Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Medicine

Оценка Тератогенные Изменения в модели данио рерио внутриутробного развития плода алкоголь

doi: 10.3791/3704 Published: March 20, 2012

Summary

Для того чтобы понять молекулярные механизмы этанол-индуцированного повреждения развития, мы разработали модель данио воздействие этанола и изучают физические, клеточном и генетические изменения, которые происходят после воздействия этанола

Abstract

Фетальный алкогольный синдром (ФАС) является серьезным проявлением эмбриональных воздействия этанола. В нем представлены с характерными дефектами лица и органы, в том числе умственная отсталость из-за неупорядоченных и повреждения развития мозга. Плод алкоголь спектр расстройств (FASD) это термин, используемый для покрытия континуум врожденные дефекты, которые возникают в связи с материнской потребления алкоголя, и встречается примерно у 4% детей, рожденных в Соединенных Штатах. С 50% в детородном возрасте женщины сообщив о потреблении алкоголя, а половина всех беременностей быть незапланированными, непреднамеренного воздействия является постоянной проблемой 2. Для того, чтобы лучше понять повреждения производства этанола, а также производить модель для тестирования возможных мер, мы разработали модель развития воздействия этанола помощью рыбок данио эмбриона. Данио рерио идеально подходят для такого рода исследований тератогенным 3-8. Каждая пара откладывает сотни яиц, которые затем могут быть собраны без ущерба для взрослыхрыбы. Данио эмбрион является прозрачным и может быть легко, полученную с использованием любого количества пятен. Анализ этих эмбрионов после воздействия этанола в разных дозах и времени продолжительности и применения показывает, что валовой пороки развития производства этанола в соответствии с человека врожденный дефект. Описанный здесь основные методы, используемые для изучения и управления данио модель ФАС.

Protocol

1. Этанол Лечение эмбрионов

  1. Эмбрионов данио рерио, полученные от дикого типа спаривания были подняты на 28 ° C в 5 мл воды эмбриона. (Milli-Q воды с 60 мг / л мгновенных океан). Различные штаммы дикого типа эмбрионы имеют немного разные допуски в этанол воздействия 9.
  2. Воздействие этанола было начато на купол этапе (~ 4,3 часа после оплодотворения, HPF) для нужного времени, до 24 импульсов в час. Это начальный этап примерно эквивалентно имплантации стадии эмбрионов млекопитающих, незадолго до гаструляции. Этанол концентраций, используемых в диапазоне от 0,2% -2,5%, объем / объем. Испытания показали, что 25-50% раствора в воде, попадает в развивающийся эмбрион 10, 11. Эмбрионы поддерживается на 28 ° C для требуемого периода времени. После нужной длины этанола экспозиции, этанола водный раствор удаляется и заменяется тремя моет регулярно воды данио и поддерживается лг желаемое время. Специфика дефекта зависит от времени начала, доза и длительность импульса этанола.

2. Коллекция эмбрионов для РНК, в гибридизация, антител и хряща Окрашивание

  1. Для сбора мРНК КПЦР, возраст соответствует эмбрионов собираются в пробирки Эппендорф. После удаления воды данио, лизис буфера TCEP добавляется. Моторизованный пульверизатора используется для физически отделить эмбрионы в лизис решение. Это затем пропускают через колонку преклира, который удаляет все недиссоциированных большие куски. Полученный раствор содержит все макромолекулы выпущен лизис процесса. РНК экстрагировали выполнения этого решения на колонке, а затем моет и ДНКазы лечения. Элюирование затем выполняется с помощью воды или элюирования решение, предоставленной производителем (5'-премьер). РНК может быть преобразован в кДНК с использованием стандартных методов КПЦР или использовать в микро-Массив анализа.
  2. Ибо в гибридизация и антител окрашивания, эмбрионы от 6 до 24 HPF были зафиксированы в 4% параформальдегид ночи при 4 ° C. Далее следуют 3 мойки в PBS + 0.1% Tween (PBT), чтобы сохранить эмбрионов от слипания. Эмбрионы, которые затем передаются через серию из 3 метанола: PBT моет на 100% метанола, после чего их можно хранить при температуре -20 ° C. Эти эмбрионы могут быть использованы для в гибридизация или антитела окрашивания. Некоторые антитела не будут работать после того, как метанол лечения, так что это предостережение должно быть принято во внимание и ваши специфические антитела испытания, чтобы определить будет ли он работать после того, как метанол лечения.
  3. Для окрашивания хряща, эмбрионы должны быть подняты до 5 или 6 дней после оплодотворения (DPF). Затем они фиксировали в 4% параформальдегид ночи при 4 ° C, а затем на 3 мойки в PBT.

3. Оценка этанол-индуцированного изменения экспрессии генов и последствий

    и гибридизация. КПЦР достигается с помощью праймеры ДНК со встроенным технологиям (IDT) программного обеспечения, а затем проверяются с помощью 3 отдельных биологических образцов. После грунтовки были утверждены, КПЦР осуществляется на кДНК создан из собранных образцов РНК. Каждый образец выполняется в трех экземплярах. ПЦР выполняются Платиновый SYBR Green КПЦР Супер смеси (Invitrogen) на Chroma-4 ПЦР машины (BioRad) или аналогичных машин ПЦР с системой обнаружения многоцветной. В дополнение к генам допрашивали, очень важно, чтобы управление набором праймеров используется, чтобы уравновесить небольшие различия в кДНК или РНК подготовки. Для наших эмбрионов данио рерио, мы используем GAPDH: 5'GAAGGTGGGAAACTGGTCAT3 и 5'TTGCACCACCCTTAATGTGA3. Гены анализируемых затем нормированы на GAPDH уровня относительной количественной оценки экспрессии генов рассчитывается Pfaffl изменение метода 2 12. Нормальный расчет предполагает, что все гены дублирования ДНК в два раза для каждого цикла, и, таким образом выражает данных как отношение изменения в экспериментальной генной за изменения в справочных ген, выраженная в мощности вычислений над целыми "2", , которая является эффективность удвоения ДНК на цикл видели в идеальном реакции ПЦР. Pfaffl метод заменяет общий "2" с экспериментатором порожденных истинной эффективности ПЦР-праймеры выбрали. Это отражает более точно отражает разницу в реакции ПЦР. Полная формула:
    (Эффективность экспериментальной генной) (КТ-контрольного образца Ct очищенной выборке)
    -------------------------------------------------- -----------------------------------
    (Эффективность ведения ген) (КТКонтрольный образец - Ct очищенной выборке)
  1. Ибо в гибридизация, дигоксигенин (DIG)-меченных riboprobes строятся из плазмиды, содержащие части гена. Возраст соответствием эмбрионы подвергаются riboprobes с использованием стандартных условиях 13 и регистрируется с помощью анти-антител раскопки связаны с щелочной фосфатазы, которая позволяет расположения меченых riboprobes помощью цветной реакции (NBT / BCIP). Эмбрионы затем визуализировать помощью микроскопа Leica рассечения (рис. 1В-G).
  2. Для оценки морфогенетических развития эмбрионов собираются в нужное время и рассматривается в соответствии с рассечения микроскопом. Для сомитов формы, живые эмбрионы отображаемого 14. Для расстояния между глаз и длина тела эмбрионов зафиксированы в PFA. Во всех случаях, образы желаемого региона, снятые на вскрытии микроскопом на увеличении фиксированной и измерений, проведенных с помощью Adobe Photoshop softwarE 10,14.
  3. Для изучения влияния лечения на разработку структуры хряща в личиночной данио рерио, мы используем Альциановый Синий окрашивания. Фиксированные личинки данио относятся с Альциановый синий раствор, растворенного в 80% этанола: 20% ледяной уксусной кислоты (кислоты спирта) в течение нескольких часов или на ночь. Личинки обесцвечивают в нескольких стирок кислоты алкоголь затем был переведен в 1% КОН: 3% раствор перекиси водорода для дальнейшей очистки пигментные клетки. Данио рерио должна быть не менее 4 дней, чтобы показать структуры хряща, и это лучше, определенных в рыбе, что 5 или 6 дней.
  4. Гибель клеток в живых эмбрионов оценивали с помощью акридинового оранжевого (АО). АО не клетки проницаемы для живых клеток, и связывается с ДНК в клетках с нарушением мембраны, в том числе апоптоза и некроза. Живые эмбрионы инкубировали с 5 мг / мл в АО PBS в течение 1 часа, затем на 3 мойки в PBS. Эмбрионы затем отображаемого помощью конфокальной микроскопии. Digital Z-Serх годов образы объединяются для создания композиционных материалов.

4. Управление данио рерио эмбрионов

  1. После идентификации генов, которые снизились на этанол экспозиции, можно попробовать заменить их с помощью инъекции РНК предназначен для замены недостающих генов. Capped мРНК транскрибируется с линеаризованной плазмиды ДНК с помощью РНК-полимеразы в пробирке комплекты транскрипции, в соответствии с инструкциями производителя (mMessage машина, Applied Biosystems). Между 25-200 пг / п РНК вводят в клетки 1-2 яйца этап данио, в растворе 0,1 М KCl. Эмбрионы затем позволили восстановиться, прежде чем рассматривать с этанолом, как описано выше (рис. 5).
  2. Для любого гена стенограмм, которые увеличились на этанол воздействия, они могут быть сокращены, или "разобранном" с использованием технологии антисмысловых морфолино. Антисмысловые morpholinos (AMOS) разработаны средства компании Джин, и блокирует перевод РНК в белок или Блоск созревание и сплайсинг РНК, в зависимости от экспериментальной необходимостью. Это действие morpholinos ограничить количество активного белка гена целевых, дефицит которого может быть измерена с помощью anitibodies если они имеются. Эффективность morpholinos РНК сплайсинга может быть измерена с помощью RT-PCR для выявления относительного количества сращенных и unspliced ​​стенограммы. Титрования в морфолино может привести к зависимости от дозы деятельности 15. AMOS разводят до рабочей концентрации (стр. титровать до нг концентрацию) в Danieau решение (58 мМ NaCl, 0,7 мМ KCl, 0,4 мМ MgSO 4, 0,6 мМ Ca (NO 3) 2, 5 HEPES мМ, рН 7,6). Инъекция происходит на 1-2-клеточной стадии, то эмбрионы позволили разработать до подвергается этанола лечение как указано выше.

5. Представитель Результаты

Данио воздействие на эмбрион этанола приводит в ряде развития и генетических дефектов, которые связаны сфенотипа в других позвоночных. Мы зафиксировали аномальное развитие осевых тканей, в том числе хорды (данные не представлены 14). Задержка в развитии производства этанола, по-видимому, приводит к нарушению надлежащего удлинение хорды, что привело к укороченным, а иногда нарушается хорды (данные не представлены 14). Эта ранняя задержка и хорды дефектов, которые могли приводит, в частности на более поздний отклонения в сомитов (рис. 2), которые потеряли свои сильные форме шеврона, как показано на необработанных контрольных, а ближе к П-образной сомитов характеристика фенотипов видно, когда звуковой сигнализации снижается 14. Угол сомитов можно измерить с помощью стандартного программного обеспечения, а угол увеличивается с 92,1 ± 4,6 ° в необработанных контрольных в 122,6 ± 6,6 ° в этанол рассматривается эмбрионов (р <0,001).

Другим следствием воздействия этанола, который может быть downstreaм ранней задержки развития, а затем хорды дефектов сокращенной длины эмбриона (рис. 3). Даже измерения эмбрионов с учетом кривизны производства этанола экспозиции, этанол воздействие приводит к укороченным стволом, который зависит от дозы этанола эмбрион подвергался (Рисунок 3E 14). Этот результат похож на сохранение prepuberty невысокого роста у детей подвергаются этанола в течение 16 развитию, 17, предполагая, что модель данио имеет важное значение для понимания человека врожденный дефект.

Один из классических характеристик ФАС является классическим фации, в том числе снижение челюсти, небольшое отверстие глаза, и гладкая перегородка. Большая часть этих функций, связанных с сокращением средней линии ткани. Это было продемонстрировано в моделях на животных, которые интенсивного воздействия этанола приводит к еще более выраженным фенотипом, в том числе и synopthalmia циклопия. Когда выставкапеть эмбрионов данио рерио на увеличение дозы этанола, внутриглазное расстояние (НОР) уменьшается в зависимости от дозы образом (рис. 4) в соответствии с природой человека врожденный дефект. Циклопия можно найти только в очень высоких дозах, но меньших дозах они производят значительное снижение НОР (рис. 4), предполагая, что это животное модель имеет аналогичный дефект средней линии лица развития 10.

Для того чтобы понять механизм, лежащий в основе дефектов, как в теле и лице производства этанола экспозиции, мы стремились создать экспрессии генов изменения, которые происходят на ранних стадиях развития, и что было бы разумно ожидать, чтобы способствовать позже пороки развития. Мы делаем это двумя способами, добыча мРНК из эмбрионов позволяет дать количественную оценку уровня экспрессии гена в этанол рассматривается эмбрионов по сравнению с контролем (рис. 1А). Кроме того, мы можем выполнить на местегибридизации, чтобы посмотреть на структуру генов, независимо от того, или нет сигнала уменьшается (рис. 1В-G 18). В этом примере двух генов, экспрессия которых снижается после воздействия этанола показано, gli1 и six3b. Когда мы изучили на месте шаблона для six3b, мы нашли снижение пространственной протяженности экспрессии этого гена (рис. 1 EG) в эмбрионы подвергаются этанола. Аналогичное снижение было обнаружено в гене GSC (рис. BD). Оба six3b и GSC выражены в тканях суждено способствовать черепно-лицевых тканей средней линии. Таким образом, сокращение этих генов в 8 HPF согласуется с сокращением НОР найдены позже, как показано на рисунке 4.

Как только гены, которые влияют на этанол определены, существуют механизмы, с помощью которых выражение из них может быть увеличена или уменьшена. В данном EXAmple, мы показали, 2 гена, которые снизились (gli1 и six3b) по КПЦР. Мы решили придать мРНК, чтобы определить, вспять этих генов изменения могут улучшить результаты. Для этого эксперимента, а не инъекционным gli1, мы решили придать Тсс, лиганд, который увеличивает gli1 уровнях. Для six3b, мы смогли внедрить six3b себя. Мы не нашли никаких изменений, когда мы вводили six3b (данные не приведены), но и смогли принципиально спасти крупных дефектов у эмбрионов данио рерио с дополнительными Тсс инъекций (рис. 5).

Рисунок 1
Рисунок 1. Этанол воздействие изменяет ранний образец и экспрессии генов уровня развития выбранных генов. А) КПЦР результаты эмбрионов на 8hpf. Результаты для двух генов отображаются: six3b и gli1. Результаты показали, как среднее из трех отдельных экспериментах,и доза этанола показано составляет 2,5%. Оба гена снижается таким образом, что является значительным с контролем (т-тест, р <0,05). BG) в гибридизация 8 эмбрионов данио HPF. Оба РКГ и six3b модели изменяются в это время точка по сравнению с контрольной группой. (Изменения с разрешения Лукс и соавт., 2007).

Рисунок 2
Рисунок 2. Сегменты развития меняется в обработанных эмбрионов. Сегменты структуры и углов рассматриваются в 48 HPF. В контрольных эмбрионов (А), сомитов имеют форму шеврона и под острым углом. Этанол подвергается данио больше I-или П-образной сомитов, и меньше острых углов. (Изменения с разрешения Лукс и Ahlgren 2009).

Рисунок 3
Рисунок 3. Этанол лечения значительно уменьшается длина тела у рыбок данио.Длина необработанного и этанола, подвергшихся воздействию эмбрионов были измерены функции организма крыс на 5 дней. Значительное сокращение длины видели во всех рассматриваться эмбрионов (ANOVA, р <0,001). BD. Был небольшой, но значительное снижение общей длиной эмбрионов лечение с 1,0% и 1,5% этанола, в то время как большее снижение наблюдалось в эмбрионы вводили 2,0% и 2,5% этанола. Е. Чтобы контролировать размер различий в каждой кладке, контрольных эмбрионов для каждого эксперимента были нормированы на 100, а брат обработанных эмбрионов, выраженное в процентах из 100. (Изменения с разрешения Лукс и Ahlgren 2009).

Рисунок 4
Рисунок 4. Этанол воздействие приводит к снижению внутриглазного расстояние (йод) у эмбрионов данио рерио. А) фронтальная вид эмбрионов продемонстрировать нормальный фенотип и плавленого глаз. B) Различные дозы этанола вводят в течение 3 часов во время гаструляции разрешенияULTS снижению йод, когда рыба рассматривается через 24 часа. Плавленый глаза и циклопия видели только на самом высоком дозе (2,4%). * Означает значительное снижение йод сравнению с контрольной группой. (Изменение с разрешения Ahlgren, 2004).

Рисунок 5
Рисунок 5. Тсс-N мРНК инъекции спасает крупных дефектов производства этанола воздействия данио. Один-два эмбриона клетки вводили 100 пг / п тсс-N мРНК и половину вводят эмбрионы подвергались стандартной дозы этилового спирта от 4,3 до 24 HPF. Эмбрионы были проанализированы на 5 DPF. Эмбрионы относиться с 2,0% этанола демонстрируют сверху изогнутые короткие хвосты, я форму сомитов, а глаза дефекты, включая циклопия. Спасение этих фенотипов наблюдается в 71/76 введенных эмбрионов (93%). В этих эмбрионов, тело прямое, сомитов являются шеврон формы, и глаза полностью разделены.

Discussion

Методы, описанные здесь, и результаты, показанные продемонстрировать лишь верхушка того, как данио рерио могут быть использованы для допроса пороки развития. Из-за доступности эмбриона, большое количество яиц, отложенных для каждого сцепление и высокую воспроизводимость результатов этих позвоночных являются идеальным решением для тератогенных исследованиях. Рыба также можно манипулировать, чтобы содержать флуоресцентных молекул для использования в качестве визуального репортер отдельного гена или путь интерес 19. В этаноле исследований дозах появляются довольно высока по сравнению с уровнем млекопитающих алкоголя в крови. Тем не менее, эти уровни отражают то, что присутствует в воде, и не все из этанола доставляется в зародыше.

Взятые вместе, методы, описанные выше и подробно показывают, что у эмбрионов данио рерио очень полезны для моделирования человеческих врожденных дефектов, связанных с воздействием этанола. Кроме того, изменения экспрессии генов находятся в данио были подтверждены другимиВ млекопитающих модель 20, что свидетельствует о развитии эффекты этанола сохраняются через позвоночных. Многие из методов было показано выше может быть использована с другими экологическими или фармацевтических оскорбления быстро и легко обнаружить потенциальную тератогенами и определить основные механизмы, которые способствуют тератогенез конкретного вещества.

Disclosures

Нам нечего раскрывать.

Acknowledgments

Мы хотели бы поблагодарить Монте Westerfield, Макото Кобаяси и Яцек Topczewski для подарков плазмид для в гибридизация и мРНК микроинъекций. Мы благодарны Стеф Эрхард за появление в видео. Мы также хотели бы выразить признательность за помощь Уильяма Гуссенс с конфокальной микроскопии показано на видео. Тайлер Schwend условии изображения, используемые в видео, и Родни Дейл помощь в подготовке к видео. Мы также признаем CMRC персонала для ухода за животными своего хозяйства работе с данио. Эта работа финансировалась NIH грант R21 AA13596 в SCA.

Materials

Name Company Catalog Number Comments
Tissue RNA kit: 5-Prime PerfectPure Fisher Scientific FP2302410
Platinum SYBR green qPCR SuperMix-UDG Invitrogen 11733038
mMessage mMachine high yield capped RNA transcription kit Applied Biosystems Depends on the RNA polymerase in your plasmid

DOWNLOAD MATERIALS LIST

References

  1. Streissguth, A. P. Fetal alcohol syndrome in adolescents and adults. Jama. 265, (15), 1961-1967 (1991).
  2. Floyd, R. L. Observations from the CDC. Preventing alcohol-exposed pregnancies among women of childbearing age: the necessity of a preconceptional approach. J. Womens Health Gend. Based Med. 8, (6), 733-736 (1999).
  3. Ali, S. Large-scale analysis of acute ethanol exposure in zebrafish development: a critical time window and resilience. PLoS One. 6, (5), e20037-e20037 (2011).
  4. Dlugos, C. A., Rabin, R. A. Structural and functional effects of developmental exposure to ethanol on the zebrafish heart. Alcohol Clin. Exp. Res. 34, (6), 1013-1021 (2010).
  5. Fernandes, Y., Gerlai, R. Long-term behavioral changes in response to early developmental exposure to ethanol in zebrafish. Alcohol Clin. Exp. Res. 33, (4), 601-609 (2009).
  6. Bilotta, J. Effects of embryonic exposure to ethanol on zebrafish visual function. Neurotoxicol. Teratol. 24, (6), 759-766 (2002).
  7. Tanguay, R. L., Reimers, M. J. Analysis of ethanol developmental toxicity in zebrafish. Methods Mol. Biol. 447, 63-74 (2008).
  8. Blader, P., Strahle, U. Ethanol impairs migration of the prechordal plate in the zebrafish embryo. Dev. Biol. 201, (2), 185-201 (1998).
  9. Loucks, E., Carvan, M. J. 3rd, Strain-dependent effects of developmental ethanol exposure in zebrafish. Neurotoxicol. Teratol. 26, (6), 745-755 (2004).
  10. Ahlgren, S. C. Molecular Mechanisms of Fetal Alcohol Syndrome: Shh-signaling. Comprehensive Handbook of Alcohol Related Pathology. Preedy, V. (2004).
  11. Reimers, M. J., Flockton, A. R., Tanguay, R. L. Ethanol- and acetaldehyde-mediated developmental toxicity in zebrafish. Neurotoxicol. Teratol. 26, (6), 769-781 (2004).
  12. Pfaffl, M. W. A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res. 29, (9), 45-45 (2001).
  13. Jowett, T. Tissue in situ hybridization: methods in animal development. John Wiley & Sons. New York. 128-128 (1997).
  14. Loucks, E. J., Ahlgren, S. C. Deciphering the role of Shh signaling in axial defects produced by ethanol exposure. Birth Defects Res. A. Clin. Mol. Teratol. 86, 556-567 (2009).
  15. Schwend, T. Requirement of Npc1 and availability of cholesterol for early embryonic cell movements in zebrafish. J. Lipid Res. 52, (7), 1328-1344 (2011).
  16. Spohr, H. L., Willms, J., Steinhausen, H. C. Fetal alcohol spectrum disorders in young adulthood. J. Pediatr. 150, (2), 175-179 (2007).
  17. Strauss, R. S. Effects of the intrauterine environment on childhood growth. Br. Med. Bull. 53, (1), 81-95 (1997).
  18. Loucks, E. J., Schwend, T., Ahlgren, S. C. Molecular changes associated with teratogen-induced cyclopia. Birth Defects Res. A. Clin. Mol. Teratol. 79, (9), 642-651 (2007).
  19. Schwend, T., Loucks, E. J., Ahlgren, S. C. Visualization of Gli activity in craniofacial tissues of hedgehog-pathway reporter transgenic zebrafish. PLoS One. 5, (9), 14396-14396 (2011).
  20. Chrisman, K. Gestational ethanol exposure disrupts the expression of FGF8 and Sonic hedgehog during limb patterning. Birth Defects Res. A. Clin. Mol. Teratol. 70, (4), 163-171 (2004).
Оценка Тератогенные Изменения в модели данио рерио внутриутробного развития плода алкоголь
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Loucks, E., Ahlgren, S. Assessing Teratogenic Changes in a Zebrafish Model of Fetal Alcohol Exposure. J. Vis. Exp. (61), e3704, doi:10.3791/3704 (2012).More

Loucks, E., Ahlgren, S. Assessing Teratogenic Changes in a Zebrafish Model of Fetal Alcohol Exposure. J. Vis. Exp. (61), e3704, doi:10.3791/3704 (2012).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter