Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Medicine

भ्रूण शराब एक्सपोजर Zebrafish मॉडल में teratogenic परिवर्तन का आकलन

doi: 10.3791/3704 Published: March 20, 2012

Summary

आदेश में इथेनॉल प्रेरित विकास के नुकसान की आणविक तंत्र को समझने के लिए, हम इथेनॉल जोखिम का एक zebrafish मॉडल विकसित किया है और शारीरिक, सेलुलर, और आनुवंशिक परिवर्तन है कि इथेनॉल प्रदर्शन के बाद होने की खोज कर रहे हैं

Abstract

भ्रूण शराब सिंड्रोम (FAS) इथेनॉल के लिए भ्रूण जोखिम के एक गंभीर अभिव्यक्ति है. यह चेहरे और अंगों, अव्यवस्थित और क्षतिग्रस्त मस्तिष्क के विकास के कारण मानसिक मंदता सहित विशेषता दोष के साथ प्रस्तुत करता है. भ्रूण शराब स्पेक्ट्रम विकार (FASD) एक जन्म दोष है कि मातृ शराब की खपत के कारण होते हैं की एक continuum को कवर करने के लिए शब्द का प्रयोग किया जाता है, और संयुक्त राज्य अमेरिका में पैदा हुए बच्चों में से लगभग 4% में होता है. बच्चे पैदा करने की उम्र की महिलाओं की 50% शराब की खपत रिपोर्टिंग, और सभी गर्भधारण के आधा अनियोजित जा रहा है के साथ, बिना किसी खास उद्देश्य के जोखिम एक सतत अंक 2 है. आदेश में सबसे अच्छा इथेनॉल द्वारा उत्पादित क्षति को समझने के लिए, साथ ही साथ जो संभावित उपायों का परीक्षण करने के लिए एक मॉडल का उत्पादन, हम विकास इथेनॉल zebrafish भ्रूण का उपयोग जोखिम के एक मॉडल विकसित किया है. Zebrafish अपरूपजनन 3-8 अध्ययन के इस प्रकार के लिए आदर्श हैं. प्रत्येक जोड़ी में अंडे के सैकड़ों देता है, जो तो वयस्क चोट के बिना एकत्र किया जा सकता हैमछली. zebrafish भ्रूण पारदर्शी है और आसानी से दाग के किसी भी संख्या के साथ imaged किया जा सकता है. इन भ्रूण के विश्लेषण के बाद अलग अवधि और आवेदन शो की खुराक और समय पर इथेनॉल के लिए जोखिम है कि सकल विकास इथेनॉल द्वारा उत्पादित दोष मानव जन्म दोष के साथ संगत कर रहे हैं. यहाँ वर्णित बुनियादी तकनीक का अध्ययन करने और zebrafish FAS के मॉडल में हेरफेर करने के लिए इस्तेमाल किया.

Protocol

1. भ्रूण की इथेनॉल उपचार

  1. Zebrafish भ्रूण जंगली प्रकार matings से व्युत्पन्न 28 में उठाया गया ° भ्रूण पानी की 5 मिलीलीटर में सी. (मिल्ली क्यू 60 मिलीग्राम / एल तुरंत महासागर के साथ पानी). जंगली प्रकार के भ्रूण के विभिन्न प्रकारों से थोड़ा अलग जोखिम इथेनॉल 9 tolerances है.
  2. इथेनॉल के लिए एक्सपोजर गुंबद (~ 4.3 घंटे के बाद निषेचन, HPF) मंच पर समय के वांछित लंबाई के लिए शुरू किया गया था, 24 घंटा नाड़ी. इस आरंभिक चरण मोटे तौर पर, बस gastrulation से पहले स्तनधारी भ्रूण आरोपण चरण के लिए बराबर है. इथेनॉल सांद्रता से लेकर 0.2% -2.5% / मात्रा और मात्रा का इस्तेमाल किया. टेस्ट प्रदर्शन किया है कि पानी में समाधान की 25-50% के बीच विकासशील भ्रूण 10, 11 में समाप्त होता है. भ्रूण समय की लंबाई के लिए वांछित 28 ° C पर रखा जाता है. इथेनॉल जोखिम के वांछित लंबाई के बाद, समाधान इथेनॉल से पानी निकाल दिया है और जगह नियमित zebrafish पानी की तीन washes के साथ और के लिए बनाए रखाआर समय की इच्छित लंबाई. दोष की विशिष्टता शुरुआत, खुराक, और इथेनॉल की नाड़ी की लंबाई के समय पर निर्भर करता है.

2. स्वस्थानी संकरण, एंटीबॉडी, और उपास्थि धुंधला में शाही सेना के लिए भ्रूण का संग्रह,

  1. QPCR के लिए mRNA के इकट्ठा करने के लिए, उम्र मिलान भ्रूण Eppendorf ट्यूबों में एकत्र कर रहे हैं. , Zebrafish पानी निकालने के बाद lysis बफर TCEP साथ जोड़ा जाता है. एक motorized भुरभुरीकारी को शारीरिक रूप से सेल के समाधान में भ्रूण को अलग कर देना करने के लिए प्रयोग किया जाता है. यह तो एक preclear स्तंभ, जो किसी भी undissociated बड़े टुकड़ों को हटा के माध्यम से पारित कर दिया है. जिसके परिणामस्वरूप समाधान सभी lysis प्रक्रिया जारी अणुओं शामिल हैं. आरएनए तो एक स्तंभ पर इस समाधान चल रहा है, washes और DNase उपचार के बाद निकाला जाता है. क्षालन तो या तो पानी या एक प्रोद्धावन (5'-प्रधानमंत्री) निर्माता द्वारा प्रदान समाधान का उपयोग किया जाता है. शाही सेना के सीडीएनए करने के लिए परिवर्तित किया जा सकता है qPCR के लिए मानक तकनीक का उपयोग कर या सूक्ष्म में इस्तेमाल कियासरणी विश्लेषण.
  2. HPF के लिए स्वस्थानी संकरण और एंटीबॉडी धुंधला, 6 करने के लिए 24 से भ्रूण में 4% रातोंरात paraformaldehyde में 4 डिग्री सेल्सियस पर तय किया गया यह पीबीएस में 3 washes के + 0.1% (पीबीटी) के बीच, एक साथ चिपके से भ्रूण रखने के द्वारा पीछा किया जाता है. भ्रूण तो 3 मेथनॉल की एक श्रृंखला के माध्यम से स्थानांतरित कर रहे हैं: पीबीटी 100% मेथनॉल में washes, जो बिंदु पर वे -20 डिग्री सेल्सियस पर भंडारित किया जा सकता है इन भ्रूण में स्वस्थानी संकरण या एंटीबॉडी धुंधला के लिए इस्तेमाल किया जा सकता है. कुछ एंटीबॉडी, मेथनॉल उपचार के बाद तो इस चेतावनी को ध्यान में रखा जाना है और अपने विशिष्ट एंटीबॉडी निर्धारित करने के लिए अगर यह मेथनॉल उपचार के बाद काम करेंगे परीक्षण की जरूरत है काम नहीं करते.
  3. उपास्थि धुंधला के लिए, भ्रूण के लिए 5 या 6 दिनों के बाद निषेचन (DPF) उठाया जाना चाहिए. वे तो 4 बजे 4% रातोंरात paraformaldehyde में तय डिग्री सेल्सियस, पीबीटी में 3 washes के द्वारा पीछा किया.

3. का आकलन इथेनॉल प्रेरित जीन एक्सप्रेशन परिवर्तन और विकास के परिणाम

    स्वस्थानी संकरण में जांच कर रहे हैं. qPCR एकीकृत डीएनए (IDT) सॉफ्टवेयर, तो 3 अलग जैविक नमूने का उपयोग कर पुष्टि के साथ डिजाइन प्राइमरों का प्रयोग कर प्राप्त किया जाता है. एक बार प्राइमरों मान्य किया गया है, qPCR शाही सेना के नमूने एकत्र से बनाया सीडीएनए पर किया जाता है. प्रत्येक नमूना तीन प्रतियों में चलाया जाता है. Chroma-4 पीसीआर (BioRad) के एक बहुरंगा पहचान प्रणाली के साथ या इसी तरह की पीसीआर मशीन मशीन पर पीसीआर प्रतिक्रियाओं का प्लेटिनम SYBR ग्रीन qPCR सुपर मिश्रण (Invitrogen) चलाए जा रहे हैं. पूछताछ की जा रही जीन के अलावा, यह महत्वपूर्ण है कि एक प्राइमरों के सेट नियंत्रण सीडीएनए या शाही सेना की तैयारी में छोटे मतभेदों को संतुलित करने के लिए प्रयोग किया जाता है. हमारे zebrafish भ्रूण के लिए, हम GAPDH का उपयोग करें: 5'GAAGGTGGGAAACTGGTCAT3 'और' 5'TTGCACCACCCTTAATGTGA3. जीन का विश्लेषण किया तो GAPDH स्तर को सामान्य जीन अभिव्यक्ति के रिश्तेदार मात्रा का ठहराव पर 2 Pfaffl विधि परिवर्तन का उपयोग कर की गणना है 12 प्रकार के सापेक्ष में गुना अंतर के रूप में डेटा प्रदर्शित. सामान्य गणना मान लिया है कि सभी जीनों के डीएनए duplicating के हर चक्र के लिए दो बार, और इस प्रकार के संदर्भ जीन में परिवर्तन पर प्रयोगात्मक जीन में परिवर्तन की एक अनुपात के रूप में डेटा को व्यक्त करता है, पूर्णांक "2" से अधिक बिजली गणना के रूप में व्यक्त की, जो एक आदर्श पीसीआर प्रतिक्रिया में देखा चक्र प्रति डीएनए के दोहरीकरण की दक्षता है. Pfaffl विधि पीसीआर चुना प्राइमरों के लिए सही दक्षता उत्पन्न experimenter के साथ सामान्य "2" की जगह है. यह पीसीआर प्रतिक्रियाओं में अंतर का एक और अधिक सटीक प्रतिबिंब को दर्शाता है. पूर्ण सूत्र है:
    (प्रयोगात्मक जीन की क्षमता) (नियंत्रण की सीटी इलाज नमूना नमूना सीटी)
    -------------------------------------------------- -----------------------------------
    (संदर्भ जीन की क्षमता) (सीटीनियंत्रण नमूना इलाज नमूना की सीटी)
  1. स्वस्थानी संकरण में के लिए, digoxigenin (खुदाई)-लेबल riboprobes, हित के जीन की भाग युक्त plasmids से निर्माण कर रहे हैं. आयु मिलान भ्रूण मानक 13 शर्तों का उपयोग riboprobes को उजागर कर रहे हैं और विरोधी खुदाई alkaline फॉस्फेट जो लेबल riboprobes रंग प्रतिक्रिया (/ एनबीटी BCIP है) का उपयोग कर का स्थान की अनुमति देता है युग्मित एंटीबॉडी का उपयोग कर पाया. भ्रूण तो एक Leica विदारक माइक्रोस्कोप (चित्रा 1 बी जी) का उपयोग कर कल्पना कर रहे हैं.
  2. Morphogenic विकास का आकलन करने के लिए, भ्रूण वांछित समय में एकत्र कर रहे हैं और विदारक माइक्रोस्कोप के तहत जांच की. विखंड आकार के लिए, जीना भ्रूण 14 imaged किया कर रहे हैं. अंतर नेत्र दूरी और शरीर की लंबाई के लिए, भ्रूण पीएफए ​​में तय कर रहे हैं. सभी मामलों में वांछित क्षेत्र की छवियों को एक निश्चित बढ़ाई और माप लिया पर एक विदारक माइक्रोस्कोप Adobe Photoshop softwar का उपयोग पर कब्जा कर रहे हैं10,14 ई.
  3. लार्वा zebrafish में विकासशील उपास्थि संरचनाओं पर उपचार के प्रभाव की जांच करने के लिए, हम Alcian ब्लू धुंधला का उपयोग करें. कई घंटे या रातोंरात के लिए 20% ग्लेशियल एसिटिक अम्ल (एसिड शराब): निश्चित zebrafish लार्वा Alcian नीला 80% इथेनॉल में भंग समाधान के साथ व्यवहार कर रहे हैं. लार्वा पहले एक 1% KOH के लिए हस्तांतरित किया जा रहा है एसिड शराब के कई washes में destained हैं: रंगद्रव्य कोशिकाओं के आगे समाशोधन के लिए 3% हाइड्रोजन पेरोक्साइड समाधान. Zebrafish के लिए कम से कम 4 उपास्थि संरचनाओं को दिखाने के लिए पुराने दिनों की जरूरत है, और इन मछली है कि 5 या 6 दिन पुराने हैं बेहतर में परिभाषित कर रहे हैं.
  4. कोशिका मृत्यु में रहने वाले भ्रूण acridine नारंगी (ए ओ) का उपयोग मूल्यांकन किया है. ए ओ जीवित कोशिकाओं के लिए पारगम्य सेल, नहीं है, और apoptosis और परिगलन के दौर से गुजर उन सहित समझौता झिल्ली, के साथ कोशिकाओं में डीएनए को बांधता है. जहाँ रहते हैं भ्रूण 5 मिलीग्राम / - पीबीएस में मिलीलीटर ए ओ के साथ 1 घंटे के लिए incubated हैं, पीबीएस में 3 washes के द्वारा पीछा किया. भ्रूण तो confocal सूक्ष्मदर्शी का उपयोग imaged किया कर रहे हैं. Z सेवा डिजिटलएँ छवियों के लिए कंपोजिट बनाने के लिए संयुक्त रहे हैं.

4. Zebrafish भ्रूण से छेड़छाड़

  1. जीन की पहचान जो इथेनॉल जोखिम से कम कर रहे हैं के बाद, यह संभव है करने के लिए उन्हें बदलने के लापता जीन को बदलने के लिए डिज़ाइन mRNA का इंजेक्शन का उपयोग करने की कोशिश. छाया mRNA के के linearized डीएनए इन विट्रो प्रतिलेखन किट में शाही सेना पोलीमरेज़ का उपयोग प्लास्मिड से लिखित है निर्माताओं के निर्देशों (mMessage मशीन, एप्लाइड Biosystems) के अनुसार,. / 25-200 के बीच शाही सेना के nl स्नातकोत्तर 1-2 सेल चरण zebrafish अंडे में इंजेक्शन 0.1 एम KCl की एक समाधान में. भ्रूण तो इथेनॉल के साथ इलाज किया जा रहा है के रूप में ऊपर (चित्रा 5) में वर्णित से पहले ठीक करने के लिए अनुमति दी जाती है.
  2. किसी भी जीन टेप कि इथेनॉल जोखिम की वृद्धि हुई हैं, वे, कम किया जा सकता है या खटखटाया नीचे एक antisense morpholino प्रौद्योगिकी का उपयोग कर. Antisense morpholinos (Amos) जीन उपकरण कंपनी द्वारा डिजाइन किए हैं, और प्रोटीन में शाही सेना के अनुवाद ब्लॉक, या bloसी.के. परिपक्वता और शाही सेना splicing है, प्रयोगात्मक की आवश्यकता पर निर्भर करता है. Morpholinos की इस कार्रवाई लक्षित जीन, एक घाटा जो anitibodies का उपयोग कर मापा जा सकता है अगर वे उपलब्ध हैं के लिए सक्रिय प्रोटीन की मात्रा की सीमा. शाही सेना splicing morpholinos की दक्षता RT-पीसीआर का उपयोग करने के लिए spliced ​​और unspliced ​​टेप के रिश्तेदार मात्रा का पता लगाने में मापा जा सकता है. Titrating morpholino की खुराक पर निर्भर 15 गतिविधि में परिणाम कर सकते हैं. अमोस में काम कर रहे सांद्रता Danieau समाधान (एनजी एकाग्रता स्नातकोत्तर titrated) के (58 मिमी NaCl, 0.7 मिमी KCl, 0.4 मिमी 4 MgSO, 0.6 मिमी Ca (3 सं) 2, 5 मिमी HEPES के, 7.6 पीएच) को पतला कर रहे हैं. इंजेक्शन चरण 1-2-सेल में जगह लेता है, तो भ्रूण उपचार के रूप में ऊपर से इथेनॉल के अधीन किया जा रहा से पहले विकसित करने के लिए अनुमति दी जाती है.

5. प्रतिनिधि परिणाम

Zebrafish भ्रूण विकास और आनुवंशिक दोष है कि करने के लिए जुड़े हुए हैं की एक संख्या में इथेनॉल परिणाम के लिए जोखिमphenotypes अन्य रीढ़ में पाया. हम अक्षीय ऊतकों की असामान्य विकास पृष्ठदंड (डेटा से पता चला 14 नहीं) सहित दस्तावेज है. विकास इथेनॉल द्वारा उत्पादित देरी जाहिरा तौर पर उचित पृष्ठदंड बढ़ाव के विघटन के लिए होता है, एक छोटा और कभी कभी बाधित पृष्ठदंड (डेटा से पता चला 14 नहीं) के लिए अग्रणी. यह जल्दी देरी और पृष्ठदंड दोष की संभावना भाग में somites में बाद में असामान्यताएं (चित्रा 2), जो उनके मजबूत शहतीर आकार खो दिया है के रूप में अनुपचारित नियंत्रण में देखा जाता है, और U-आकार phenotypes की विशेषता somites देखा जब करीब हैं ध्वनि संकेत 14 कम है. कोण somites की मानक सॉफ्टवेयर, और 92.1 से 4.6 ± ° अनुपचारित नियंत्रण में 122.6 के लिए इथेनॉल का इलाज भ्रूण (पी 0.001 <) में ± 6.6 ° कोण बढ़ जाती है का उपयोग करके मापा जा सकता है.

इथेनॉल जोखिम के एक और परिणाम कि downstrea हो सकता हैजल्दी विकासात्मक देरी और बाद में पृष्ठदंड दोष मीटर भ्रूण का एक छोटा लंबाई (चित्रा 3) है. भले ही भ्रूण को लेने के लिए खाते में इथेनॉल जोखिम द्वारा उत्पादित की वक्रता को मापने, इथेनॉल जोखिम एक छोटा ट्रंक है कि भ्रूण को उजागर किया गया था इथेनॉल की खुराक पर निर्भर करता है (चित्र 14 3E) की ओर जाता है. यह निष्कर्ष इथेनॉल के लिए 16 विकास, 17 के दौरान उजागर बच्चों में पाया prepuberty कम कद के हठ के समान है, सुझाव है कि zebrafish मॉडल मानव जन्म दोष की समझ के लिए प्रासंगिक है.

FAS के क्लासिक विशेषताओं में से एक कम जबड़ा, छोटे आंख खोलने, और एक चिकनी philtrum सहित क्लासिक मुखाकृति, है. इन सुविधाओं के बहुत midline के ऊतकों में कमी करने के लिए संबंधित हैं. यह पशु मॉडल में प्रदर्शन किया गया है कि गंभीर इथेनॉल जोखिम synopthalmia और मध्यनेत्रता सहित और भी अधिक स्पष्ट phenotypes, की ओर जाता है. एक्सपो जबइथेनॉल की वृद्धि की खुराक लेने के लिए zebrafish भ्रूण गाते हैं, intraocular दूरी (IOD) एक खुराक निर्भर फैशन में घट जाती है (चित्रा 4) मानव जन्म दोष की प्रकृति के अनुरूप है. मध्यनेत्रता बहुत ही उच्च खुराक के साथ पाया जाता है, लेकिन कम मात्रा IOD (चित्रा 4) में एक महत्वपूर्ण कमी का उत्पादन करते हैं, सुझाव है कि इस पशु मॉडल midline चेहरे 10 विकास में एक समान दोष है.

आदेश में दोनों शरीर और चेहरे इथेनॉल जोखिम से उत्पादित में दोष अंतर्निहित तंत्र को समझने के लिए, हम जीन अभिव्यक्ति में परिवर्तन है कि विकास में जल्दी होते हैं और कि काफी बाद में विकास संबंधी दोषों में योगदान की उम्मीद हो सकती है की स्थापना की मांग की. हम दो तरीकों से इस करते हैं, भ्रूण से mRNA का निष्कर्षण इथेनॉल इलाज भ्रूण में जीन अभिव्यक्ति के स्तर नियंत्रण (चित्रा 1 ए) की तुलना में एक मात्रात्मक मूल्यांकन के लिए अनुमति देता है. इसके अलावा, हम बगल में प्रदर्शन कर सकते हैंसंकरण जीन की तर्ज पर देखने के लिए, की परवाह किए बिना कि क्या है या नहीं संकेत (चित्रा 18 1B - जी) की कमी हुई है. इस उदाहरण में, दो जीन जिनकी अभिव्यक्ति है इथेनॉल के लिए प्रदर्शन के बाद कम दिखाया गया है, GLI1 और six3b. जब हम six3b के लिए स्वस्थानी पैटर्न में जांच की, हम इथेनॉल के लिए संपर्क में भ्रूण में इस जीन की अभिव्यक्ति के स्थानिक हद तक (1 चित्रा ईजी) में कमी मिला. इसी तरह की कमी जीन GSC (चित्रा बी) में पाया गया. दोनों six3b और GSC ऊतकों लिए craniofacial midline के ऊतकों के लिए योगदान करने के लिए किस्मत में व्यक्त कर रहे हैं. तो 8 HPF में इन जीनों की कमी के बाद के रूप में चित्रा 4 में दिखाया पाया IOD में कमी के साथ संगत है.

एक बार जीन है कि इथेनॉल से प्रभावित कर रहे हैं की पहचान कर रहे हैं, वहाँ तंत्र है जिसके द्वारा उन की अभिव्यक्ति या बढ़ाया जा सकता है की कमी हुई हैं. इस विशेष exa मेंmple, हम qPCR द्वारा 2 जीन है कि घट रहे हैं (GLI1 और six3b) से पता चला है. हम mRNA के इंजेक्षन करने के लिए निर्धारित अगर इन जीन परिवर्तन के पीछे परिणामों में सुधार कर सकते हैं चुना. इस प्रयोग के लिए, GLI1 इंजेक्शन लगाने के बजाय, हम श, एक ligand है कि GLI1 स्तर बढ़ता है इंजेक्षन करने के लिए चुना. Six3b के लिए, हम खुद six3b इंजेक्षन करने में सक्षम थे. हम कोई बदलाव नहीं जब हम six3b के (नहीं दिखाया डेटा) इंजेक्शन लेकिन मौलिक पूरक इंजेक्शन (चित्रा 5) के साथ zebrafish भ्रूण में सकल दोषों बचाव करने में सक्षम थे पाया.

चित्रा 1
आंकड़ा इथेनॉल 1. जोखिम जल्दी पैटर्न और जीन चयनित विकास के जीन की अभिव्यक्ति के स्तर में परिवर्तन. ) एक भ्रूण के लिए 8hpf पर qPCR परिणाम. six3b और GLI1: दो जीन के लिए परिणाम प्रदर्शित कर रहे हैं. परिणाम तीन अलग प्रयोगों की औसत के रूप में दिखाया गया है,और इथेनॉल की खुराक दिखाया 2.5% है. दोनों जीन एक तरह से है कि नियंत्रण (टी परीक्षण, पी <0.05) से महत्वपूर्ण है कम कर रहे हैं. बड़ी 8 HPF zebrafish भ्रूण की स्वस्थानी संकरण में). दोनों GSC और six3b पैटर्न के इस समय बिंदु पर नियंत्रण की तुलना में बदल रहे हैं. (Loucks एट अल 2007. से अनुमति के साथ संशोधित).

चित्रा 2
चित्रा 2. विखंड विकास इलाज भ्रूण में बदल दिया है. विखंड संरचना और कोण 48 HPF पर जांच कर रहे हैं. नियंत्रण भ्रूण में (ए), somites एक शहतीर आकार के और एक तेज कोण है. इथेनॉल उजागर zebrafish अधिक मैं या यू के आकार का somites, और कम तेज कोण है. (Loucks और Ahlgren 2009 के से अनुमति के साथ संशोधित).

चित्रा 3
चित्रा 3. इथेनॉल उपचार काफी zebrafish में शरीर की लंबाई कम हो जाती है.अनुपचारित और इथेनॉल उजागर भ्रूण की लंबाई 5 दिन postfertilization में मापा गया. लंबाई में एक महत्वपूर्ण कमी सभी इलाज भ्रूण में देखा गया था (एनोवा, पी 0.001 <). बी.डी.. भ्रूण की कुल लंबाई 1.0% और 1.5% इथेनॉल के साथ इलाज में एक मामूली लेकिन महत्वपूर्ण कमी थी, जबकि एक बड़ी कमी 2.0% और 2.5% इथेनॉल के साथ dosed भ्रूण में देखा गया था. प्रत्येक क्लच आकार में अंतर के लिए नियंत्रण ई., एक प्रयोग के लिए नियंत्रण भ्रूण 100 के लिए सामान्य थे, और भाई का इलाज भ्रूण 100 के प्रतिशत के रूप में व्यक्त की है. (Loucks और Ahlgren 2009 के से अनुमति के साथ संशोधित).

चित्रा 4
चित्रा 4 इथेनॉल zebrafish भ्रूण में intraocular दूरी (iod) में कमी के जोखिम में परिणाम. ) एक भ्रूण के ललाट दृश्य सामान्य और इनकार आँख phenotypes प्रदर्शित करता है. बी) इथेनॉल की खुराक भिन्न gastrulation रेस के दौरान 3 घंटे के लिए प्रशासितमें ults iod कमी हुई जब मछली 24 घंटे बाद की जांच कर रहे हैं. इनकार आँखें और मध्यनेत्रता केवल उच्चतम परीक्षण (2.4%) खुराक पर देखा जाता है. * नियंत्रण की तुलना में iod में एक महत्वपूर्ण कमी को दर्शाता है. (Ahlgren, 2004 से अनुमति के साथ संशोधित).

चित्रा 5
संख्या 5. MRNA के श एन इंजेक्शन zebrafish की जोखिम से इथेनॉल का उत्पादन सकल दोषों को बचाता है. 100 / स्नातकोत्तर nl mRNA के श - एन और इंजेक्शन भ्रूण के आधे से 4,3 करने के लिए 24 HPF के से मानक इथेनॉल खुराक से अवगत कराया गया एक दो सेल भ्रूण के साथ अंतःक्षिप्त थे. यह भ्रूण 5 DPF पर विश्लेषण किया गया. भ्रूण 2.0% इथेनॉल के साथ इलाज के पीछे की ओर छोटी पूंछ, मैं के आकार somites, और मध्यनेत्रता सहित नेत्र दोष घुमावदार प्रदर्शन. इन phenotypes का बचाव 71/76 इंजेक्शन भ्रूण (93%) में देखा जाता है. इन भ्रूण में शरीर को सीधे है, somites शहतीर के आकार का है, और आँखों को पूरी तरह से अलग हो रहे हैं.

Discussion

तरीके यहाँ वर्णित और दिखाया परिणाम सिर्फ कैसे zebrafish विकास दोष पूछताछ के लिए इस्तेमाल किया जा सकता है टिप प्रदर्शित करता है. भ्रूण की पहुंच की वजह से, प्रत्येक क्लच, और परिणामों के उच्च reproducibility के लिए रखी अंडे की उच्च संख्या, इन रीढ़ teratogenic अध्ययन के लिए आदर्श होते हैं. मछली भी फ्लोरोसेंट अणु होते हैं एक विशेष जीन या 19 हित के मार्ग के लिए एक दृश्य के संवाददाता के रूप में उपयोग करने के लिए चालाकी से किया जा सकता है. इथेनॉल अध्ययन में इस्तेमाल खुराक काफी स्तनधारी रक्त शराब के स्तर की तुलना में उच्च दिखाई देते हैं. हालांकि, इन स्तरों को प्रतिबिंबित क्या पानी में मौजूद है, और नहीं सभी इथेनॉल के भ्रूण के लिए दिया जाता है.

साथ में ले ली, और वर्णित ऊपर विस्तृत तरीकों का सुझाव है कि zebrafish भ्रूण मानव जन्म इथेनॉल जोखिम से संबंधित दोषों को मॉडलिंग में बहुत उपयोगी हैं. इसके अलावा, जीन अभिव्यक्ति परिवर्तन zebrafish में पाया दूसरों के द्वारा पुष्टि की गई हैस्तनधारी मॉडल 20 प्रणाली, सुझाव है कि इथेनॉल का विकास प्रभाव रीढ़ भर में बनाए रखा जाता है. प्रदर्शन के ऊपर तकनीकों के कई अन्य पर्यावरण या दवा अपमान के साथ इस्तेमाल किया जा सकता है जल्दी और आसानी से संभावित teratogens के पता लगाने के लिए और अंतर्निहित तंत्र है कि एक विशेष पदार्थ की teratogenesis के लिए योगदान निर्धारित है.

Disclosures

हम खुलासा करने के लिए कुछ भी नहीं है.

Acknowledgments

हम स्वस्थानी संकरण और mRNA के microinjections में plasmids के उपहार के लिए मोंटे Westerfield, Makoto Kobayashi और Jacek Topczewski के के लिए धन्यवाद करना चाहता हूँ. हम वीडियो में प्रदर्शित होने के लिए से Steph Erhard के लिए आभारी हैं. हम भी वीडियो में दिखाया गया confocal माइक्रोस्कोपी के साथ विलियम Goossens की सहायता को स्वीकार करने की इच्छा. टायलर SCHWEND वीडियो में इस्तेमाल किया छवियों को प्रदान की है, और रॉडने डेल वीडियो के लिए तैयारी के साथ सहायता प्रदान की. हम भी उनके zebrafish साथ खेती - किसानी काम के लिए CMRC जानवरों की देखभाल के कर्मचारियों को स्वीकार करते हैं. यह काम एससीए के लिए NIH अनुदान AA13596 R21 द्वारा वित्त पोषित किया गया.

Materials

Name Company Catalog Number Comments
Tissue RNA kit: 5-Prime PerfectPure Fisher Scientific FP2302410
Platinum SYBR green qPCR SuperMix-UDG Invitrogen 11733038
mMessage mMachine high yield capped RNA transcription kit Applied Biosystems Depends on the RNA polymerase in your plasmid

DOWNLOAD MATERIALS LIST

References

  1. Streissguth, A. P. Fetal alcohol syndrome in adolescents and adults. Jama. 265, (15), 1961-1967 (1991).
  2. Floyd, R. L. Observations from the CDC. Preventing alcohol-exposed pregnancies among women of childbearing age: the necessity of a preconceptional approach. J. Womens Health Gend. Based Med. 8, (6), 733-736 (1999).
  3. Ali, S. Large-scale analysis of acute ethanol exposure in zebrafish development: a critical time window and resilience. PLoS One. 6, (5), e20037-e20037 (2011).
  4. Dlugos, C. A., Rabin, R. A. Structural and functional effects of developmental exposure to ethanol on the zebrafish heart. Alcohol Clin. Exp. Res. 34, (6), 1013-1021 (2010).
  5. Fernandes, Y., Gerlai, R. Long-term behavioral changes in response to early developmental exposure to ethanol in zebrafish. Alcohol Clin. Exp. Res. 33, (4), 601-609 (2009).
  6. Bilotta, J. Effects of embryonic exposure to ethanol on zebrafish visual function. Neurotoxicol. Teratol. 24, (6), 759-766 (2002).
  7. Tanguay, R. L., Reimers, M. J. Analysis of ethanol developmental toxicity in zebrafish. Methods Mol. Biol. 447, 63-74 (2008).
  8. Blader, P., Strahle, U. Ethanol impairs migration of the prechordal plate in the zebrafish embryo. Dev. Biol. 201, (2), 185-201 (1998).
  9. Loucks, E., Carvan, M. J. 3rd, Strain-dependent effects of developmental ethanol exposure in zebrafish. Neurotoxicol. Teratol. 26, (6), 745-755 (2004).
  10. Ahlgren, S. C. Molecular Mechanisms of Fetal Alcohol Syndrome: Shh-signaling. Comprehensive Handbook of Alcohol Related Pathology. Preedy, V. (2004).
  11. Reimers, M. J., Flockton, A. R., Tanguay, R. L. Ethanol- and acetaldehyde-mediated developmental toxicity in zebrafish. Neurotoxicol. Teratol. 26, (6), 769-781 (2004).
  12. Pfaffl, M. W. A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res. 29, (9), 45-45 (2001).
  13. Jowett, T. Tissue in situ hybridization: methods in animal development. John Wiley & Sons. New York. 128-128 (1997).
  14. Loucks, E. J., Ahlgren, S. C. Deciphering the role of Shh signaling in axial defects produced by ethanol exposure. Birth Defects Res. A. Clin. Mol. Teratol. 86, 556-567 (2009).
  15. Schwend, T. Requirement of Npc1 and availability of cholesterol for early embryonic cell movements in zebrafish. J. Lipid Res. 52, (7), 1328-1344 (2011).
  16. Spohr, H. L., Willms, J., Steinhausen, H. C. Fetal alcohol spectrum disorders in young adulthood. J. Pediatr. 150, (2), 175-179 (2007).
  17. Strauss, R. S. Effects of the intrauterine environment on childhood growth. Br. Med. Bull. 53, (1), 81-95 (1997).
  18. Loucks, E. J., Schwend, T., Ahlgren, S. C. Molecular changes associated with teratogen-induced cyclopia. Birth Defects Res. A. Clin. Mol. Teratol. 79, (9), 642-651 (2007).
  19. Schwend, T., Loucks, E. J., Ahlgren, S. C. Visualization of Gli activity in craniofacial tissues of hedgehog-pathway reporter transgenic zebrafish. PLoS One. 5, (9), 14396-14396 (2011).
  20. Chrisman, K. Gestational ethanol exposure disrupts the expression of FGF8 and Sonic hedgehog during limb patterning. Birth Defects Res. A. Clin. Mol. Teratol. 70, (4), 163-171 (2004).
भ्रूण शराब एक्सपोजर Zebrafish मॉडल में teratogenic परिवर्तन का आकलन
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Loucks, E., Ahlgren, S. Assessing Teratogenic Changes in a Zebrafish Model of Fetal Alcohol Exposure. J. Vis. Exp. (61), e3704, doi:10.3791/3704 (2012).More

Loucks, E., Ahlgren, S. Assessing Teratogenic Changes in a Zebrafish Model of Fetal Alcohol Exposure. J. Vis. Exp. (61), e3704, doi:10.3791/3704 (2012).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter