатории штамма (DH5α, LE393, JM109, и т.д. ) как положительный и отрицательный контроль, соответственно, для allelotyping тестов ПЦР, описанные в этой статье. Некоторые из этих сероваров сальмонелл будет служить положительным или отрицательным контролем, в зависимости от аллель испытания.

Некоторые меры предосторожности и руководящие принципы должны быть выполнены во время выполнения этой и любой другой диагностической ПЦР. Во-первых, физическое разделениешаблона подготовки, ПЦР настройки, и гель-электрофореза имеет решающее значение для предотвращения возможных ПЦР переноса загрязнения и ошибочные представления ложных срабатываний. Кроме того, включение соответствующих мер контроля необходимо в любой рутинной ПЦР, как эти элементы управления выявления проблем по мере их возникновения и помочь в интерпретации результатов (5). Самое главное, последовательность имеет важное значение, особенно в связи с электрофоретической условия для ампликона (ПЦР продукта) обнаружения andestimation из ампликона размера. Чтобы проиллюстрировать это, мы намеренно приостановлено электрофореза ранее запланированного на рисунке 1А. Молекулярный вес стандартов (дорожки 1 и 13) и положительного контроля (дорожка 2) не являются достаточно отделены точно оценить размеры или наблюдать разделение фрагментов ДНК, где Есть небольшие различия (~ 50 б.п.) в размерах. Адекватное разделение фрагментов ДНК, особенно молекулярного веса стандартам, имеет важное значение в качестве положительных отчетности зависит от точной оценки размера ампликона и отличительные "истинный положительный результат" от неспецифических ампликонов, которые иногда наблюдаются в повседневной работе любого ПЦР (5 ). Например, есть неспецифический ампликона на Рисунке 1B, переулок 7 (~ 700 б.п. в размере). Если бы электрофореза была прекращена слишком рано, когда краситель фронт только на пол-очка путь в агарозном геле, не было бы мало различий между 500 б.п. и 700 б.п. фрагментов ДНК. Таким образом, образец в переулок 7 было бы ошибочно сообщили, как положительные для обоих я и G, M аллелей.

Наконец, нужно признать, ограничения, связанные с какой-либо тест. Некоторые из H1/H2 allelotyping ПЦР не имеют дискриминационный власти различить тонкие генетические различия в аллелей принадлежащих H2 1,2, 1,5, 1,6, 1,7 антиген комплекса, е, п, х / б , п, Z15 комплекса антиген и антиген H1 G комплекс, который включает в себя G, M аллеля. Один или два аминокислот изменения кислоты составляют различные эпитопы, присутствующие в этих жгутиковых антигенов. Поэтому было трудно для нас дизайн праймеров, которые может использовать эти иногда одиночные пары оснований различия в последовательности гена флагеллин (3). Например, сальмонеллы сероваров Дублин (D1: г, р: -) и Берта (D1: F, G, т: -) также ПЦР положительный с нашими г, mallelotyping праймеров. H2 allelotyping грунтовки не могут отличить Typhimurium (B: я: 1,2) из ​​Лагоса (B: я: 1,5), Гейдельберга (B: г: 1,2) Брэдфорд (B: г: 1,5), Виннебе (B: г: 1,6), или Ремо (B: г: 1,7), или Хадар (C2: z10: е, п, х) из Glostrup (C2: z10: е, п, Z15). Хотя вероятность столкновения некоторые из этих сероваров: Лагос, Брэдфорд, Виннебе, Ремо или Glustrup на удаленной машине, это возможность и требует либо предоставление оговорка о тестов ограничение или другого подтверждающего теста.

В заключение этой основе ПЦР серотипирование быстро идентифицирует С. enterica сероваров Enteritidis, Хадар, Гейдельберге и Typhimurium, и О, H1, H2 и аллелей связано с дополнительными 19 сероваров. Этот анализ является быстрым, экономически эффективной альтернативой традиционным микробиологическим подход к серотипирование сальмонеллы.

Disclosures

Нет конфликта интересов объявлены.

Acknowledgments

Эта работа была поддержана Министерством сельского хозяйства США Гранты 1999-35212-8680, 2005-01378, и 2010-04288-01, USDA Формула фондов и государства ветеринарной медицины Грузии грант сельскохозяйственных исследований. Протокол, описанный в этой публикации был разработан для использования студентами в рамках исследования направлены курсы: MIBO 4900L, GENE 4960H, BCMB 4960L и БИОЛ 4960H в Университете Джорджии и используются студентами на нескольких молекулярных исследовательских проектов эпидемиологии в Маурер лаборатории. Мы хотели бы поблагодарить многих студентов, которые выполняются исследования в Маурер и Ли лабораториях, и наш отдел стул, Джон Глиссона за поддержку наших усилий по интеграции студентов с инструкцией исследований.

Materials

Name Company Catalog Number Comments
Luria Bertani Fisher Scientific (or any comparable source)
Microfuge tubes Fisher Scientific 1.5 ml capacity (or any comparable source)
Ethanol Fisher Scientific 200 proof (or any comparable source)
dH2O Sigma-Aldrich Molecular Biology Grade (or any comparable source; PCR only)
10 x PCR Buffer: Idaho Technologies 20 mM MgCl2 (buffer comes with BSA, Ficoll and Tartrazine)
30 mM MgCl2
40 mM MgCl2
PCR primers
DMSO
dNTP Roche Group (or any comparable source)
Taq DNA Polymerase Denville Scientific (or any comparable source)
Capillary pipettes Idaho Technologies 10 µl volume
Rapid Cycler Idaho Technologies
Agarose Bio-Rad Low EEO; Molecular Biology Grade (or any comparable source)
50 X TAE Buffer or 5X TBE Buffer Fisher Scientific (or any comparable source)
Ethidium bromide Bio-Rad (or any comparable source)
Horizontal, submersible gel electrophoresis chamber with gel mold Bio-Rad (or any comparable source)
Power supply Bio-Rad (or any comparable source)
Molecular Imager Gel Doc System Bio-Rad (or any comparable source)
Table 4. Materials

DOWNLOAD MATERIALS LIST

References

  1. Dauga, C., Zabrovskaia, A., Grimont, P. A. D. Restriction fragment length polymorphism analysis of some flagellin genes of Salmonella enterica. J. Clin. Microbiol. 36, 2835-2843 Forthcoming.
  2. Hong, Y., Liu, T., Lee, M. D., Hofacre, C. L., Maier, M., White, D. G., Ayers, S., Wang, L., Berghaus, R., Maurer, J. A rapid screen of broth enrichments for Salmonella enterica serovars Enteritidis, Hadar, Heidelberg, and Typhimurium using an allelotyping multiplex PCR that targets O and H antigen alleles. J. Food Prot. 72, 2198-2201 (2009).
  3. Hong, Y., Liu, T., Lee, H. ofacre, Maier, C. L., White, M., Ayers, D. G., Wang, S., Berghaus, L., R, M. aurer J.Rapid screening of Salmonella enterica serovars Enteritidis, Hadar, Heidelberg and Typhimurium using a serologically-correlative allelotyping PCR targeting the O and H antigen alleles. BMC Microbiol. (2008).
  4. Liu, T., Liljebjelke, K., Bartlett, E., Hofacre, C. L., Sanchez, S., Maurer, J. J. Application of nested PCR to detection of Salmonella in poultry environments. J. Food Prot. 65, 1227-1232 (2002).
  5. Maurer, J. J. Rapid detection and limitation of molecular techniques. Ann. Rev. Food Sci. Tech. 2, 259-279 (2011).
  6. Moscoso, H., Alvarado, I., Hofacre, C. L. Molecular analysis of infectious bursal disease virus from bursal tissues collected on FTA filter paper. Avian Dis. 50, 391-396 (2006).
  7. Sambrook, J., Fritsch, E. F., Maniatis, T. Molecular cloning: a laboratory. 2nd ed, Cold Spring Harbor Laboratory Press. Cold Spring Harbor, N.Y. (1989).
  8. Wittwer, C. T., Fillmore, G. C., Hillyard, D. R. Automated polymerase chain reaction capillary tubes with hot air. Nucleic Acids Res. 17, 4353-4357 (1989).
Allelotyping ПЦР для выявления<em> Salmonella enterica</em> Сероваров Enteritidis, Хадар, Гейдельберг, и Typhimurium
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Maurer, J. J., Lee, M. D., Cheng, Y., Pedroso, A. An Allelotyping PCR for Identifying Salmonella enterica serovars Enteritidis, Hadar, Heidelberg, and Typhimurium. J. Vis. Exp. (53), e3130, doi:10.3791/3130 (2011).More

Maurer, J. J., Lee, M. D., Cheng, Y., Pedroso, A. An Allelotyping PCR for Identifying Salmonella enterica serovars Enteritidis, Hadar, Heidelberg, and Typhimurium. J. Vis. Exp. (53), e3130, doi:10.3791/3130 (2011).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter