Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Neuroscience

Isolering og dyrkning af humane Fungiform Taste papiller Celler

doi: 10.3791/3730 Published: May 17, 2012

Summary

Vi havde til formål at udvikle en reproducerbar protokol til at isolere og opretholde langsigtede kulturer af humane fungiform smag papiller celler. Celler fra menneskelige fungiform papiller opnået ved biopsi blev med succes holdt i kultur i mere end otte passager (12 måneder) uden tab af levedygtighed.

Abstract

Smag celler er meget specialiseret, med unikke histologiske og molekylære og fysiologiske egenskaber, der tillader detektion af en lang række simple stimuli og komplekse kemiske molekyler indeholdt i fødevarer. I humant individuel fungiform papiller indeholde fra nul til så mange som 20 smagsløg. Der er ingen etableret protokol for dyrkning af humane smag celler, selv om evnen til at opretholde smagen papiller celler i kultur til flere cellecykler ville være af stor nytte til karakterisering af de molekylære, regenerative og funktionelle egenskaber af disse unikke sensoriske celler. Tidligere undersøgelser af smag celler er blevet udført under anvendelse af frisk isolerede celler i primær kultur, eksplantatkulturer fra gnavere eller semi-intakte smagsløgene i vævssnit 1,2,3,4. Selv om hver af disse præparater har fordele, vil udviklingen af ​​langsigtede kulturer har givet betydelige fordele, især for studier af smag celledeling og forskelrentiation. Flere grupper, herunder vores, har været interesseret i udvikling og etablering af smag cellekulturmodeller. De fleste forsøg på kultur smag celler har rapporteret begrænset levedygtighed, med celler typisk ikke længere varighed end 3-5 d. 5,6,7,8. Vi har for nylig rapporteret om en succesfuld metode til den udvidede kultur af gnaver smag celler 9. Vi her rapport første gang etableringen af en in vitro-kultur system til isolerede humane fungiform smag papiller celler. Celler fra menneskelige fungiform papiller opnået ved biopsi blev med succes holdt i kultur i mere end otte passager (12 måneder) uden tab af levedygtighed. Celler viste mange molekylære og fysiologiske egenskaber karakteristiske for modne smag celler. Gustducin og phospholipase C β2 (PLC-β2) mRNA blev detekteret i mange celler ved revers transkriptase-polymerasekædereaktion og bekræftet ved sekventering. Immuncytokemi analyse viste tilstedeværelsen af ​​vindstødducin og PLC-β2-ekspression i dyrkede smag celler. Dyrkede humane fungiform celler udviste også stigninger i intracellulært calcium som reaktion på passende koncentrationer af forskellige smag stimuli indikerer, at smag receptorer og i det mindste nogle af de signalveje var til stede. Disse resultater indikerer, at en tilstrækkelig smag celler fra voksne mennesker kan genereres og opretholdes i mindst otte passager. Mange af cellerne bevarer fysiologiske og biokemiske karakteristika for akut isolerede celler fra den voksne smag epitel at støtte deres anvendelse som en model smag system. Dette system vil gøre det muligt for yderligere undersøgelser af de processer, der er involveret i proliferation, differentiering og funktion af pattedyr smag receptor celler i en in vitro præparat.

Menneskelig fungiform smag papiller anvendes til oprettelse af human fungiform cellekultur blev doneret til forskning efter en fyldestgørende informeret samtykke under forsknings-protokoller, der blev revideretog godkendt af IRB-udvalget. Protokollen (# 0934) blev godkendt af Schulman Associates Institutional Review Board Inc., Cincinnati, OH. Skrevet protokol nedenfor er baseret på offentliggjorte parametre rapporteret af Ozdener et al. 2011 10.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. Indhentning af menneskelige Fungiform Smag Papiller

  1. Fjerne 07:56 human fungiform smag papiller fra den dorsale overflade af den forreste del af tungen ved hjælp af krumme fjederelementer microscissors.
  2. Umiddelbart i en isolation opløsning (26 mM NaHCO3, 2,5 mM NaH 2PO 4, 20 mM glucose, 65 mM NaCl, 20 mM KCl og 1 mM EDTA blev opløst i nuklease-frit vand og filtersteriliseret).

2. Menneskelig Fungiform Smag Papiller Fordøjelse

Menneskelig fungiform smag celle papiller kan adskilles ved hjælp af to forskellige enzymatiske fordøjelse protokoller med små forskelle.

  1. Inkuber fungiform papiller isoleret opløsning med pronase (1 mg / ml, Sigma Aldrich) og elastase (1 mg / ml Sigma Aldrich) ved stuetemperatur i 30-45 min (protokol 1).
  2. Inkuber fungiform papiller med collagenase I (550 U / ml, fra Worthington) + elastase (10 U / ml, fra urthington) + trypsininhibitor (0,9 mg / ml, fra Worthington) i 2 ml calcium-fri Ringer-opløsning i 35 ° C vandbad med cirkulation i 30 minutter og skånsom iltnings med 95% O2 / 5% CO2. (Alternativ fremgangsmåde til fordøjelsen, protokol 2)
  3. Efter inkubation vaskes papiller med ringetone og udriv papiller med ilden poleret glas Pasteur pipette til 10 gange.
  4. Centrifugeres det i 3 minutter ved 2500 rpm ved stuetemperatur og fjerne isoleringen og der tilsættes 1 ml af smag celledyrkningsmedium.
  5. Overfør fordøjet fungiform papiller i glas fad.
  6. Dissekere fungiform papiller forsigtigt med kirurgisk barberkniv.
  7. Tilsæt 250 pi dissekeret papiller i kloning cylinderen på rotte hale collagen type-1 overtrukne dækglas.
  8. Tilsæt 1 ml af smag celledyrkningsmedium i hver brønd.

3. Dyrkning af humane Fungiform Taste papiller Celler

  1. Inkuber plade ved 36 ° C i en befugtetinkubator indeholdende 5% CO2.
  2. Anbring i en inkubator uforstyrret i 2 dage før den første ændring i komplet medium. Smag celler i sidste ende vil binde til det overtrukne dækglas, selvom det måske ikke være tydeligt i 1 til 3 dage.
  3. Fjern kloning cylinder fra pladen og mellemstore helt og tilsæt 1 ml smag celle medium til hver brønd.
  4. Erstatte 1/3 af medium hver 6-7 dage. Du må ikke ændre mellemstore oftere og / eller helt.
  5. Se cellevækst under mikroskop hver anden dag. De fleste af de nye celler vokser under celleklynger. Celleklynger sædvanligvis aftage efter 2-3 uger i kultur forlader de nyligt genererede celler.
  6. Når 40-50% af kloning cylinderen er dækket ekspanderende smag celler, Trypsinisér cellerne med 0,25% w / v trypsin / EDTA i 2-3 minutter ved 36 ° C.
  7. Overførsel celler fra brøndene i 15 ml rør, og der tilsættes 3 volumener smag celledyrkningsmedium efterfulgt af centrifugering ved 3000 rpm i 5 minutter ved stuetemperatur temperamentratur.
  8. Fjerne supernatanten og resuspender cellerne med 1 ml af smag cellemedium.

4. Formering af humane Fungiform Taste papiller Celler

  1. Overfør celler i T25 plade og tilsæt 4 ml smag celle medium (passage 0). Opretholde cellerne ved 36 ° C i en befugtet inkubator indeholdende 5% CO2.
  2. Erstatte 1/3 af medium hver 6-7 dage, indtil dyrkede smag cellerne har nået 100% konfluens. På dette tidspunkt, så smagen celler til høst vaske cellerne en gang med sterilt PBS og derefter Trypsinisér cellerne med 0,25% w / v trypsin / EDTA i 2-3 minutter ved 36 ° C.
  3. Efter centrifugering som beskrevet ovenfor, resuspenderes i komplet smag cellemedium og overføre cellerne til friske T-75 kolber (passage 1).
  4. Erstatte 1/3 af medium hver 6-7 dage. Du må ikke ændre mellemstore oftere og / eller helt.
  5. Gentag trin 4,3 og 4,4, når cellerne har nået tæt på 100% sammenflydning. Opdele celler til ikke mere end 1:4 fortynding i en T75 kolbefor at opretholde tilstrækkelig vækst af cellerne med tiden.

5. Nedfrysning og optøning Dyrkede humane Fungiform Taste papiller Celler

  1. For at fryse lagre af primære smag celler, efter trypsinbehandling (trin 4.2), tilsættes 3 ml komplet smag celle medium og overføre cellerne til sterile 15 ml koniske centrifugerør. Centrifugeres ved 2500 rpm i 5 minutter ved stuetemperatur.
  2. Forsigtigt Fjern supernatanten og forsigtigt resuspender cellerne med en passende volumen af ​​frysning medium indeholdende 95% føtalt bovint serum (FBS) og 5% DMSO.
  3. Overfør celler til mærket, sterilt kryohætteglas, cap stramt og sted i en fryse container indeholder isopropanol. Sted til en -80 ° C fryser i mindst én dag før overførsel uendelige for flydende nitrogen.
  4. At optø en hætteglas frosne primære humane fungiform smag papiller celler sted ved 37 ° C vandbad, indtil kun optøet (ca. 1 minut), mens der udføres i en laminar strømning cellekulturhætte.
  5. Overføre celler og frysning medium til et sterilt 15 ml konisk centrifugeglas og der tilsættes 5 ml af smag celledyrkningsmedium.
  6. Centrifugeres celler ved 2500 rpm i 5 minutter ved stuetemperatur. Omhyggeligt Bortkast supernatanten og forsigtigt Resuspender celler med komplet smag celledyrkningsmedium, og overføres til en steril T-25 vævsdyrkningskolbe.
  7. Fortsæt med at dyrke celler i henhold til trin 3 til 4.

6. Repræsentative resultater

Forsøg på at vokse smag biopsier i kultur var vellykket 90% af tiden. Et par dage efter biopsi og dissociation, celler typisk begyndte at vokse og migrere udad fra stykker af dissekeret fungiform væv, der forblev efter dissociation procedure. Selv individuelle celler var synlige 24-48 timer efter udpladning (fig. 1A), celler voksede i op til 2-3 uger under vedføjede celleklynger, lejlighedsvis frembringelse datterceller celler (figur 1B). Fra biopsiING 4-8 menneskelige fungiform papiller, indledende isolater af primære humane fungiform smag papiller celler nå cirka 2000 - 8000 celler i 4 uger i kultur. Ekspansion i T25 celledyrkningskolber (passage 0) til yderligere 3-4 uger vil resultere i, at humane fungiform smag papiller celler i kultur er indrettet (figur 1C). Primære humane fungiform smag papiller celler kan yderligere ekspanderet i kultur til opnåelse opad på mindst en million celler ved passage-1 i 3-4 uger (figur 1D). Primære smag celler vil fortsætte med at vokse i mere end 8 passager.

Morfologien af de dyrkede humane fungiform smag papiller celler i kultur var lig dyrkede chemosensory celler er beskrevet tidligere 11,12 .. Mest dyrkede humane fungiform smag papiller celler opretholdt deres oprindelige kompakt udseende cellelegemer med eller uden en eller flere processer op til 15-30 dage. Efter de nåede sammenløb det meste af det dyrkede ceLLS havde en polariseret-langstrakt udseende. Modne smag celler består af flere forskellige histologiske undertyper og udviser smag celle særlige træk. Her viser vi, at cellerne i disse kulturer vise mange molekylære og fysiologiske egenskaber karakteristiske for modne smag celler. Gustducin og phospholipase C - β2 (PLC-β2) mRNA blev påvist ved revers transkriptase-polymerasekædereaktion og produkter bekræftes ved sekventering (fig. 2). Ekspression af gustducin og PLC-β2 blev detekteret immunocytokemisk indikerer tilstedeværelsen af type II-lignende celler (fig. 3 B og D henholdsvis). Udbredelsen og relative ekspressionsmønstre af gustducin og PLC-β2 reflekterende celle signalveje og celletyper ikke præcist afspejler den, der ses in vivo. De faktorer, der styrer den relative fordeling af forskellige celletyper i en smagsløg er ukendt, og kan ikke gentages i de dyrkningsbetingelser. Derfor b oth ligheder og forskelle mellem de dyrkede celler og deres in vivo kolleger giver en lejlighed til at undersøge reguleringen af disse egenskaber på et molekylært niveau, under forhold, der kan manipuleres og overvåges.

Et vigtigt kriterium for et modelsystem er tilstedeværelsen af ​​relevante funktionelle egenskaber. Dyrkede celler udviste også kraftige stigninger i intracellulært calcium som reaktion på passende koncentrationer af forskellige smags stimuli (fig. 4). I disse undersøgelser fremkalde søde og bitter stimuli en stigning i intracellulært calcium, som kan svare til en depolarisering. Disse smag celle-lignende egenskaber af de dyrkede celler yde støtte til påstanden om, at den model system, vi beskriver her, vil være et værdifuldt aktiv for yderligere undersøgelser af transduktionsveje og regenereringskapacitet af menneskelige smag celler.

fig1.jpg "/>
Figur 1. Attachment og morfologi af dyrkede humane fungiform smag papiller celler. Primære humane fungiform smag papiller cellekulturer dyrket på collagen type-1-overtrukne plader blev afbildet efter 2 dage (a). Humane fungiform smag papiller celler voksede i op til 4 uger under vedhæftede celle klynger, som syntes at give anledning til datterceller. Cellerne typisk voksede til konfluens i fire uger (B) og (C og D) betegner dag 2 og 4 uger efter høstning og tilsået hhv. Dyrkede celler fortsatte med at vokse i mindst 8 måneder. Skala barer = 50 nm. Del af figur 1 blev også præsenteret i Ozdener et. al. 10.

Figur 2
Figur 2. RT-PCR resultater viste tilstedeværelsen af specifikke smag celle biomarkør mRNA'er (gustducin og PLC-β2,). Totalt RNA fra dyrkede humane fungiform celler blev revers transcribed under anvendelse af Superscript første streng syntese system til RT-PCR (Invitrogen) og anvendt til PCR amplificering med specifikke primere designet til detektion af gustducin og PLC-β2. Primere (tabel 1) blev valgt til at spænde en eller flere introner. Hvert mRNA blev detekteret i dyrkede humane fungiform smag papiller celler fra passage 4 eller 5 med amplifikationsprodukter med den forventede størrelse, bekræftet ved sekventering. Specifikt mRNA blev ikke påvist i kontrol eksperimenter uden revers transkriptase indikerer ingen genomisk DNA-kontaminering. PCR-produkter blev separeret på 2% agarosegeler og de amplificerede produkter på gelen blev udskåret med et barberblad. DNA blev ekstraheret fra gelen under anvendelse QIAquick Gel Extraction Kit (Qiagen). PCR-produkter blev sekventeret ved University of Pennsylvania Sekventering faciliteter. C-PCR og C-RT, er kontrolforsøg for PCR og Reverse Transcriptase hhv. Del af figur 2 blev også præsenteret i Ozdener et. al.

Figur 3
Figur 3. Immunofarvning af dyrkede humane fungiform smag papiller celler passagen 4 eller 5 viste tilstedeværelse af smag celle biomarkører. Dyrkede humane fungiform smag papiller celler (5 dage gamle) blev fikseret med 4% paraformaldehyd, og inkuberet med primære antistoffer (tabel 2) natten over ved 4 ° C. Billederne blev optaget med en Leica TCS-SP2 konfokal laser scanning mikroskop. Ca. blev 60% af dyrkede fungiform smag papiller celler mærket med gustducin (B) og 20-30% med PLC-β2 (D). Transmission billeder af de tilsvarende celler er vist (A og C). For kontrol, viste immunfarvning med antistof specifikt immunoglobulin fravær af ikke-specifik immun-reaktivitet (data ikke vist). Skala barer = 50 nm. Deli figur 3 blev også præsenteret i Ozdener et. al. 10.

Figur 4
Figur 4. Dyrkede humane fungiform smag papiller celler fra passage 4 eller 5 reagerer på forskellige stimuli. Dyrkede humane fungiform smag papiller celler (4-5 dage gamle) blev fyldt med 1 mM Fura-2 AM (Molecular Probes) og 10 mg / ml Pluronic F127 (Molecular Probes). Ændringer i intracellulære calciumniveauer ([Ca2 +] i) i dyrkede humane fungiform smag papiller celler blev målt under anvendelse af standard manuelle billeddannende teknikker. Cellerne blev visualiseret under anvendelse af en inverteret fluorescens-mikroskop ved excitationsbølgelængder på 340 nm og 380 nm og en emissionsbølgelængde sat ved et båndpasfilter centreret ved 510 nm. Stimuli blev opløst i badopløsning og derefter pH-værdi og osmolaritet justeres om nødvendigt. Dyrkede humane fungiform smag papiller celler reagerede på søde og bitre stimuli. Graphs illustrerer repræsentative responser [Ca +2] i-niveauer i individuelle celler under udsættelse for (A) Denatonium (2 mM), (B) Sucralose (1 mM). Hvert spor repræsenterer enkelte individuelle celler.

Gene Sequence PCR tilstand Forventede størrelse
(Bp)
Reference
β-Actin GGACTTCGAGCAAGAGATGG
AGCACTGTGTTGGCGTACAG
7 min
45 sek
45 sek
45 sek
7 min
95
94
53
72
72
234 NM_001101.3
Gustducin TCTGGGTATGTGCCAAATGA
GGCCCAGTGTATTCTGGAAA
7 min
45 sek
45 sek
45 sek
7 min
95
94
53
72
72
386 NM_001102386
PLC-β2 GTCACCTGAAGGCATGGTCT
TTAAAGGCGCTTTCTGCAAT
3 min
30 sek
30 sek
60 sek
7 min
95
94
53
72
72
333 NM_004573

Tabel 1. Primere og betingelser, der anvendes til påvisning smags specifikke molekyler.

Primært antistof Kilde Host Fortynding Sekundært antistof Kilde Host Fortynding
Gustducin SantaCruz Kanin 1:500 Anti-kanin IgG Alexa 633 Molecular Probes Goat 1:500
PLC-β 2 SantaCruz Kanin 1:500 Anti-kanin IgG Alexa 633 Molecular Probes Goat 1:500

Tabel 2. Antistoffer, der anvendes til påvisning af ekspression af specifikke molekyler.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Vi har fastholdt celler fra menneskelige fungiform smag papiller for over 8 passager, spænder over en periode på 12 måneder. Disse kulturer skaber nye celler, hvoraf mange modnes in vitro til den fase, hvor de udtrykker flere markører for modne smagsløg celletyper, foruden vigtige molekylære og fysiologiske egenskaber smag receptor celler. Tilstedeværelsen af ​​gustducin-og PLC-β2-immunoreaktivitet i delmængder af dyrkede celler er i overensstemmelse med denne konklusion. Vigtigst er det, nogle celler reagerede på anvendelser af søde og bitre smag stimuli med forbigående stigninger i intracellulær calcium, som er en funktion af dissocierede smag celler 5, celler i smagsløg skiver 3 og dyrkede humane og rotte smag celler 19,10. Dette indikerer ikke blot, at nogle af cellerne i kultur udtrykkes molekylære receptorer for sød og bitter, men at de havde nok af G-proteinkoblet transduktion kaskade for at generere CalciUM svar.

Langsigtede primære cellekulturer ofte ikke kan opretholde det oprindelige væv og celler struktur og cellulære faktorer, som kan spille en rolle i den fysiologiske funktion af celler. Ved vellykket langsigtet etablering af menneskelig fungiform smag papiller cellekultur, er store fremskridt endnu, skal en række begrænsninger nævnes. Fremmest blandt disse er, at hver batch af primære dyrkede celler kan variere på grund af forskelle i den oprindelige population af celler anvendt til at starte kulturen. Primære cellekulturer ofte savner det oprindelige væv organisation og struktur og vækstfaktorer, der spiller en rolle i den fysiologiske funktion af celler. Celler er ofte ikke altid og helt i kontakt med andre celler, som kulturer aldrig dyrkes til 100% konfluens. Generelt er de primære celler også underlagt dedifferentiering, og kromosomal ustabilitet, præget af tab eller gevinster af kromosomer ved celledeling i løbende celle LiNES, kan være et andet problem 13,14,15. Sammenligning af dyrkede humane fungiform celler med dyrkede nontaste celler tungen skal undersøges. Disse spørgsmål vil kræve brug af mange eksperimentelle metoder og modelsystemer, før vores forståelse er færdig.

Som konklusion er beskrevet protokollen her tillader opretholdelse humane fungiform smag papiller celler in vitro i mindst 8 passager (12 måneder) uden at miste de relevante celle-fysiologiske og molekylære egenskaber. Den videre udvikling af denne langsigtede primære kultur vil give et modelsystem til undersøgelser af spredning og differentiering, stimulus specificitet, cross-talk og tilpasning egenskaber af humane smag receptor celler samt væv regenerering. Hertil kommer, at virkningen af ​​betingelser, som forringer smagen cellefunktion, såsom infektion, kan medikamenter, stråling, giftige eller kemisk eksponering undersøges ved molekylære og fysiologiske niveauer.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Ingen interessekonflikter erklæret.

Acknowledgments

Vi takker Aimee Myers og Esi Quayson for tekniske kvalifikationer og hjælpe. Dette arbejde blev delvist støttet af NSF 0216310 og Givaudan Inc tilskud (NER).

References

  1. Mbiene, J. P., Maccallum, D. K., Mistretta, C. M. Organ cultures of embryonic rat tongue support tongue and gustatory papilla morphogenesis in vitro without intact sensory ganglia. J. Comp. Neurol. 377, 324-340 (1997).
  2. Miyamoto, T., Fujiyama, R., Okada, Y., Sato, T. Strain difference in amiloride-sensitivity of salt-induced responses in mouse non-dissociated taste cells. Neurosci. Lett. 277, 13-16 (1999).
  3. Caicedo, A., Jafri, M. S., Roper, S. D. In situ Ca2+ imaging reveals neurotransmitter receptors for glutamate in taste receptor cells. J. Neurosci. 20, 7978-7985 (2000).
  4. Qin, Y. M., Shi, J. Q., Zhang, G. H., Deng, S. P., Wang, T. H. A reliable method to obtain cells of taste buds from fungiform papillae of mice. Acta Histochem. 112, 107-112 (2010).
  5. Spielman, A. I., Mody, I., Brand, J. G., Whitney, G., MacDonald, J. F., Salter, M. W. A method for isolating and patch-clamping single mammalian taste receptor cells. Brain Res. 503, 326-329 (1989).
  6. Kishi, M., Emori, Y., Tsukamoto, Y., Abe, K. Primary culture of rat taste bud cells that retain molecular markers for taste buds and permit functional expression of foreign genes. Neuroscience. 106, 217-225 (2001).
  7. Ruiz, C. J., Stone, L. M., McPheeters, M., Ogura, T., Bottger, B., Lasher, R. S., Finger, T. E., Kinnamon, S. C. Maintenance of rat taste buds in primary culture. Chem. Senses. 26, 861-873 (2001).
  8. Stone, L. M., Tan, S. S., Tam, P. P., Finger, T. E. Analysis of cell lineage relationships in taste buds. J. Neurosci. 22, 4522-4529 (2002).
  9. Ozdener, H., Yee, K. K., Cao, J., Brand, J. G., Teeter, J. H., Rawson, N. E. Characterization and long-term maintenance of rat taste cells in culture. Chem. Senses. 31, 279-290 (2006).
  10. Ozdener, M. H., Brand, J. G., Spielman, A. I., Lischka, F. W., Teeter, J. H., Breslin, P. A., Rawson, N. E. Characterization of Human Fungiform Papillae Cells in Culture. Chem. Senses. 36, 601-612 (2011).
  11. Gomez, G., Rawson, N. E., Hahn, C. G., Michaels, R., Restrepo, D. Characteristics of odorant elicited calcium changes in cultured human olfactory neurons. J. Neurosci. Res. 62, 737-749 (2000).
  12. Wolozin, B., Sunderland, T., Zheng, B. B., Resau, J., Dufy, B., Barker, J., Swerdlow, R., Coon, H. Continuous culture of neuronal cells from adult human olfactory epithelium. J. Mol. Neurosci. 3, 137-146 (1992).
  13. Wick, N., Saharinen, P., Saharinen, J., Gurnhofer, E., Steiner, C. W., Raab, I., Stokic, D., Giovanoli, P., Buchsbaum, S., Burchard, A., Thurner, S., Alitalo, K., Kerjaschki, D. Transcriptomal comparison of human dermal lymphatic endothelial cells ex vivo and in vitro. Physiol. Genomics. 17, 179-192 (2007).
  14. Fu, L., Zhu, L., Huang, Y., Lee, T. D., Forman, S. J., Shih, C. C. Derivation of neural stem cells from mesenchymal stemcells: evidence for a bipotential stem cell population. Stem Cells Dev. 17, 1109-1121 (2008).
  15. Sandow, S. L., Grayson, T. H. Limits of isolation and culture: intact vascular endothelium and BKCa. Am. J. Physiol. Heart Circ. Physiol. 297, H1-H7 (2009).
Isolering og dyrkning af humane Fungiform Taste papiller Celler
Play Video
PDF DOI

Cite this Article

Ozdener, H., Spielman, A. I., Rawson, N. E. Isolation and Culture of Human Fungiform Taste Papillae Cells. J. Vis. Exp. (63), e3730, doi:10.3791/3730 (2012).More

Ozdener, H., Spielman, A. I., Rawson, N. E. Isolation and Culture of Human Fungiform Taste Papillae Cells. J. Vis. Exp. (63), e3730, doi:10.3791/3730 (2012).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter