Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Medicine

Valutare i cambiamenti teratogeni in un modello di Zebrafish di esposizione alcolica fetale

doi: 10.3791/3704 Published: March 20, 2012

Summary

Al fine di comprendere i meccanismi molecolari del danno indotto da etanolo di sviluppo, abbiamo sviluppato un modello di esposizione zebrafish etanolo e stanno esplorando le caratteristiche fisiche, alterazioni cellulari e genetiche che si verificano dopo l'esposizione etanolo

Abstract

Sindrome alcolica fetale (FAS) è una manifestazione grave di esposizione embrionale in etanolo. Si presenta con difetti caratteristici al viso e gli organi, tra cui ritardo mentale dovuto allo sviluppo del cervello disordinato e danneggiati. Disturbo dello spettro fetale alcolico (FASD) è un termine usato per coprire un continuum di difetti di nascita che si verificano a causa di consumo di alcol materno, e si verifica in circa il 4% dei bambini nati negli Stati Uniti. Con il 50% delle donne in età fertile età segnalazione consumo di alcol, e la metà di tutte le gravidanze non pianificate essere, l'esposizione non intenzionale è un problema costante 2. Al fine di comprendere al meglio il danno prodotto da etanolo, oltre a produrre un modello con cui testare possibili interventi, abbiamo sviluppato un modello di esposizione etanolo di sviluppo utilizzando l'embrione zebrafish. Zebrafish sono ideali per questo tipo di studio teratogeno 3-8. Ogni coppia dispone di centinaia di uova, che possono poi essere raccolti senza danneggiare l'adultopesce. L'embrione zebrafish è trasparente e può essere facilmente ripreso con qualsiasi numero di macchie. L'analisi di questi embrioni dopo esposizione a etanolo a dosi differenti e tempi di durata e mostra l'applicazione che i difetti gravi sviluppo prodotte da etanolo sono coerenti con il difetto nascita umana. Qui descritte sono le tecniche di base utilizzate per studiare e manipolare il modello zebrafish FAS.

Protocol

1. Trattamento etanolo di embrioni

  1. Embrioni di zebrafish derivati ​​da wild-type accoppiamenti sono state sollevate a 28 ° C in 5 ml di acqua dell'embrione. (Milli-Q acqua con 60 mg / L istantaneo Ocean). Diversi ceppi wild-type embrioni hanno tolleranze leggermente diverse con etanolo esposizione 9.
  2. L'esposizione di etanolo è stata avviata nella fase cupola (~ 4,3 ore dopo la fecondazione, HPF) per il tempo desiderato, fino ad un impulso di 24 ore. Questa fase di partenza è più o meno equivalente alla fase di impianto di embrioni di mammifero, appena prima della gastrulazione. Concentrazioni di etanolo utilizzato da 0,2% -2,5%, volume / volume. I test hanno dimostrato che tra il 25-50% della soluzione nell'acqua finisce negli embrioni 10, 11. Gli embrioni vengono mantenuti a 28 ° C per la durata desiderata. Dopo la lunghezza desiderata di etanolo esposizione, l'etanolo-acqua soluzione viene rimosso e sostituito con tre lavaggi di acqua zebrafish regolare e mantenuto FOr la durata desiderata. La specificità del difetto dipende dal tempo di insorgenza, la dose, e la lunghezza dell'impulso di etanolo.

2. Raccolta di embrioni per la RNA, ibridazione in situ, Anticorpi, e la colorazione cartilagine

  1. Per raccogliere mRNA per qPCR, età embrioni trovati sono raccolti in provette Eppendorf. Dopo la rimozione dell'acqua zebrafish, tampone di lisi con TCEP viene aggiunto. Un polverizzatore motorizzato viene utilizzato per dissociare fisicamente gli embrioni nella soluzione di lisi. Questo viene poi fatto passare attraverso una colonna preclear, che elimina eventuali pezzi di grandi dimensioni dissociato. La soluzione risultante contiene tutte le macromolecole rilasciati dal processo di lisi. RNA viene poi estratta eseguendo questa soluzione su una colonna, seguita da lavaggio e trattamento DNAsi. L'eluizione viene quindi effettuata utilizzando acqua o una soluzione di eluizione fornito dal produttore (5'-Prime). L'RNA può essere convertito in cDNA usando tecniche standard per qPCR o utilizzati in micromatrice analisi.
  2. Per ibridazione in situ e la colorazione anticorpale, embrioni da 6 a 24 hpf sono stati fissati in paraformaldeide al 4% notte a 4 ° C. Questo è seguito da 3 lavaggi in PBS + 0,1% Tween (PBT), per mantenere gli embrioni aderiscano l'uno all'altro. Gli embrioni vengono poi trasferite attraverso una serie di metanolo 3: PBT lava in metanolo 100%, al punto che essi possono essere conservati a -20 ° C. Questi embrioni possono essere utilizzati per ibridazione in situ o colorazione anticorpale. Alcuni anticorpi non funzionano dopo il trattamento metanolo, quindi questo avvertimento deve essere presa in considerazione e la anticorpi specifici test per determinare se funzionerà dopo il trattamento metanolo.
  3. Per la colorazione della cartilagine, gli embrioni devono essere innalzati a 5 o 6 giorni dopo la fecondazione (DPF). Essi vengono poi fissati in paraformaldeide al 4% notte a 4 ° C, seguito da 3 lavaggi in PBT.

3. Valutare etanolo-indotti cambiamenti di espressione genica e conseguenze dello sviluppo

    in situ. qPCR si ottiene utilizzando primer disegnati con Integrated DNA Technologies (IDT) del software, poi convalidato mediante 3 distinti campioni biologici. Una volta primer sono stati convalidati, qPCR viene eseguita su cDNA creata dal raccolto campioni di RNA. Ogni campione viene eseguito in triplice copia. Le reazioni di PCR sono gestiti Platinum SYBR Green qPCR Super mix (Invitrogen) su un Chroma-4 macchina PCR (BioRad) o similare macchina PCR con un sistema di rilevamento multicolor. Oltre ai geni essere interrogato, è fondamentale che un insieme di controllo di primer viene usata per equilibrare piccole differenze nella preparazione di cDNA o RNA. Per i nostri embrioni di zebrafish, usiamo GAPDH: 5'GAAGGTGGGAAACTGGTCAT3 'e 5'TTGCACCACCCTTAATGTGA3'. Geni essere analizzati vengono poi normalizzati a livelli GAPDH uno la quantificazione relativa dell'espressione genica è calcolato utilizzando la variazione Pfaffl metodo 2 12. Il calcolo normale presuppone che tutti i geni sono duplicando il DNA due volte per ogni ciclo, e quindi i dati esprime come rapporto tra la variazione nel gene sperimentale sulla variazione del gene di riferimento, espressa come calcoli di potenza sulla intero "2", che è l'efficienza di raddoppio di DNA per ciclo visto in una reazione PCR perfetta. Il metodo Pfaffl sostituisce il generico "2" con lo sperimentatore generato vera efficienza per il primer PCR scelto. Essa riflette una riflessione più accurata della differenza nelle reazioni PCR. La formula è completo:
    (Efficienza del gene sperimentale) (Ct del controllo Ct campione del campione trattato)
    -------------------------------------------------- -----------------------------------
    (Efficienza del gene di riferimento) (Ct delcampione di controllo - Ct del campione trattato)
  1. Per ibridazione in situ, digossigenina (DIG)-marcati ribosonde sono costruiti plasmidi contenenti porzioni del gene di interesse. Pari età embrioni sono esposti a ribosonde utilizzando condizioni standard 13 e rilevato usando anti-DIG anticorpi accoppiati a fosfatasi alcalina che consente la localizzazione delle ribosonde marcato utilizzando una reazione di colorazione (NBT / BCIP). Gli embrioni vengono poi visualizzati con un microscopio Leica dissezione (Figura 1B-G).
  2. Per valutare lo sviluppo morfogenetico, gli embrioni vengono raccolti al momento desiderato ed esaminate al microscopio da dissezione. Per la forma somite, embrioni vivi vengono esposte 14. Per la distanza tra l'oculare e lunghezza del corpo, gli embrioni sono fissati in PFA. In tutti i casi, le immagini della regione desiderata vengono catturate su un microscopio da dissezione a un ingrandimento fisso e misurazioni effettuate con Adobe Photoshop software 10,14.
  3. Per esaminare gli effetti del trattamento sulle strutture cartilagine in via di sviluppo larvale del pesce zebra, usiamo Alcian colorazione blu. Larve di zebrafish fisso vengono trattate con soluzione blu Alcian sciolto in etanolo all'80%: 20% di acido acetico glaciale (alcool acido) per diverse ore o durante la notte. Le larve sono decolorato in alcuni lavaggi di alcol acido prima di essere trasferito ad un 1% KOH: 3% di soluzione di perossido di idrogeno per la compensazione ulteriore cellule pigmentate. Zebrafish devono essere almeno 4 giorni vecchie mostrano strutture cartilaginee, e questi sono meglio definite nei pesci che sono 5 o 6 giorni.
  4. La morte cellulare in embrioni di vita è valutata sulla base arancio di acridina (AO). AO non è la cellula permeabile alle cellule viventi, e si lega al DNA in cellule con membrane compromessi, compresi quelli in fase di apoptosi e necrosi. Embrioni viventi sono incubati con 5 mg / ml AO in PBS per 1 ora, seguito da 3 lavaggi in PBS. Gli embrioni vengono poi ripresi utilizzando il microscopio confocale. Digital Z-serimmagini IE sono combinati per creare compositi.

4. Manipolare l'embrione Zebrafish

  1. Dopo l'identificazione di geni che sono diminuiti esposizione etanolo, è possibile tentare di sostituirli con iniezione di mRNA progettato per sostituire il gene mancante. MRNA Capped è trascritto da plasmidi di DNA linearizzato utilizzando RNA polimerasi in kit di trascrizione in vitro, secondo le istruzioni del produttore (mMessage Macchina, Applied Biosystems). Tra 25-200 pg / nl di RNA viene iniettata 1-2 uova fase cellule zebrafish, in una soluzione di 0,1 M KCl. Gli embrioni vengono poi consentito di recuperare prima di essere trattata con etanolo come descritto in precedenza (Figura 5).
  2. Per qualsiasi trascritti genici vengono aumentate di etanolo esposizione, possono essere ridotti, o "knock-down" utilizzando una tecnologia antisenso morfolino. Antisenso Morpholinos (Amos), sono stati progettati da Gene Tools societari, e bloccare la traduzione di RNA in proteine, o block la maturazione e splicing di RNA, a seconda della necessità sperimentale. Questa azione di Morpholinos limitare la quantità di proteina attiva per il gene obiettivo, un deficit che può essere misurata usando anitibodies se sono disponibili. L'efficienza di Morpholinos splicing dell'RNA può essere misurata usando RT-PCR per rilevare le quantità relative di trascritti giuntate e unspliced. Titolazione dei morfolino può provocare dose-dipendente l'attività 15. AMOS vengono diluiti a concentrazioni di lavoro (titolato pg a concentrazione ng) Danieau in soluzione (58 mM NaCl, 0,7 mM KCl, 0,4 mM MgSO 4, 0,6 mM Ca (NO 3) 2, 5 mM di HEPES, pH 7,6). L'iniezione avviene in 1-2-cella fase, quindi gli embrioni sono permesso di sviluppare prima di essere sottoposto a trattamento di etanolo come sopra.

5. Risultati rappresentativi

L'esposizione dell'embrione Zebrafish ai risultati di etanolo in un certo numero di difetti di sviluppo e genetici che sono legati ai fenotipi trovato in altri vertebrati. Abbiamo documentato sviluppo anormale di tessuti assiali, compresa la notocorda (dati non mostrati 14). Il ritardo dello sviluppo prodotto da etanolo porta apparentemente per rottura di un adeguato allungamento notocorda, portando ad una abbreviata e di tanto in tanto interrotto notocorda (dati non riportati 14). Questo ritardo iniziale e difetti notocorda conduce con ogni probabilità in parte alle successive anomalie nei somiti (Figura 2), che hanno perso la loro forma forte chevron come si vede nei controlli non trattati, e sono più vicini ai somiti caratteristiche dei fenotipi a forma di U visto quando sonic segnalazione è ridotta 14. L'angolo dei somiti può essere misurata usando software standard, e l'angolo aumenta da 92,1 ± 4,6 ° nei controlli non trattati a 122,6 ± 6,6 ° negli embrioni di etanolo trattati (p <0,001).

Un'altra conseguenza di etanolo esposizione che potrebbe essere downstream del primo ritardo di sviluppo e successive difetti notocorda è una lunghezza ridotta di un embrione (Figura 3). Anche misurazione embrioni per tener conto della curvatura prodotta da esposizione etanolo, etanolo esposizione porta ad un tronco accorciata che dipende dalla dose di etanolo è stato esposto per l'embrione (Figura 3E 14). Questo risultato è simile alla persistenza di statura prepubertà short trovato in bambini esposti all'etanolo durante lo sviluppo del 16, 17, suggerendo che il modello di zebrafish è rilevante per la comprensione del difetto nascita umana.

Una delle caratteristiche classiche della FAS è una facies classici, tra cui una mandibola ridotta, apertura piccolo occhio, e un philtrum liscia. Gran parte di queste caratteristiche sono correlata ad una riduzione nei tessuti della linea mediana. È stato dimostrato in modelli animali che etanolo esposizione grave porta a fenotipi ancor più pronunciati, compresi synopthalmia e ciclopia. Quando expocantare embrioni di zebrafish a dosi maggiori di etanolo, la distanza intraoculare (IOD) riduce in modo dose-dipendente (Figura 4) coerente con la natura del difetto nascita umana. Cyclopia si trova solo con dosi molto elevate, ma dosi inferiori producono una significativa riduzione del IOD (figura 4), ​​suggerendo che questo modello animale ha un difetto simile in linea mediana dello sviluppo facciale 10.

Al fine di comprendere il meccanismo alla base dei difetti sia nel corpo e del viso prodotto da etanolo esposizione, abbiamo cercato di determinare le variazioni di espressione genica che si verificano all'inizio di sviluppo e che possono essere ragionevolmente dovrebbe contribuire a difetti dello sviluppo successivo. Facciamo questo in due modi, l'estrazione di mRNA da embrioni permette una valutazione quantitativa dei livelli di espressione genica in embrioni di etanolo trattati rispetto ai controlli (Figura 1A). Inoltre, si può eseguire in situibridazione di guardare il modello di geni, indipendentemente dal fatto che il segnale viene diminuita (Figura 1B G-18). In questo esempio, due geni la cui espressione è diminuita dopo l'esposizione a etanolo sono mostrati, e gli1 six3b. Quando abbiamo esaminato il modello in situ per six3b, abbiamo trovato una riduzione della estensione spaziale del espressione di questo gene (Figura 1 EG) in embrioni esposti a etanolo. Una riduzione simile è stato trovato nel gene GSC (Figura BD). Sia six3b e gsc sono espressi in tessuti destinati a contribuire alla cranio-facciali tessuti della linea mediana. Quindi, la riduzione di questi geni a 8 hpf è coerente con la riduzione IOD trovato seguito come mostrato nella Figura 4.

Una volta che i geni che sono affetti da etanolo sono identificati, vi sono meccanismi mediante i quali l'espressione di essi può essere aumentato o diminuito. In questo particolare EXAesempio, nell'ambito abbiamo dimostrato 2 geni che sono diminuiti (gli1 e six3b) da qPCR. Abbiamo scelto di iniettare mRNA per determinare se l'inversione di tali cambiamenti genetici possono migliorare i risultati. Per questo esperimento, invece di iniettare gli1, abbiamo scelto di iniettare shh, un ligando che aumenta gli1 livelli. Per six3b, siamo stati in grado di iniettare six3b stesso. Non abbiamo trovato cambia quando abbiamo iniettato six3b (dati non riportati), ma sono stati in grado di salvare fondamentalmente i difetti lordi in embrioni di zebrafish con iniezioni supplementari shh (Figura 5).

Figura 1
Figura 1. Esposizione etanolo cambia il modello precoce e livelli di espressione genica di geni dello sviluppo selezionati. A) i risultati qPCR per gli embrioni a 8hpf. I risultati di due geni vengono visualizzati: six3b e gli1. I risultati mostrati come media di tre esperimenti separati,e la dose di etanolo mostrato è del 2,5%. Entrambi i geni sono ridotti in maniera significativa dal controllo (t-test, p <0,05). BG) L'ibridazione in situ di 8 embrioni di zebrafish HPF. Sia la GSC e modelli six3b sono alterati a questo punto tempo rispetto ai controlli. (Modificata con il permesso di Loucks et al. 2007).

Figura 2
Figura 2. Sviluppo somite è alterata in embrioni trattati. Somite struttura e gli angoli vengono esaminati a 48 HPF. In embrioni di controllo (A), hanno una forma somiti chevron e un angolo acuto. Zebrafish Etanolo esposti hanno più angoli di I o U somiti, e meno tagliente. (Modificata con il permesso di Loucks e Ahlgren 2009).

Figura 3
Figura 3. Trattamento etanolo diminuisce significativamente lunghezza del corpo in zebrafish.La lunghezza di embrioni non trattati e etanolo-esposti sono stati misurati a 5 postfertilization giorni. Una riduzione significativa lunghezza è stata osservata in tutti gli embrioni trattati (ANOVA, p <0,001). BD. C'è stata una leggera riduzione ma significativa nella lunghezza totale di embrioni trattati con 1,0% e 1,5% etanolo, mentre una maggiore riduzione è stata osservata in embrioni dosate con 2,0% e 2,5% di etanolo. E. Per controllare le differenze di dimensioni in ogni frizione, gli embrioni di controllo per ciascun esperimento sono stati normalizzati a 100, e gli embrioni di pari livello trattati espressa come percentuale di 100. (Modificata con il permesso di Loucks e Ahlgren 2009).

Figura 4
Figura 4. Risultati etanolo esposizione in una riduzione della distanza intraoculare (IOD) in embrioni di zebrafish. A) viste frontali di embrioni dimostrano fenotipi occhi normali e fusa. B) Distinguere le dosi di etanolo somministrata per 3 ore durante res gastrulazioneULT è diminuito in iod quando i pesci sono esaminati dopo 24 ore. Occhi fusi e ciclopia si vedono solo alla massima dose testata (2,4%). * Denota una significativa riduzione iod rispetto ai controlli. (Modificato con il permesso di Ahlgren, 2004).

Figura 5
Figura 5. Shh-N iniezione di mRNA salva i difetti lordi prodotti da esposizione etanolo di zebrafish. Uno-due embrioni di cellule sono state iniettate con 100 pg / nl shh-N mRNA e la metà degli embrioni iniettati sono stati esposti a dosi standard di etanolo 4,3-24 HPF. Gli embrioni sono stati analizzati a 5 dpf. Gli embrioni trattati con 2,0% di etanolo esibiscono sul dorso curvo code più corte, I-forma somiti, e difetti agli occhi, compresa ciclopia. Salvataggio di questi fenotipi è visto in 71/76 di embrioni iniettati (93%). In questi embrioni, il corpo è dritto, i somiti sono chevron forma, e gli occhi sono completamente separati.

Discussion

I metodi qui descritti e mostrati i risultati dimostrano che la punta di zebrafish come può essere utilizzato per interrogare difetti di sviluppo. A causa della accessibilità dell'embrione, elevato numero di uova deposte per ogni frizione e alta riproducibilità dei risultati, questi vertebrati sono ideali per gli studi teratogeni. Pesci possono essere manipolati per contenere molecole fluorescenti da utilizzare come reporter visivo per un gene particolare o percorso di interesse 19. Negli studi di etanolo, le dosi utilizzate appaiono piuttosto elevato rispetto ai livelli di alcool nel sangue dei mammiferi. Tuttavia, questi livelli riflettono ciò che è presente nell'acqua, e non tutto l'etanolo è consegnato l'embrione.

Nel loro insieme, i metodi descritti e riportati sopra suggeriscono che embrioni di zebrafish sono molto utili a modellare difetti di nascita umani derivanti da un'esposizione etanolo. Inoltre, i cambiamenti di espressione genica si trovano nel pesce zebra sono stati confermati da altrinei sistemi modello mammiferi 20, suggerendo che gli effetti sviluppo di etanolo sono mantenuti in vertebrati. Molte delle tecniche dimostrate sopra può essere utilizzato con altri insulti ambientali o farmaceutica per rilevare rapidamente e facilmente potenziali teratogeni e determinare i meccanismi che contribuiscono alla teratogenesi di una particolare sostanza.

Disclosures

Non abbiamo nulla da rivelare.

Acknowledgments

Desideriamo ringraziare Monte Westerfield, Makoto Kobayashi e Jacek Topczewski per i doni di plasmidi per l'ibridazione in situ e microiniezioni di mRNA. Siamo grati a Steph Erhard per apparire nel video. Desideriamo inoltre riconoscere l'aiuto di William Goossens con la microscopia confocale mostrato nel video. Tyler Schwend fornito le immagini utilizzate nel video, e il Rodney Dale assistito con la preparazione per il video. Abbiamo anche riconoscere il personale CMRC la cura degli animali per il loro lavoro con l'allevamento zebrafish. Questo lavoro è stato finanziato dalla sovvenzione del NIH R21 AA13596 di SCA.

Materials

Name Company Catalog Number Comments
Tissue RNA kit: 5-Prime PerfectPure Fisher Scientific FP2302410
Platinum SYBR green qPCR SuperMix-UDG Invitrogen 11733038
mMessage mMachine high yield capped RNA transcription kit Applied Biosystems Depends on the RNA polymerase in your plasmid

DOWNLOAD MATERIALS LIST

References

  1. Streissguth, A. P. Fetal alcohol syndrome in adolescents and adults. Jama. 265, (15), 1961-1967 (1991).
  2. Floyd, R. L. Observations from the CDC. Preventing alcohol-exposed pregnancies among women of childbearing age: the necessity of a preconceptional approach. J. Womens Health Gend. Based Med. 8, (6), 733-736 (1999).
  3. Ali, S. Large-scale analysis of acute ethanol exposure in zebrafish development: a critical time window and resilience. PLoS One. 6, (5), e20037-e20037 (2011).
  4. Dlugos, C. A., Rabin, R. A. Structural and functional effects of developmental exposure to ethanol on the zebrafish heart. Alcohol Clin. Exp. Res. 34, (6), 1013-1021 (2010).
  5. Fernandes, Y., Gerlai, R. Long-term behavioral changes in response to early developmental exposure to ethanol in zebrafish. Alcohol Clin. Exp. Res. 33, (4), 601-609 (2009).
  6. Bilotta, J. Effects of embryonic exposure to ethanol on zebrafish visual function. Neurotoxicol. Teratol. 24, (6), 759-766 (2002).
  7. Tanguay, R. L., Reimers, M. J. Analysis of ethanol developmental toxicity in zebrafish. Methods Mol. Biol. 447, 63-74 (2008).
  8. Blader, P., Strahle, U. Ethanol impairs migration of the prechordal plate in the zebrafish embryo. Dev. Biol. 201, (2), 185-201 (1998).
  9. Loucks, E., Carvan, M. J. 3rd, Strain-dependent effects of developmental ethanol exposure in zebrafish. Neurotoxicol. Teratol. 26, (6), 745-755 (2004).
  10. Ahlgren, S. C. Molecular Mechanisms of Fetal Alcohol Syndrome: Shh-signaling. Comprehensive Handbook of Alcohol Related Pathology. Preedy, V. (2004).
  11. Reimers, M. J., Flockton, A. R., Tanguay, R. L. Ethanol- and acetaldehyde-mediated developmental toxicity in zebrafish. Neurotoxicol. Teratol. 26, (6), 769-781 (2004).
  12. Pfaffl, M. W. A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res. 29, (9), 45-45 (2001).
  13. Jowett, T. Tissue in situ hybridization: methods in animal development. John Wiley & Sons. New York. 128-128 (1997).
  14. Loucks, E. J., Ahlgren, S. C. Deciphering the role of Shh signaling in axial defects produced by ethanol exposure. Birth Defects Res. A. Clin. Mol. Teratol. 86, 556-567 (2009).
  15. Schwend, T. Requirement of Npc1 and availability of cholesterol for early embryonic cell movements in zebrafish. J. Lipid Res. 52, (7), 1328-1344 (2011).
  16. Spohr, H. L., Willms, J., Steinhausen, H. C. Fetal alcohol spectrum disorders in young adulthood. J. Pediatr. 150, (2), 175-179 (2007).
  17. Strauss, R. S. Effects of the intrauterine environment on childhood growth. Br. Med. Bull. 53, (1), 81-95 (1997).
  18. Loucks, E. J., Schwend, T., Ahlgren, S. C. Molecular changes associated with teratogen-induced cyclopia. Birth Defects Res. A. Clin. Mol. Teratol. 79, (9), 642-651 (2007).
  19. Schwend, T., Loucks, E. J., Ahlgren, S. C. Visualization of Gli activity in craniofacial tissues of hedgehog-pathway reporter transgenic zebrafish. PLoS One. 5, (9), 14396-14396 (2011).
  20. Chrisman, K. Gestational ethanol exposure disrupts the expression of FGF8 and Sonic hedgehog during limb patterning. Birth Defects Res. A. Clin. Mol. Teratol. 70, (4), 163-171 (2004).
Valutare i cambiamenti teratogeni in un modello di Zebrafish di esposizione alcolica fetale
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Loucks, E., Ahlgren, S. Assessing Teratogenic Changes in a Zebrafish Model of Fetal Alcohol Exposure. J. Vis. Exp. (61), e3704, doi:10.3791/3704 (2012).More

Loucks, E., Ahlgren, S. Assessing Teratogenic Changes in a Zebrafish Model of Fetal Alcohol Exposure. J. Vis. Exp. (61), e3704, doi:10.3791/3704 (2012).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter