Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Medicine

הערכת שינויים teratogenic במודל דג הזברה של חשיפה אלכוהול עוברית

doi: 10.3791/3704 Published: March 20, 2012

Summary

כדי להבין את המנגנונים המולקולריים של אתנול הנזק הנגרמת התפתחותית, פיתחנו מודל של דג הזברה חשיפה אתנול בוחנים את פיזיים, שינויים הסלולר, וגנטיים המתרחשות לאחר החשיפה אתנול

Abstract

תסמונת אלכוהול עוברית (FAS) הוא ביטוי חמור של חשיפה עוברית על אתנול. הוא מציג עם מומים האופייניים על הפנים איברים, כולל פיגור שכלי עקב התפתחות המוח ועל סדר פגום. ספקטרום אלכוהול עוברית הפרעה (FASD) הוא מונח המשמש לכיסוי רצף של מומים מולדים המתרחשות עקב צריכת אלכוהול של האם, ומופיע כ -4% מהילדים שנולדו בארצות הברית. עם 50% הפוריות לנשים בגיל דיווח על צריכת אלכוהול, ומחצית ההריונות להיות מתוכנן, חשיפה לא מכוונת הוא נושא מתמשך 2. על מנת להבין בצורה הטובה ביותר את הנזק המיוצר על ידי אתנול, ובנוסף לייצר מודל שבאמצעותו אפשר לבדוק התערבויות פוטנציאליות, פיתחנו מודל של חשיפה באמצעות אתנול התפתחותית עובר דג הזברה. דג הזברה הם אידיאליים עבור סוג זה של מחקר teratogen 3-8. כל זוג מטילה מאות ביצים, אז מה שיכול להיות שנאספו מבלי לפגוע הבוגרתדגים. עובר דג הזברה שקוף ניתן הדמיה בקלות עם כל מספר של כתמים. ניתוח של עוברים אלה לאחר חשיפה אתנול במינון ובזמנים שונים של משך מראה כי יישום הליקויים ההתפתחותיים ברוטו אתנול המיוצר על ידי עולים בקנה אחד עם מום הלידה האנושית. שתוארו כאן הם הטכניקות הבסיסיות המשמשות ללמוד ולטפל מודל FAS דג הזברה.

Protocol

1. אתנול טיפול של עוברים

  1. עוברי דג הזברה הנגזרות wild-type הזדווגויות הועלו על 28 מעלות צלזיוס ב 5 מ"ל של מים העובר. (מילי-Q מים עם 60 מ"ג / ל 'אושן מיידית). זנים שונים של wild-type עוברים יש טולרנסים שונים מעט אתנול חשיפה 9.
  2. חשיפה אתנול יזמה בשלב הכיפה (~ 4.3 שעות הפריה הודעה, hpf) לאורך הרצוי של זמן, עד הדופק 24 שעות. שלב זה מתחיל שווה בערך בשלב השתלת עוברים יונקים, בדיוק לפני gastrulation. ריכוזי אתנול המשמש נע בין 0.2% -2.5%, נפח / נפח. בדיקות הוכיחו כי בין 25-50% של פתרון במים בסופו של העובר המתפתח 10, 11. העוברים נשמרים על 28 מעלות צלזיוס לאורך הרצוי של זמן. לאחר באורך הרצוי של חשיפה אתנול, הפתרון אתנול מים מוסר והוחלפו שלוש שטיפות של מים דג הזברה קבוע ומתוחזק FOr האורך הרצוי של זמן. סגוליות של פגם תלוי בזמן התפרצות, המינון, ואת משך הדופק של אתנול.

2. אוסף של עוברים על RNA, הכלאה של נוגדן באתרו, ו מכתים סחוס

  1. לאסוף את ה-mRNA של QPCR, עוברים מתאימים לגיל נאספים צינורות eppendorf. לאחר הוצאת המים דג הזברה, מאגר תמוגה עם TCEP הוא הוסיף. מרסס ממונע המשמש פיזית לנתק את העוברים בתמיסה תמוגה. זה מועבר דרך העמודה הפרקליר, אשר מסיר את כל חתיכות גדולות undissociated. הפתרון שהתקבל מכיל את כל מקרומולקולות שפורסמו על ידי תהליך תמוגה. RNA מופק מכן על ידי הפעלת הפתרון הזה על עמוד, ואחריו שוטף וטיפול DNAse. Elution מתבצע מכן שימוש או מים או פתרון elution המסופק על ידי היצרן (5'-הממשלה). RNA ניתן להמיר cDNA תוך שימוש בטכניקות מקובלות QPCR או להשתמש מיקרומערך ניתוח.
  2. שכן ההכלאה באתרם מכתים נוגדנים, עוברים מ 6-24 hpf נקבעו ב paraformaldehyde 4% בין לילה ב 4 ° C. זה ואחריו 3 שוטף ב PBS + 0.1% tween (PBT), כדי לשמור על עוברי יידבקו זה לזה. העוברים מועברים דרך סדרה של מתנול 3: PBT שוטף לתוך מתנול 100%, ובשלב זה הם יכולים להיות מאוחסנים ב -20 ° C. עוברים אלו יכולים לשמש ב ההכלאה באתרם או מכתים נוגדנים. נוגדנים מסוימים לא עובדים לאחר הטיפול מתנול, כך אזהרה זו צריך לקחת בחשבון הנוגדן הספציפי שלך נבדקו כדי לקבוע אם זה יעבוד לאחר הטיפול מתנול.
  3. עבור מכתים סחוס, עוברים צריך לעלות ל הפריה ימים 5 או 6 פוסט (DPF). הם קבועים אז 4 ב paraformaldehyde 4% בין לילה ° C, ואחריו 3 שוטף של PBT.

3. הערכת אתנול המושרה ביטוי גנים שינויים התפתחותיים והשלכות

    על הכלאה באתרה. QPCR מושגת באמצעות פריימרים המיועדים משולב עם ה-DNA טכנולוגיות (IDT) תוכנה, תוקף מכן באמצעות 3 דגימות ביולוגיות נפרדות. לאחר primers אומתו, QPCR מבוצע על cDNA נוצר מן הדוגמאות שנאספו RNA. מדגם זה מתנהל בשלושה עותקים. PCR תגובות מנוהלים פלטינום SYBR גרין QPCR סופר מיקס (Invitrogen) על מכונת ה-PCR Chroma-4 (BioRad) או דומה המכונה PCR עם מערכת זיהוי ססגוניות. בנוסף הגנים בחקירה, זה קריטי, כי השליטה קבוצה של primers משמש לאזן הבדלים קטנים לקראת cDNA או RNA. עבור עוברי דג הזברה שלנו, אנו משתמשים gapdh: 5'GAAGGTGGGAAACTGGTCAT3 'ו 5'TTGCACCACCCTTAATGTGA3 ". הגנים שאנו מנתחים הם מנורמל אז לרמות gapdh כימות היחסי של ביטוי גנים מחושב לפי שיטת וריאציה Pfaffl על 2 12. החישוב מבוסס על ההנחה כי הגנים רגיל כל שכפול ה-DNA פעמיים בכל מחזור, ובכך מבטא את הנתונים כיחס בין השינוי בגן הניסוי על שינוי בגן התייחסות, כפי שבאה לידי ביטוי חישובים Power over שלם "2", המהווה את היעילות של הכפלת ה-DNA בכל מחזור ראיתי בתגובה PCR מושלמת. שיטת Pfaffl מחליף את "2" גנרי עם הנסיין באופן היעילות האמיתית primers PCR הנבחר. היא משקפת השתקפות מדויקת יותר של ההבדל בין PCR תגובות. הנוסחה המלאה היא:
    (יעילות של גן ניסויי) (CT של השליטה מדגם-CT מדגם מטופלים)
    -------------------------------------------------- -----------------------------------
    (יעילות של הגן הפניה) (CT שלמדגם שליטה - CT של מדגם מטופלים)
  1. שכן ההכלאה באתרו, digoxigenin (חפירה), שכותרתו riboprobes בנויים פלסמידים המכילים חלקים של הגן של עניין. גיל מתאימים עוברים נחשפים riboprobes באמצעות תנאים סטנדרטיים 13 ו לאתר באמצעות נוגדנים נגד וחופרים מצמידים את phosphatase בסיסי המאפשר את מיקום riboprobes שכותרתו באמצעות תגובת צבע (NBT / BCIP). הם עוברים אז דמיינו באמצעות מיקרוסקופ הלייקה לנתח (איור 1 ב-G).
  2. כדי להעריך את ההתפתחות morphogenic, עוברים נאספים בזמן הרצוי ובחן תחת מיקרוסקופ לנתח. עבור הצורה somite, עוברים חיים הם צילמו 14. על המרחק בין העין ואורך הגוף, עוברים קבועים ב PFA. בכל מקרה, תמונות של האזור הרצוי נלכדים על מיקרוסקופ לנתח בהגדלה מדידות קבוע נלקחו באמצעות Adobe Photoshop softwarה 10,14.
  3. כדי לבחון את ההשפעות של הטיפול על מבנה הסחוס מתפתחות דג הזברה הזחל, אנו משתמשים מכתים כחול Alcian. הזחלים דג הזברה קבוע מטופלים עם פתרון כחול Alcian מומס באתנול 80%: 20% חומצה אצטית קרחונית (חומצה אלכוהול) במשך כמה שעות או לילה. הזחלים הם destained ב שוטף כמה אלכוהול חומצה לפני שהועבר KOH 1%: 3% מי חמצן פתרון סליקה נוסף של תאים פיגמנט. דג הזברה צריך להיות לפחות 4 פעם להראות מבני הסחוס, ואלה מוגדרים טוב יותר דגים כי הם 5 או 6 ימים.
  4. מותם של תאים העוברים החיים נבחנת באמצעות Acridine אורנג' (AO). AO הוא לא התא חדיר לתאים חיים, נקשר ל-DNA בתאים עם ממברנות שנפרצו, כולל אלה שעברו אפופטוזיס ו נמק. החיים עוברים מודגרת עם 5 מ"ג / מ"ל ​​AO ב PBS שעה 1, ואחריו 3 שוטף ב PBS. עוברים אז הם צילמו באמצעות מיקרוסקופ confocal. Digital Z-serתמונות IES משולבים ליצירת חומרים מרוכבים.

4. מניפולציה העובר דג הזברה

  1. לאחר זיהוי של גנים אשר ירדו כתוצאה מחשיפה אתנול, ניתן לנסות להחליף אותם באמצעות הזרקת mRNA שנועדה להחליף את הגן החסר. MRNA כתרים הוא עיבד מ-DNA פלסמידים לינארית באמצעות RNA פולימראז של ערכות שעתוק במבחנה, על פי הוראות היצרן (mMessage מכונה, יישומי Biosystems). בין 25-200 pg / NL של RNA מוזרק בשלב 1-2 ביצים סלולריים דג הזברה, בתמיסה של 0.1 מ 'KCl. עוברים מותר אז להתאושש לפני שטופלו אתנול כמתואר לעיל (איור 5).
  2. לכל תעתיקי גנים אשר עלתה החשיפה אתנול, הם יכולים להיות מופחת או "דפק למטה" באמצעות הטכנולוגיה morpholino antisense. Antisense morpholinos (עמוס) מתוכננים על ידי כלי ין החברה, ולחסום את התרגום של רנ"א לחלבון, או bloCK ההתבגרות של שחבור רנ"א, בהתאם לצורך הניסוי. פעולה זו של morpholinos להגביל את כמות החלבון הפעיל של הגן ממוקד, גירעון אשר ניתן למדוד באמצעות anitibodies אם הם זמינים. היעילות של שחבור רנ"א morpholinos ניתן למדוד באמצעות RT-PCR כדי לזהות את הסכומים היחסיים של תמלילי שזורה unspliced. Titrating של morpholino יכול לגרום לפעילות תלויה במינון 15. עמוס הם בדילול לריכוזים עבודה (טיטרציה PG ריכוז ng) ב Danieau פתרון (58 mM NaCl, KCl 0.7 מ"מ, 0.4 מ"מ MgSO 4, 0.6 מ"מ Ca (NO 3) 2, 5 HEPES מ"מ, ה-pH 7.6). הזרקת מתרחשת בשלב 1-2 תאים, אז עוברים מותר לפתח לפני נתון אתנול הטיפול לעיל.

5. נציג תוצאות

עובר דג הזברה החשיפה לתוצאות אתנול מספר מומים התפתחותיים וגנטיים הקשוריםפנוטיפים את המצוי בבעלי חוליות אחרים. יש לנו תיעוד התפתחות לא תקינה של רקמות צירית, כולל notochord (מידע לא מוצג 14). עיכוב התפתחותי בהפקת אתנול כנראה מוביל שיבוש התארכות notochord הנכון, המוביל notochord מקוצרת ושיבשה מדי פעם (מידע לא מוצג 14). עיכוב זה מוקדם פגם notochord סביר מוביל בין השאר על ליקויים בהמשך somites (איור 2), אשר איבדו את הצורה שלהם חזקה שברון כמו לראות את הפקדים שלא טופלו, והם קרוב יותר בצורת somites האופייניים פנוטיפים לראות כאשר איתות קולי מופחת 14. זווית של somites יכולים להימדד באמצעות תוכנה רגילה, עולה זווית מ 92.1 ± 4.6 מעלות בקבוצת הביקורת שלא טופלו עד 122.6 ± 6.6 מעלות את העוברים אתנול שטופלו (P <0.001).

תוצאה נוספת של חשיפת אתנול שעשוי להיות downstreaמ 'של עיכוב התפתחותי מוקדם, מאוחר יותר פגמים notochord הוא אורך מקוצרת של העובר (תרשים 3). גם מדידת עוברים לקחת בחשבון את עקמומיות אתנול המיוצר על ידי חשיפה, חשיפה אתנול מוביל המטען קיצר זה תלוי במינון של אתנול העובר נחשף (איור 3E 14). ממצא זה דומה התמדה בעל שיעור קומה prepuberty קצר מצאו אצל ילדים שנחשפו אתנול במהלך 16 פיתוח, 17, טוען כי המודל דג הזברה הוא רלוונטי להבנת פגם לידה האנושי.

אחד המאפיינים הקלאסיים של FAS הוא מספר facies קלאסיים, כולל לסת מופחת, פתיחת העין קטן, philtrum חלקה. רוב התכונות הללו קשורות לירידה ברקמות קו האמצע. הוכח במודלים של בעלי חיים כי חשיפה אתנול חמור מוביל פנוטיפים מודגש עוד יותר, כולל synopthalmia ו cyclopia. כאשר Expoלשיר עוברי דג הזברה למנות גבוהות של אתנול, המרחק התוך עיני (IOD) מפחיתה באופן תלוי מינון (איור 4) עולה בקנה אחד עם אופיו של הפגם הלידה האנושית. Cyclopia נמצא רק עם מינונים גבוהים מאוד, אך במינונים נמוכים מייצרים הפחתה משמעותית של IOD (איור 4), טוען כי מודל זה בעל חיים יש פגם דומה בפיתוח פנים קו האמצע 10.

על מנת להבין את המנגנון שמאחורי הפגמים בגוף וגם בפנים המיוצר על ידי חשיפה אתנול, ביקשנו להקים ביטוי גנים השינויים המתרחשים בתחילת פיתוח שעשוי סביר שצפוי לתרום ליקויים התפתחותיים מאוחר יותר. אנו עושים זאת בשתי דרכים, מיצוי של mRNA מעוברים מאפשר הערכה כמותית של רמות של ביטוי גנים העוברים אתנול שטופלו בהשוואה לקבוצת הביקורת (איור 1 א). כמו כן, אנו יכולים לבצע באתרוההכלאה להסתכל על דפוס של גנים, ללא קשר לשאלה אם האות יורדת (איור 1 ב-G 18). בדוגמה זו, שני גנים, אשר הביטוי הוא ירד לאחר חשיפה אתנול מוצגים, gli1 ו six3b. כאשר בדקנו את דפוס באתרו של six3b, מצאנו הפחתה בהיקף המרחבי של הביטוי של גן זה (איור 1 למשל) עוברי חשופים אתנול. ירידה דומה נמצאה GSC גן (איור BD). שניהם six3b ו GSC באים לידי ביטוי ברקמות שנועדו לתרום רקמות Craniofacial קו האמצע. אז הפחתה של הגנים האלה ב hpf 8 עולה בקנה אחד עם הפחתת IOD נמצא מאוחר יותר כפי שמוצג באיור 4.

ברגע גנים המושפעים אתנול מזוהים, יש מנגנונים שבאמצעותם ביטוי מהם ניתן להגדיל או להקטין. ב exa המסוים הזהmple, הראינו 2 גנים אשר ירדה (gli1 ו six3b) על ידי QPCR. בחרנו להזריק mRNA כדי לקבוע אם להפוך את השינויים האלה גנים יכול לשפר את התוצאות. לצורך ניסוי זה, במקום הזרקת gli1, בחרנו להזריק ששש, ליגנד המגביר gli1 רמות. עבור six3b, היינו יכולים להזריק six3b עצמו. מצאנו שינויים כאשר אנו הזריק six3b (מידע לא מוצג), אך הצליחו להציל מן היסוד את הפגמים ברוטו עוברי דג הזברה עם משלים ששש זריקות (איור 5).

איור 1
1. איור חשיפה אתנול משנה את דפוס מוקדם ביטוי גנים רמות של גנים התפתחותיים שנבחרו. א) QPCR תוצאות עבור עוברים על 8hpf. התוצאות עבור שני גנים מוצגים: six3b ו gli1. תוצאות כפי שמוצג ממוצע של שלושה ניסויים נפרדים,והמנה של אתנול שתופיע היא 2.5%. שני גנים מופחתים באופן משמעותי מן הביקורת (מבחן t, p <0.05). BG) על הכלאה באתרו של 8 עוברים hpf דג הזברה. שניהם GSC דפוסי six3b משתנים בשלב זה הזמן בהשוואה לביקורות. (שינוי באישור Loucks et al. 2007).

איור 2
2. איור פיתוח Somite משתנה עוברי שטופלו. מבנה Somite וזוויות נבחנים על hpf 48. עוברי שליטה (א '), somites יש צורה שברון ואת זווית חדה. דג הזברה אתנול חשופים יש זוויות I-U או בצורת somites, וחד פחות יותר. (שינוי באישור Loucks ו Ahlgren 2009).

איור 3
איור 3. טיפול אתנול מפחית באופן משמעותי את אורך הגוף של דג הזברה.אורך של עוברים שלא טופלו ואתנול חשוף נמדדו postfertilization 5 ימים. הפחתה משמעותית של אורך היה לראות את כל העוברים טיפול (ANOVA, p <0.001). BD. היתה ירידה קלה אך משמעותית באורך כולל של עוברי שטופלו 1.0% ואתנול 1.5%, לעומת ירידה גדולה יותר היה לראות עוברים שבה עירבב 2.0% ואתנול 2.5%. א 'כדי לשלוט על ההבדלים בגודל של המצמד אחד, עוברים בקרה של כל ניסוי היה תקין עד 100, ו עוברים אחים שטופלו מבוטא באחוזים מתוך 100. (שינוי באישור Loucks ו Ahlgren 2009).

איור 4
איור 4. חשיפה אתנול גורמת לירידה מרחוק תוך עיני (iod) עוברי דג הזברה. א) צפיות הקדמיות של עוברי להפגין פנוטיפים עיניים נורמליים התמזגו. ב) מינונים שונים של אתנול מנוהל במשך 3 שעות במהלך מיל gastrulationאולטס ירד ב iod כאשר דגים נבחנים 24 שעות מאוחר יותר. העיניים התמזגו ו cyclopia נראים רק במינון הגבוה ביותר שנבדק (2.4%). * מציין הפחתה משמעותית של iod בהשוואה לביקורות. (שונה באישור Ahlgren, 2004).

איור 5
איור 5. ששש-N הזרקת mRNA מציל את הליקויים ברוטו אתנול המיוצר על ידי חשיפה של דג הזברה. אחת ושתיים עוברים התאים הוזרקו mRNA 100 ששש-N pg / NL וחצי של עוברי הזריק נחשפו על מינונים סטנדרטיים של אתנול hpf 4.3-24. עוברים נותחו ב DPF 5. עוברים שטופלו אתנול 2.0% התערוכה עקום dorsally זנבות קצרים יותר, אני בצורת somites, ופגמים עיניים כולל cyclopia. הצלת פנוטיפים אלה בא לידי ביטוי 71/76 של עוברים הזריק (93%). עוברי אלה, הגוף ישר, somites הם שברון בצורת, והעיניים מופרדים לחלוטין.

Discussion

בשיטות שתוארו כאן את התוצאות המוצגות להוכיח רק קצה איך דג הזברה יכול לשמש כדי לחקור ליקויים התפתחותיים. בגלל הנגישות של העובר, מספר גבוה של ביצים על המצמד כל אחד, שחזור גבוהה של התוצאות, חוליות אלה הם אידיאליים עבור מחקרים טרטוגניות. הדג יכול גם לטפל להכיל מולקולות ניאון להשתמש ככתב חזותית גן מסוים או מסלול של ריבית 19. במחקרים אתנול, במינונים המשמשים נראה די גבוה לעומת רמות אלכוהול בדם יונקים. עם זאת, רמות אלה משקפים את מה נמצא בתוך המים, ולא כל אתנול מועבר לעובר.

יחדיו, בשיטות המתוארות ו כמפורט לעיל עולה כי עוברי דג הזברה הם שימושיים מאוד בדוגמנות מומים מולדים אדם הקשורים לחשיפה אתנול. יתר על כן, הביטוי של גנים השינויים שנמצאו דג הזברה אושרו על ידי אחריםבמערכות מודל יונקים 20, טוען כי השפעת ההתפתחות של אתנול נשמרות על פני החוליות. רבים טכניקות הפגינו לעיל ניתן להשתמש עם עלבונות סביבתיים או תרופות אחרות על מנת לאתר בקלות ובמהירות teratogens פוטנציאליים ולקבוע את המנגנונים התורמים teratogenesis של חומר מסוים.

Disclosures

אין לנו מה למסור.

Acknowledgments

אנו רוצים להודות מונטה ווסטרפילד, מקוטו קוביאשי ו יאצק Topczewski על המתנות של פלסמידים שכן ההכלאה באתרם microinjections mRNA. אנו מודים סטף ארהרד עבור המופיע בסרטון. כמו כן, אנו רוצים להודות סיוע של ויליאם Goossens עם מיקרוסקופיה confocal רואים בסרט. טיילר שוונד סיפק תמונות בשימוש וידאו, ואת רודני דייל סייעה לקראת וידאו. כמו כן, אנו מודים לצוות CMRC טיפול בבעלי חיים לעבודה עם בעלי דג הזברה. עבודה זו מומנה על ידי מענק NIH R21 AA13596 כדי SCA.

Materials

Name Company Catalog Number Comments
Tissue RNA kit: 5-Prime PerfectPure Fisher Scientific FP2302410
Platinum SYBR green qPCR SuperMix-UDG Invitrogen 11733038
mMessage mMachine high yield capped RNA transcription kit Applied Biosystems Depends on the RNA polymerase in your plasmid

DOWNLOAD MATERIALS LIST

References

  1. Streissguth, A. P. Fetal alcohol syndrome in adolescents and adults. Jama. 265, (15), 1961-1967 (1991).
  2. Floyd, R. L. Observations from the CDC. Preventing alcohol-exposed pregnancies among women of childbearing age: the necessity of a preconceptional approach. J. Womens Health Gend. Based Med. 8, (6), 733-736 (1999).
  3. Ali, S. Large-scale analysis of acute ethanol exposure in zebrafish development: a critical time window and resilience. PLoS One. 6, (5), e20037-e20037 (2011).
  4. Dlugos, C. A., Rabin, R. A. Structural and functional effects of developmental exposure to ethanol on the zebrafish heart. Alcohol Clin. Exp. Res. 34, (6), 1013-1021 (2010).
  5. Fernandes, Y., Gerlai, R. Long-term behavioral changes in response to early developmental exposure to ethanol in zebrafish. Alcohol Clin. Exp. Res. 33, (4), 601-609 (2009).
  6. Bilotta, J. Effects of embryonic exposure to ethanol on zebrafish visual function. Neurotoxicol. Teratol. 24, (6), 759-766 (2002).
  7. Tanguay, R. L., Reimers, M. J. Analysis of ethanol developmental toxicity in zebrafish. Methods Mol. Biol. 447, 63-74 (2008).
  8. Blader, P., Strahle, U. Ethanol impairs migration of the prechordal plate in the zebrafish embryo. Dev. Biol. 201, (2), 185-201 (1998).
  9. Loucks, E., Carvan, M. J. 3rd, Strain-dependent effects of developmental ethanol exposure in zebrafish. Neurotoxicol. Teratol. 26, (6), 745-755 (2004).
  10. Ahlgren, S. C. Molecular Mechanisms of Fetal Alcohol Syndrome: Shh-signaling. Comprehensive Handbook of Alcohol Related Pathology. Preedy, V. (2004).
  11. Reimers, M. J., Flockton, A. R., Tanguay, R. L. Ethanol- and acetaldehyde-mediated developmental toxicity in zebrafish. Neurotoxicol. Teratol. 26, (6), 769-781 (2004).
  12. Pfaffl, M. W. A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res. 29, (9), 45-45 (2001).
  13. Jowett, T. Tissue in situ hybridization: methods in animal development. John Wiley & Sons. New York. 128-128 (1997).
  14. Loucks, E. J., Ahlgren, S. C. Deciphering the role of Shh signaling in axial defects produced by ethanol exposure. Birth Defects Res. A. Clin. Mol. Teratol. 86, 556-567 (2009).
  15. Schwend, T. Requirement of Npc1 and availability of cholesterol for early embryonic cell movements in zebrafish. J. Lipid Res. 52, (7), 1328-1344 (2011).
  16. Spohr, H. L., Willms, J., Steinhausen, H. C. Fetal alcohol spectrum disorders in young adulthood. J. Pediatr. 150, (2), 175-179 (2007).
  17. Strauss, R. S. Effects of the intrauterine environment on childhood growth. Br. Med. Bull. 53, (1), 81-95 (1997).
  18. Loucks, E. J., Schwend, T., Ahlgren, S. C. Molecular changes associated with teratogen-induced cyclopia. Birth Defects Res. A. Clin. Mol. Teratol. 79, (9), 642-651 (2007).
  19. Schwend, T., Loucks, E. J., Ahlgren, S. C. Visualization of Gli activity in craniofacial tissues of hedgehog-pathway reporter transgenic zebrafish. PLoS One. 5, (9), 14396-14396 (2011).
  20. Chrisman, K. Gestational ethanol exposure disrupts the expression of FGF8 and Sonic hedgehog during limb patterning. Birth Defects Res. A. Clin. Mol. Teratol. 70, (4), 163-171 (2004).
הערכת שינויים teratogenic במודל דג הזברה של חשיפה אלכוהול עוברית
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Loucks, E., Ahlgren, S. Assessing Teratogenic Changes in a Zebrafish Model of Fetal Alcohol Exposure. J. Vis. Exp. (61), e3704, doi:10.3791/3704 (2012).More

Loucks, E., Ahlgren, S. Assessing Teratogenic Changes in a Zebrafish Model of Fetal Alcohol Exposure. J. Vis. Exp. (61), e3704, doi:10.3791/3704 (2012).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter