Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Biology

10 나노 그램 총 RNA의 단일 읽기와 결합하여 최종 mRNA - Seq의 Illumina 도서관

doi: 10.3791/3340 Published: October 27, 2011

Summary

여기 T7 RNA 선형 증폭을 기반으로 유전자 발현 분석을 위해 모두 하나의 읽기 및 이점 엔드 Illumina mRNA - Seq 시퀀싱 라이브러리의 준비를위한 방법을 설명합니다. 이 프로토콜은 총 RNA를 시작하는 10 나노 그램이 필요하고 전체 성적표를 나타내는 매우 일관된 라이브러리를 생성합니다.

Abstract

mRNA - Seq하여 전체 transcriptome 배열은 현재 전세계 유전자 발현, 돌연변이, allele 특정 표현과 다른 게놈 차원의 분석을 수행하기 위해 광범위하게 사용됩니다. mRNA - Seq도 아닌 합성의 genomes의 유전자 발현 분석을위한 게이트가 열립니다. mRNA - Seq는 높은 감도, 넓은 동적 범위를 제공하고 샘플에 성적표 사본 번호를 측정하실 수 있습니다. Illumina의 게놈 분석기는 하나의 긴 읽기 궁극적으로 "이점 엔드"접근 방식이 모두의 끝에 합성 수 있습니다. 대형 상대적으로 짧은 시퀀스 번호 (> 10 7) (<150 BP) 읽기의 순서 수행 대체 스플 라이스 분기점을 추적 가능 , 삽입 및 삭제, 그리고 드 노보 transcriptome 조립하는 데 유용합니다.

연구자들이 직면한 주요 도전 과제 중 하나는 재료를 시작하는 제한된 금액을 말합니다. 예를 들어, 세포가 레이저 마이크로 해부 가능하여 수확 아르 실험 총 RNA m를 시작나노 그램의 대책을 불안. 이러한 샘플에서 mRNA - Seq 라이브러리의 준비는 1, 2를 설명하지만 편견을 소개 중대한 PCR 증폭을 포함하고 있습니다. 최소한의 PCR 증폭 다른 RNA - Seq 라이브러리 구축 절차 3, 4를 발표했지만 전체 RNA를 시작하는 마이크로 그램 금액을 요구했습니다.

여기 우리는 중요한 PCR 증폭을 피할 수 및 총 RNA의 10 나노 그램이 필요 도서관 준비 mRNA - Seq의 시퀀싱을위한 Illumina 게놈 분석기 II 플랫폼을위한 프로토콜을 설명합니다. 이 프로토콜은 그것이 상당한 증폭 바이어스를 도입하지 않고 방향 라이브러리를 제작 게재된 단일 엔드 시퀀싱 5, 이전에 설명한 및 검증되어 있지만, 여기서 우리는 이점 엔드 프로토콜로 사용하기 위해 추가로 그것을 확인합니다. 우리는 선택 'T7 주장, T7 기반 Eberwine 선형 증폭 방법을 사용하여 총 RNA를 시작 polyadenylated 메신저 RNAs를 증폭라 "(T7 선형 증폭). 증폭 폴리 - A mRNAs이 조각되어 최종 시퀀싱 라이브러리를 생성하는 출혈도 잡았 베꼈는데와 어댑터 역방향. 모두 하나의 읽기 및 이점 최종 실행을 위해, 시퀀스는 인간의 transcriptome 6 매핑하고되도록 정규화 여러 실행에서 데이터를 비교할 수 있습니다. 우리는 샘플 7 비교하면 RPKM에 뛰어난 측정합니다 만명 당 성적 단위로 유전자 발현 측정 (TPM)를보고합니다.

Protocol

1. 총 RNA를 분리

  1. 세포 / 조직 1ml Trizol을 추가하고, 18-22 거즈 바늘 필요한 경우와 homogenize.
  2. 200 μl 클로로포름, 4시 30 분 14,000 rpm으로 회전 ° C. 추가
  3. 최고 수성 층을 꺼내, 0.5 μl 선형 아크릴 아미드를 추가한 후 500 μl 이소프로판올를 추가합니다. 20 분 상온에서 앉아 보자.
  4. 14,000 70 % 에탄올 4 ° C, 씻어 펠렛에 RPM, 그리고 진공 건조에 스핀.
  5. 1 μl nuclease 무료 물 200 μl PCR 튜브에 전송에 Resuspend.

2. 이중 cDNA 좌초 준비

  1. 위의 1 μl RNA하기 oligo - DT - T7 리버스 전사 프라이머 (5' - GGCCAGTGAATTGTAATACGACTCACTATAGGGAGGCGGTTTTTTTTTTTTTTTTTTTTTTTT -3 ') 100 μm의 1 μl, 70 열을 추가 ° C (히트 블록) 5 분, 그리고 얼음 멋진 스냅하십시오.
  2. 1 μl 배 FS 버퍼, 0.5 μl DTT, 0.5 μl dNTP 믹스와 0.5 μl RnaseOUT을 (윗첨자 II 키트에서) 추가합니다.
  3. 42 열° C는 PCR 기계에서 1 분 후, 0.5 μl 윗첨자 II 역방향 transcriptase를 추가합니다. 42 1 시간에 대한 품어 ° C.
  4. 70 열 ° 10 분 C, 멋진 4 ° C.
  5. 얼음, 위의 반응에 다음을 추가 :
  • Nuclease 무료 물 - 22.75 μl
  • 배 두 번째 스트랜드 버퍼 - 7.5 μl
  • dNTP 혼합 - 0.75 μl
  • E. 대장균 DNA Ligase - 0.25 μl
  • E. 대장균의 DNA의 중합 효소 - 1 μl
  • RnaseH - 0.25 μl

16 2 시간에 대해 품어 ° C 다음 1 μl T4의 DNA 중합 효소를 추가하고 16 추가 10 분 품어 ° C.

  1. 1.5 ML eppendorf 튜브로 환승, 80 μl 물을 추가합니다.
  2. 선형 아크릴 아미드의 0.5 μl를 추가합니다.
  3. 72 μl 3 M NH4OAc 차가운 100 % 에탄올을 480 μl를 추가합니다. -20 ° C.에 1 시간을 위해 침전
  4. 4 14,000 rpm으로 회전 ° C 30 분, 2 14,000 rpm으로, 1 ML 70 % 에탄올과 함께 원심 분리기를 씻어약 10 분 동안 건조 분, 진공.

3. 시험 관내 전사에 의해 폴리 - A mRNA를 증폭

  1. 3.5 μl nuclease 무료 물 위에 cDNA Resuspend.
  2. 위와 1 μl dNTPs의 각 (총 4 μl), 10X 반응 버퍼 1 μl 및 T7 효소 1 μl, 그리고 Megascript 키트에서 RnaseOUT 0.5 μl를 추가합니다.
  3. 37 품어 ° PCR 기계에서 C 하룻밤.
  4. 다음 단계를 준비​​. -80에 저장할 수 있습니다 ° C.

4. 증폭 폴리 - A mRNA의 조각

  1. 이상 반응 4 μl 10X 조각 시약 물을 26 μl를 추가합니다.
  2. 70 ° C 정확히 7분에 대한 PCR 기계에 열.
  3. 조각화 중지 버퍼의 5 μl를 추가, 얼음에 샘플을 넣어.

5. RNA는 청소

  1. 위의 반응, 60 μl 물을 Rneasy MinElute 키트에서 버퍼 RLT 350 μl, 그리고 pipetting하여 혼합을 추가합니다.
  2. 스핀 컬럼에 250 μl 에탄올, pipetting하여 혼합하고, 피펫을 추가합니다.
  3. 20 초 동안 8,000 rcf에 스핀.
  4. , RPE 20 초 동안 회전과 함께 한 번 씻으 80 % EtOH, 2 분 동안 회전하고, 오분 스핀과 건조 열로 두 번 씻는다.
  5. 10 μl nuclease 무료 물에 Elute RNA.

6. cDNA 합성

단일 읽을 라이브러리 최초의 스트랜드 합성 :

  1. PCR 튜브에 다음을 추가 :
  • 조각난 폴리 - A mRNA - 10 μl
  • NotI 무작위 nonamer 프라이머 - 1 μl

5 thermocycler에 분, 얼음에 빠른 진정에 대해 70 ° C에서 품어. NotI Nonamer 프라이머 (5' - TGAATTCGCGGCCGCTCAAGCAGAAGACGGCATACGAGCTCTTCCGATCT NNNNNNNNN의 -3 '). 임의의 영역까지 그 다음 순서는 칩 Seq 키트에서 Illumina의 어댑터 B 순서의 반대로 보완되는 동안 5 '근위 시퀀스가​​ NotI 제한 사이트입니다.

위의하려면 얼음에 다음 (윗첨자 III 키트에서) 추가 :
  • 배 첫번째 스트랜드 버퍼 -4 μl
  • DTT - 2 μl
  • dNTP 혼합물 * - 1.5 μl

42 2 분 동안 thermocycler 입어 ° C는 윗첨자 III 역방향 transcriptase 1 μl를 추가하고, 1 시간을위한 42 ° C에서 품어.

* 대신 dCTP의 5 - 메틸 dCTP는 dNTP 혼합물에 사용되었다.

이점 엔드 라이브러리에 대한 최초의 스트랜드 합성 :

  1. PCR 튜브에 다음을 추가 :
  • 조각난 폴리 - A mRNA - 10 μl
  • 임의의 hexamer의 프라이머 - 1 μl

5 thermocycler에 분, 얼음에 빠른 진정 65 ° C에서 품어.

  1. 위의하려면 얼음에 다음 (윗첨자 firststrand III 키트에서) 추가 :
  • 배 첫번째 스트랜드 버퍼 - 4 μl
  • DTT - 2 μl
  • dNTPs (에서키트) - 1.5 μl

45에서 1 분 thermocycler 입어 ° C가 어깨 III 역방향 transcriptase 1 μl를 추가, 1 시간 동안 45 ° C에서 품어.

두 번째 가닥 합성 (두 라이브러리의 경우) :

  1. 위의하려면 얼음에 다음 (윗첨자 II 키트에서) 추가 :
  • 물 (RNase 무료) - 91 μl
  • 배 두 번째 스트랜드 버퍼 - 30 μl
  • dNTPs (키트에서) - 3 μl
  • E. 대장균 DNA Ligase - 1 μl
  • E. 대장균의 DNA의 중합 효소 - 4 μl
  • E. 대장균 RNase H - 1 μl

역전에 의한 혼합 튜브는 2 시간 16에서 짧은 스핀과 부화 ° C를 제공합니다.

7. cDNA 정화

  1. 이점 엔드 라이브러리를 하나의 읽기 및 물 30 μl을위한 물 40 μl에 elute Zymo 열이와 cDNA 샘플을 정화.

8. 최종 수리

단일 읽어 도서관의 경우 :

  1. cDNA의 위 40 μl하려면 추가 :
  • 10mM ATP와 T4 DNA ligase의 버퍼 - 5 μl
  • dNTP 혼합 - 2 μl
  • T4의 DNA 중합 효소 - 1 μl
  • Klenow 효소 (1U / μl로 물을 1:5 희석) - 1 μl
  • T4 PNK - 1 μl

20 30 분 열 자전거 타는 사람에 품어 ° C.

이점 엔드 라이브러리의 경우 :

(Illumina 이점 최종 샘플 준비 키트를 사용)

  1. cDNA 위의 30 μl하려면 추가 :
  • RNase DNase 무료 물 - 45 μl
  • 10mM ATP와 T4 DNA ligase의 버퍼 - 10 μl
  • 10mM dNTP 믹스 - 4 μl
  • T4의 DNA 중합 효소 - 5 μl
  • Klenow 효소 - 1 μl
  • T4 PNK - 5 μl

20 30 분 열 자전거 타는 사람에 품어 ° C.

9. cDNA 청소까지

  1. C cDNA를 사용하여 Zymo 컬럼을 린 (Lean). 이점 엔드 라이브러리를 하나의 읽기 및 EB 32 μl를 위해 EB 34 μl에 Elute.

10. DNA 조각의 3 '끝에'A '기지를 추가

단일 읽어 도서관의 경우 :

  1. 다음과 같은 반응 믹스를 준비 :
  • DNA 샘플 - 34 μl
  • Klenow 버퍼 - 5 μl
  • dATP - 10 μl
  • Klenow 엑소 - 1 μl

37 30 분 품어 ° C.

이점 엔드 라이브러리의 경우 :

  1. 다음과 같은 반응 믹스를 준비 :
  • DNA 샘플 - 32 μl
  • Klenow 버퍼 - 5 μl
  • dATP - 10 μl
  • Klenow 엑소 - 3 μl

37 30 분 품어 ° C.

11. cDNA 청소까지

  1. cDNA를 사용하여 zymo 컬럼을 청소하십시오. EB 10 μl에 Elute.

12. 어댑터 내고

jove_step "> 단일 읽어 라이브러리의 경우 :

(Illumina 칩 Seq 샘플 준비 키트를 사용)

  1. 다음과 같은 반응 믹스를 준비 :
  • DNA 샘플 - 10 μl
  • 어댑터 Oligo 믹스 - 1 μl
  • 2X DNA Ligase 버퍼 -15 μl
  • DNA ligase - 4 μl

상온에서 15 분 동안 품어. 어댑터는 얼음 희석 1시 20분에 해동해야합니다.

이점 엔드 라이브러리의 경우 :

(Illumina 이점 최종 샘플 준비 키트를 사용)

  1. 다음과 같은 반응 믹스를 준비 :
  • DNA 샘플 - 10 μl
  • PE 어댑터 Oligo 믹스 - 10 μl
  • 2X DNA Ligase 버퍼 - 25 μl
  • DNA ligase - 5 μl

20 15 분 동안 품어 ° C. 어댑터는 얼음 희석 1시 20분에 해동해야합니다.

13. 결합 반응 정리

  1. zy를 사용하여 결합 반응을 정리MO 열. 이점 엔드 라이브러리 EB 5 μl에서 다른 용출에 이어 단일 읽어 도서관 EB 6 μl 물 44 μl에 Elute.

NotI의 소화를 수행, 오직 1 읽기 도서관

  • cDNA - 44 μl
  • 코 버퍼 3-5 μl
  • BSA - 0.5 μl
  • NotI - 1 μl

37 ° C 및 zymo 칼럼을 사용하여 정화 반응에서 하루에 2 시간을위한 품어. 버퍼 EB 6 μl와 Elute이 EB 5 μl와 두 번째 용출로 따라갔다.

14. 사이즈 선택 / 젤 정화

Invitrogen에서 2 % Sybr 안전 E - 젤을 사용하여 다음을 수행합니다.

  1. 프로그램 0 - PreRun 이분을 실행합니다.
  2. Invitrogen 희석 1시 4분에서 1킬로바이트 플러스 사다리로드, 10 μl를로드합니다.
  3. DNA 샘플을 모두로드하고, 물 10 μl와 빈 차선을 입력합니다.
  4. 프로그램을 실행 1 - EGel 2 % 28 분 실행합니다.
  5. 크기가 200-300 BP 젤 slic을 선택새로운 면도날과 전자.

15. 겔 슬라이스에서 Elute의 DNA

  1. 겔 슬라이스를 저울질하고, 젤 1 볼륨 (Qiagen에서 사용할 젤 추출 키트)에 QG 버퍼 3 볼륨을 추가
  2. 50 품어 ° C로 10 분 또는 겔 슬라이스가 해소까지.
  3. 1 ispropanol의 볼륨, 그리고 역전이나 pipetting하여 혼합을 추가합니다.
  4. 최대 속도로 1 분 열, 스핀에 추가하고, 흐름을 통해 폐기하십시오.
  5. 열 QG 버퍼 500 μl, 최대 속도로 1 분 스핀을 추가하고 흐름을 통해 폐기하십시오.
  6. 열 버퍼 PE의 750 μl를 추가, 최대 속도로 1 분 스핀, 그리고 플로우를 통해 폐기하십시오.
  7. 최대 속도에서 1 분간 원심 분리기.
  8. 이점 엔드 라이브러리를 하나의 읽기 및 23 μl EB 위해 EB 36 μl에 Elute.

16. PCR

단일 읽어 도서관의 경우 :

(Illumina 칩 Seq 샘플 준비 키트를 사용)

  1. 따라와 준비g PCR 반응 혼합물 :
  • DNA - 36 μl
  • 배 Phusion 버퍼 - 10 μl
  • dNTP 혼합 - 1.5 μl
  • PCR의 프라이머 1.1-1 μl
  • PCR의 프라이머 2.1-1 μl
  • Phusion 효소 - 0.5 μl

다음 PCR 프로토콜을 사용 :

  • 98 30 초 ° C
  • : 10 사이클
    • 98시 십초 ° C
    • 65 30 초 ° C
    • 72 ° C 30 초
  • 72시 오분 ° C
  • 4 잡고 ° C

키트가 사용되는 * 처음 EB 버퍼와 PCR primers 1시 2분을 희석.

이점 엔드 라이브러리의 경우 :

(Illumina 이점 최종 샘플 준비 키트를 사용)

  1. 다음 PCR 반응 준비 :
  • DNA - 23 μl
  • Phusion DNA의 중합 효소 - 25 μl
  • PCR 프라이머 PE 1.1-1 μl
  • PCR 프라이머 PE 2.1 -1 μl

다음 PCR 프로토콜을 사용하여 증폭 :

  1. 98 30 초 ° C
  2. : 10 사이클
    • 98시 십초 ° C
    • 65 30 초 ° C
    • 72 ° C 30 초
  3. 72시 오분 ° C
  4. 4 잡고 ° C

키트가 사용되는 * 처음 EB 버퍼와 PCR primers 1시 2분을 희석.

17. 도서관 청소

  1. zymo 컬럼을 사용하여 라이브러리를 정리. EB 12 μl에 Elute

18. Quantitate 도서관

  1. Quantitate 라이브러리 Qubit를 사용합니다. 그것은 시퀀싱을위한 준비가 된 것입니다. 단일 읽어 도서관 및 이점 엔드 라이브러리에 대한 V4 이상 Illumina 이점 엔드 클러스터 생성 키트에 대한 V4 이상 Illumina 단일 읽어 클러스터 생성 키트에서 primers를 시퀀싱 사용합니다.

19. 데이터 분석

Bowtie 6 m로 사용되었습니다AP는 RefSeq 유전자 세트 (NCBI 빌드 36.1)로 읽습니다. 단일 끝 읽고 (30 세포핵)와 쌍을 엔드는 유전자 세트 10 일치까지 허용하고, 읽기마다이 불일치 최대 허용 매핑된했다 (42 세포핵) 읽습니다. 만 명 (TPM) 값마다 성적표는 RSEM 7 (예상 - 극대화하여 RNA - Seq)를 사용하여 유전자 발현을 측정하기 위해 취득했다.

20. 대표 결과 : 우리는 모두 하나의 읽기 및 이점 끝에 총 RNA를 (그림 1) 시작 1 μg, 100 μg, 10 μg, 1 μg 및 100 PG에서 실행에 대한 T7LA 라이브러리를했다. 우리의 프로토콜의 평가를 위해, 우리는 하나 최소한의 증폭을 가지고, "MinAmp"칭했다 10 μg 총 RNA 이러한 컨트롤 라이브러리부터 T7 RNA를 증폭하지 않고 엔드 라이브러리를 읽고 이점했다. 그들이 받아야 유일한 증폭은 Illumina 시퀀싱 어댑터, 모든 도서관에 공통 단계를 ligate 수있는 프로토콜의 끝 근처 PCR의 10주기입니다. 모든 RNA 사용은 H14에서 고립되었다인간 배아 줄기 세포 8.

우리는 먼저 다양한 라이브러리 (표 1과 보충 표 1)에 의해 식별 유전자의 개수를 평가했다. 모두 하나의 읽기 및 이점 엔드 라이브러리, 10 NG T7LA 도서관은 10 이상의 TPM과 10 μg의 MinAmp 라이브러리와 같은 유전자의 거의 같은 번호를 확인. 단일 읽어 도서관의 경우에는 10 NG T7LA 라이브러리는 10 μg unamplified 라이브러리에 의해 식별 8,500 유전자의 100 %를 확인. 이점 엔드 라이브러리, 10 NG T7LA 라이브러리는 10 μg unamplified 라이브러리 (9,267 유전자의 7961)에 의해 식별 유전자의 86 %를 발견. 이하 10 NG로 만들어진 라이브러리는 많은 유전자로 확인할 수 없습니다. 예를 들어, 단일 읽기 프로토콜에서 제 1 NG 라이브러리는 식별 ~ 10 μg의 MinAmp 라이브러리에 의해 식별 유전자의 50 %를, 우리가 T7LA 프로토콜 10 NG로 함께 사용할 수 총 RNA의 가장 낮은 금액을 제한하라는. 또한, 하우스 키핑 유전자의 매핑, GAPDH (그림 2) 시작 RNA의 적어도 10ng으로 만든 모든 T7LA 라이브러리는 극단적인 5 '엑손 포함한 모든 exons 확인을 보여준다. MinAmp 라이브러리와 10 NG T7LA 하나의 읽기 및 이점 엔드 라이브러리 비교 유사성이 높은 수준 (각각 창병 상관 관계, R = 0.90와 0.95, 그림 3A와 B)를 보여줍니다. 우리는 또한 10 NG 총 RNA로 만들어진 두 개의 단일 읽고 이점 엔드 라이브러리를 비교하고 그들은 도서관의 두 가지 유형이 (매우 유사한 유전자 발현 서명을 생산 T7LA 프로토콜을 사용하여 만든 보여주는, 매우 높은 상관 계수 (R = 0.92)했다 그림 3C).. 따라서 T7LA 방법은 신뢰성과 MinAmp 라이브러리로 포괄적 시퀀싱 라이브러리를 생산할 수 있지만 ~ 1000 배 적은부터 재료.

그림 1
그림 1 이점 엔드의 스키마와 단일 읽어 도서관 준비 프로토콜을.

jove_content "> 그림 2
그림 2 모든 단일 읽고 이점 엔드 라이브러리 하우스 키핑 유전자, GAPDH의 게놈 브라우저 그림. 단일 읽어 라이브러리 왼쪽에있는 스케일 모음 350 총 읽고 있음을 나타냅니다. 이점 엔드 라이브러리 센터의 규모를 막대는 5,000 총 읽고 있음을 나타냅니다. 수평 축은 GAPDH의 게놈 시퀀스를 나타냅니다.

그림 3
그림의 다양한 라이브러리 (창병의) 사이의 유전자 표현의 3 간 상관 관계 :. A. 사이에 단일 10 NG T7LA와 10 μg의 MinAmp 라이브러리이 라이브러리를 모두 매우 유사한 유전자 발현 패턴을 (R = 0.90) 것을 보여주는 B. 읽어 이점 끝 사이 10 NG T7LA와 10 μg의 MinAmp 라이브러리 유전자 발현 프로파일을 그들의 유사성 (R = 0.95)를 나타냅니다. 유전자의 예 C. 간 상관 관계10 NG 이점 끝에 10 NG 단일 읽어 도서관 사이 pressions는 T7LA 방법 (R = 0.92)에 의해 준비된이 라이브러리 사이의 유사성의 높은 수준을 보여줍니다.

그림 4
그림 모두 하나의 읽기 및 이점 엔드 라이브러리에서 인간의 배아 줄기 세포 특정 genes5 4 식별.

도서관 유형 ° 원시 클러스터 필터를 통과 % 클러스터 게놈으로 정렬 % %의 에러율 유전자 식별
MinAmp 10ug 단일 읽기 225602 + / - 4952 65.48 + / - 2.58 47.61 + / - 0.53 0.62 + / - 0.06 8500
1ug T7LA 단일 읽기 144818 + / - 6513 82.21 + / - 6.45 48.09 + / - 0.27 0.42 + / - 0.03 8757
100ng T7LA 단일 읽기 27,385 + / - 1818 81.33 + / - 11.75 44.46 + / - 4.53 0.49 + / - 0.10 8709
10ng T7LA 단일 읽기 11,184 + / - 985 60.70 + / - 3.70 14.96 + / - 1.15 0.99 + / - 0.30 8589
1ng T7LA 단일 읽기 12,695 + / - 1365 53.27 + / - 16.76 4.08 + / - 0.79 2.25 + / - 1.56 4720
100pg T7LA 단일 읽기 10,390 + / - 1398 72.99 + / - 2.90 1.48 + / - 0.20 1.51 + / - 0.39 1121
MinAmp 10ug 이점 최종 R1 95,786 + / - 12937 90.77 + / - 2.79 58.50 + / - 0.95 0.94 + / - 0.38 9267
이점 최종 R2 95,786 + / - 12937 90.77 + / - 2.79 58.13 + / - 1.13 0.99 + / - 0.37
1ug T7LA 이점 최종 R1 297669 + / - 10196 91.35 + / - 0.36 46.​​89 + / - 0.14 0.47 + / - 0.01 7334
이점 최종 R2 297669 + / - 10196 91.35 + / - 0.36 45.52 + / - 0.12 0.51 + / - 0.01
100ng T7LA 이점 최종 R1 205602 + / - 9932 90.53 + / - 0.76 63.44 + / - 1.00 0.48 + / - 0.02 8011
이점 최종 R2 205602 + / - 9932 90.53 + / - 0.76 61.80 + / - 8.09 0.60+ / - 0.36
10ng T7LA 이점 최종 R1 214622 + / - 11155 89.98 + / - 1.13 56.32 + / - 1.94 0.80 + / - 0.26 7961
이점 최종 R2 214622 + / - 11155 89.98 + / - 1.13 46.​​41 + / - 18.39 2.48 + / - 2.68 ;
1ng T7LA 이점 최종 R1 144951 + / - 19841 90.54 + / - 1.19 3.91 + / - 0.16 8.71 + / - 0.86 8124
이점 최종 R2 144951 + / - 19841 90.54 + / - 1.19 3.27 + / - 1.21 9.11 + / - 3.52
100pg T7LA 이점 최종 R1 1876​​00 + / - 11759 89.52 + / - 1.11 1.78 + / - 0.05 13.42 + / - 0.50 6623
이점 최종 R2 1876​​00 + / - 11759 89.52 + / - 1.11 1.99 + / - 0.23 15.29 + / - 0.96

° R1과 R2는 앞으로 있으며 태그의 순서를 역방향
* ≥ 10 TPM

표 1. 유전자 식별 클러스터 번호에 대한 정보, 오류 비율, 단일 읽고 이점 엔드 라이브러리 %의 정렬.

보충 표 1. 모든 샘플에 대한 모든 유전자 및 TPM 값 목록은 단일 읽고 엔드 이점.

Disclosures

저자는 잣은 세포 역학 국제 (CDI)의 설립자, stockowner, 컨설턴트 및 이사회의 구성원임을 공개. 그는 또한 과학 고문 역할과 전술 II의 줄기 세포 벤처 금융 이익 있습니다.

Acknowledgments

이 작품은 연구와 위스콘신 재단의 대학 Morgridge 연구소의 자금 지원에 의해 지원되었다. 우리는 편집 지원 크리스타 이스트만 주셔서 감사합니다.

Materials

Name Company Catalog Number Comments
Fragmentation reagent Ambion AM8740
Liner Acrylamide Ambion AM9520
MEGAscript T7 Kit Ambion AM1334
Non DEPC treated nuclease free water Ambion AM9932
dNTP set Fermentas R0181
methylated dNTPs Fermentas R0431 For Single Read sample prep only
TruSeq SR Cluster Generation kit v5 Illumina GD-203-5001 For Single Read sample prep only
TruSeq Seq Kit v5 36 cycles Illumina FC-104-5001
Chip Seq Sample Prep Kit Illumina IP-102-1001 For Single Read sample prep only. Can be replaced with NEB DNA sample prep Master Mix Set 1 Cat# E6040S
TruSeq PE Cluster Generation kit v5 Illumina PE-203-5001 For paired end sample prep only
Paired End Sample Prep Kit Illumina PE-102-1001 For paired end sample prep only
1kb plus ladder Invitrogen 10787-018
E. coli Rnase H Invitrogen 18021-014
Rnase Out Invitrogen 10777-019
2nd strand buffer 5x Invitrogen 10812-014
E. coli DNA polymerase Invitrogen 18010-017
E-gel SYBR safe 2% Invitrogen G521802
Superscript III (with 5X FS buffer and 0.1M DTT) Invitrogen 18080-085
Trizol Invitrogen 12183555
RNA quibit assay kit Invitrogen Q32852
dsDNA HS qubit assay kit Invitrogen Q32851
E. coli DNA ligase Invitrogen 18052-019
T4 DNA Polymerase Invitrogen 18005-025
Ultra Pure Dnase Rnase water Invitrogen 10977-015
Superscript II double stranded cDNA synthesis kit Invitrogen 11917-020
Random Primer (invitrogen) Invitrogen 48190-011 For paired end sample prep only
Not1Nonamer B primer IDT N/A For Single Read sample prep only
Oligo dT T7 IDT N/A
Not1 digestion kit New England Biolabs R0189S For Single Read sample prep only
Rneasy Minelute kit Qiagen 74204
RNEasy Mini Kit (50) Qiagen 74104
Gel purification kit Qiagen 28604
Dnase set Qiagen 79254
Rneasy MinElute kit Qiagen 74204
DNA clean and concentrator (250X) Zymo Research Corp. D4014

DOWNLOAD MATERIALS LIST

References

  1. Tang, F., Barbacioru, C., Wang, Y., Nordman, E., Lee, C., Xu, N., Wang, X., Bodeau, J., Tuch, B. B., Siddiqui, A., Lao, K., Surani, M. A. mRNA-Seq whole-transcriptome analysis of a single cell. Nature Methods. 6, 377-382 (2009).
  2. Armour, C. D., Castle, J. C., Chen, R., Babak, T., Loerch, P., Jackson, S., Shah, J. K., Dey, J., Rohl, C. A., Johnson, J. M., Raymond, C. K. Digital transcriptome profiling using selective hexamer priming for cDNA synthesis. Nature Methods. 6, 647-649 (2009).
  3. Mortazavi, A., Williams, B. A., McCue, K., Schaeffer, L., Wold, B. Mapping and quantifying mammalian transcriptomes by RNA-Seq. Nature Methods. 5, 621-628 (2008).
  4. Mamanova, L., Andrews, R. M., James, K. D., Sheridan, E. M., Ellis, P. D., Langford, C. F., Ost, T. W., Collins, J. E., Turner, D. J. FRT-seq amplification-free, strand-specific transcriptome sequencing. Nature Methods. 5, 130-132 (2010).
  5. Sengupta, S., Ruotti, V., Bolin, J., Elwell, A., Hernandez, A., Thomson, J., Stewart, R. Highly consistent, fully representative mRNA-Seq libraries from ten nanograms of total RNA. Biotechniques. 49, 898-904 (2010).
  6. Langmead, B., Trapnell, C., Pop, M., Salzberg, S. L. Ultrafast and memory-efficient alignment of short DNA sequences to the human genome. Genome. Biology. 10, R25-R25 (2009).
  7. Li, B., Ruotti, V., Stewart, R. M., Thomson, J. A., Dewey, C. N. RNA-Seq gene expression estimation with read mapping uncertainty. Biotechniques. 26, 493-500 (2010).
  8. Thomson, J. A., Itskovitz-Eldor, J., Shapiro, S. S., Waknitz, M. A., Swiergiel, J. J., Marshall, V. S., Jones, J. M. Embryonic stem cell lines derived from human blastocysts. Science. 282, 1145-1147 (1998).
  9. mRNA-Seq-8 Sample Prep Kit [Internet]. Illumina. Available from: http://www.illumina.com/products/mrna_seq_8_sample_prep_kit.ilmn Forthcoming.
  10. ScriptSeq mRNA-Seq Library Preparation Kit (Illumina -compatible) Epicentre [Internet]. Epicenter. Available from: http://www.epibio.com/item.asp?id=578 Forthcoming.
10 나노 그램 총 RNA의 단일 읽기와 결합하여 최종 mRNA - Seq의 Illumina 도서관
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Sengupta, S., Bolin, J. M., Ruotti, V., Nguyen, B. K., Thomson, J. A., Elwell, A. L., Stewart, R. Single Read and Paired End mRNA-Seq Illumina Libraries from 10 Nanograms Total RNA. J. Vis. Exp. (56), e3340, doi:10.3791/3340 (2011).More

Sengupta, S., Bolin, J. M., Ruotti, V., Nguyen, B. K., Thomson, J. A., Elwell, A. L., Stewart, R. Single Read and Paired End mRNA-Seq Illumina Libraries from 10 Nanograms Total RNA. J. Vis. Exp. (56), e3340, doi:10.3791/3340 (2011).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter