Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Neuroscience

Isolatie en Cultuur van de Mens Fungiform Smaak papillen Cellen

doi: 10.3791/3730 Published: May 17, 2012

Summary

Ons doel was om een ​​reproduceerbare protocol voor het isoleren en onderhouden van lange termijn culturen van menselijke fungiform smaak papillen cellen te ontwikkelen. Cellen uit menselijk fungiform papillen, verkregen uit biopsie werden met succes gehandhaafd in cultuur voor meer dan acht passages (12 maanden) zonder verlies van levensvatbaarheid.

Abstract

Smaak cellen zijn zeer gespecialiseerde, met unieke histologische, moleculaire en fysiologische kenmerken die de detectie van een breed scala van eenvoudige stimuli en complexe chemische moleculen in voedsel mogelijk te maken. In de menselijke, individuele fungiform papillen bevatten van nul tot maar liefst 20 smaakpapillen. Er is geen vastgesteld protocol voor het kweken van menselijke smaak cellen, hoewel de mogelijkheid om smaak papillen cellen in cultuur te behouden voor meerdere celcycli zou van groot nut zijn voor het karakteriseren van de moleculaire, regeneratieve, en functionele eigenschappen van deze unieke zintuigcellen. Eerdere studies van smaak cellen zijn gedaan met behulp van vers geïsoleerde cellen in primaire culturen, explant culturen van knaagdieren, of semi-intacte smaakpapillen in het weefsel plakjes 1,2,3,4. Hoewel elk van deze voorbereidingen heeft voordelen, zou de ontwikkeling van lange termijn culturen hebben belangrijke voordelen, met name voor studies van smaak celproliferatie en differentiation. Verschillende groepen, waaronder de onze, zijn geïnteresseerd in de ontwikkeling en invoering van smaak celkweek modellen. De meeste pogingen tot cultuur smaak cellen hebben gemeld beperkte levensvatbaarheid, met cellen die normaal gesproken niet een duur langer dan 3-5 d 5,6,7,8. We hebben onlangs gemeld op een succesvolle methode voor de uitgebreide cultuur van knaagdieren smaak cellen 9. Wij hier melden voor de eerste keer dat de vestiging van een in vitro cultuur voor geïsoleerde menselijke fungiform smaak papillen cellen. Cellen uit menselijk fungiform papillen, verkregen uit biopsie werden met succes gehandhaafd in cultuur voor meer dan acht passages (12 maanden) zonder verlies van levensvatbaarheid. Cellen weergegeven vele moleculaire en fysiologische kenmerken vertonen van rijpe smaak cellen. Gustducin en fosfolipase C β2 (PLC-β2) mRNA gedetecteerd in vele cellen door reverse transcriptase-polymerase kettingreactie en bevestigd door sequencing. Immunocytochemie analyse toonde de aanwezigheid van Gustducin en PLC-β2 expressie in gekweekte cellen smaak. Gekweekte menselijke fungiform cellen ook verhoging van de intracellulaire calciumconcentratie te zien in reactie op geschikte concentraties van verschillende stimuli smaak geven dat smaakreceptoren en ten minste enkele van de signaalpaden aanwezig waren. Deze resultaten geven aan dat voldoende smaak cellen van volwassen mensen kunnen worden gegenereerd en onderhouden gedurende ten minste acht passages. Veel van de cellen behouden fysiologische en biochemische eigenschappen van acuut geïsoleerd cellen van de volwassen smaak epitheel om hun gebruik te ondersteunen als een model smaak-systeem. Dit systeem zal in staat stellen verdere studies van de processen die betrokken zijn bij proliferatie, differentiatie en functie van zoogdieren smaak receptor cellen in een in vitro voorbereiding.

Human fungiform smaak papillen worden gebruikt voor het vaststellen van de menselijke fungiform celkweek werden geschonken voor onderzoek in goed geïnformeerde toestemming onder onderzoeksprotocollen die werden beoordeelden goedgekeurd door de IRB commissie. Het protocol (# 0934) werd goedgekeurd door Schulman Associates Institutional Review Board Inc, Cincinnati, OH. Geschreven protocol hieronder is gebaseerd op gepubliceerde parameters gerapporteerd door Ozdener et al.. 2011 10.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. Het verkrijgen van de Mens Fungiform Smaak papillen

  1. Verwijder de vier tot acht menselijke fungiform smaak papillen van de dorsale zijde van het voorste gedeelte van de tong met behulp van gebogen voorjaar microscissors.
  2. Plaats direct in een isolatie oplossing (26 mM NaHCO 3, 2,5 mM NaH 2 PO 4, 20 mM glucose, 65 mM NaCl, 20 mM KCl, en 1 mM EDTA opgelost in nuclease-vrij water en filter-gesteriliseerd).

2. Human Fungiform Smaak papillen Spijsvertering

Human fungiform smaak papillen cel kan los worden gezien met twee verschillende enzymatische digestie protocollen met kleine verschillen.

  1. Incubeer fungiform papillen afzonderlijk oplossing pronase (1 mg / ml, Sigma Aldrich) en elastase (1 mg / ml Sigma Aldrich) bij kamertemperatuur gedurende 30-45 min (protocol 1).
  2. Incubeer fungiform papillen met Collagenase type I (550 U / mL van Worthington) + elastase (10 U / ml van Worthington) + trypsine remmer (0,9 mg / ml van Worthington) in 2 ml kalkvrij Ringer oplossing 35 ° C waterbad circulatie gedurende 30 minuten en zacht oxygenatie met 95% O 2/5% CO2. (alternatieve methode voor spijsvertering, protocol 2)
  3. Na incubatie, was papillen met een belsignaal en Vermaal de papillen met vuur gepolijst glas Pasteur pipet voor 10 keer.
  4. Centrifugeer het gedurende 3 minuten bij 2500 rpm bij kamertemperatuur en verwijder de isolatie oplossing en voeg 1 ml van de smaak celkweekmedium.
  5. Overdracht verteerd fungiform papillen in de glazen schaal.
  6. Voorzichtig ontleden fungiform papillen met chirurgische scheermes.
  7. Voeg 250 ul van ontleed papillen in het klonen van cilinder op rattenstaart collageen type-1 gecoat dekglaasje aan.
  8. Voeg 1 ml van de smaak celkweekmedium in elk putje.

3. Het kweken van de Mens Fungiform Smaak papillen Cellen

  1. Incubeer plaat bij 36 ° C in een vochtigeincubator die 5% CO2.
  2. Plaatsen in een incubator ongestoord 2 dagen voor de eerste verandering volledig medium. Smaak cellen wordt eventueel binden aan de gecoate dekglaasje, hoewel het niet duidelijk zichtbaar zijn in 1 tot 3 dagen.
  3. Verwijder het klonen cilinder uit plaat en middelgrote volledig en voeg 1 ml van de smaak celmedium in elk putje.
  4. Plaats 1/3 van medium elke 6-7 dagen. Verander niet medium vaker en / of volledig.
  5. Controleer de celgroei onder de microscoop om de andere dag. Het merendeel van de nieuwe cellen groeien onder cel clusters. Cell clusters meestal los na 2-3 weken in de cultuur het verlaten van het nieuw gegenereerde cellen.
  6. Na 40-50% van de klonen cilinder bedekt uitbreiding smaak cellen trypsinize cellen met 0,25% w / v trypsine / EDTA gedurende 2-3 minuten bij 36 ° C.
  7. Overdracht cellen putjes in 15 ml buizen voeg 3 volumes smaak celkweekmedium gevolgd door centrifugatie bij 3000 rpm gedurende 5 minuten bij kamertemperatuur buiARD.
  8. Verwijder supernatant en resuspendeer cellen met 1 ml van smaak cel medium.

4. Voortplanting van de mens Fungiform Smaak papillen Cellen

  1. Overdracht cellen in T25 bord en voeg 4 ml van de smaak celmedium (passage 0). Handhaaf cellen bij 36 ° C in een bevochtigde incubator met 5% CO2.
  2. Vervang de 1/3 van medium om de 6-7 dagen tot gecultiveerde smaak cellen hebben bereikt 100% confluentie. Op dit moment naar smaak cellen mogelijk te oogsten, eenmaal wassen met steriele PBS cellen dan trypsinize cellen met 0,25% w / v trypsine / EDTA gedurende 2-3 minuten bij 36 ° C.
  3. Na centrifugeren zoals boven beschreven, opnieuw in suspensie in volkomen smaak celmedium en overdracht cellen vers T-75 kolven (passage 1).
  4. Plaats 1/3 van medium elke 6-7 dagen. Verander niet medium vaker en / of volledig.
  5. Herhaal stap 4.3 en 4.4 wanneer de cellen hebben bereikt bijna 100% confluentie. Split-cellen tot niet meer dan 1:4 verdunning in een T75 flesvoor behoud van voldoende groei van de cellen in de tijd.

5. Invriezen en ontdooien gekweekte menselijke Fungiform Smaak papillen Cellen

  1. De voorraden van primaire smaak cellen in te vriezen, na behandeling met trypsine (stap 4.2), voeg 3 ml volledige smaak celmedium en overdracht cellen om steriele 15 ml conische centrifugebuizen. Centrifugeer bij 2500 rpm gedurende 5 minuten bij kamertemperatuur.
  2. Verwijder de supernatant en voorzichtig hersuspenderen cellen met geschikte hoeveelheid bevriezing medium dat 95% foetaal runderserum (FBS) en 5% DMSO.
  3. Overdracht cellen gelabeld, steriele cryovials, dop stevig vast, en doe dit in een ijskoude container met isopropanol. Plaats een -80 ° C diepvriezer ten minste een dag voor de overdracht onbeperkt vloeibaar stikstof.
  4. Om een ​​flacon van bevroren primaire menselijke fungiform smaak papillen cellen, plaats ontdooien bij 37 ° C waterbad tot ze net ontdooid (ongeveer 1 minuut), terwijl het werken in een laminaire flow celkweekkap.
  5. Overdracht cellen en bevriezing medium tot een steriele 15 ml conische centrifugebuis en voeg 5 ml van de smaak celkweekmedium.
  6. Centrifugeer cellen bij 2500 rpm gedurende 5 minuten bij kamertemperatuur. Verwijder voorzichtig supernatant voorzichtig hersuspenderen cellen met volledige smaak celkweek medium, en transfer naar een steriele T-25 weefselkweek kolf.
  7. Blijf cultuur cellen volgens stap 3 tot 4.

6. Representatieve resultaten

Pogingen om smaak biopten te groeien in cultuur waren succesvol 90% van de tijd. Een paar dagen na de biopsie en dissociatie, cellen meestal begon te groeien en naar buiten migreren van de stukjes ontleed fungiform weefsel dat overbleef na de dissociatie procedure. Hoewel de individuele cellen zichtbaar waren 24-48 uur na plating (Figuur 1A), cellen groeide tot 2-3 weken onder bijgevoegde cel clusters, zo nu en dan het genereren van dochter-cellen (Figuur 1B). Van biopsieING 4-8 menselijke fungiform papillen, de eerste isolaten van primaire menselijke fungiform smaak papillen cellen te bereiken van ongeveer 2000 tot 8000 cellen in 4 weken in cultuur. Uitbreiding in T25 celcultuur flessen (passage 0) voor extra 3-4 weken zal resulteren in het hebben van menselijke fungiform smaak papillen cellen in cultuur aangepast (figuur 1C). Primaire humane fungiform smaak papillen cellen kunnen verder worden uitgebreid in cultuur boven ten minste een miljoen cellen oplevert door passage-1 3-4 weken (figuur 1D). Primaire smaak cellen zal blijven groeien voor meer dan 8 passages.

De morfologie van de gekweekte humane fungiform smaak papillen celkweken was vergelijkbaar met gekweekte cellen chemosensory eerder beschreven 11,12 .. De meeste gekweekte menselijke fungiform smaak papillen cellen behouden hun oorspronkelijke compacte uiterlijk van cellichamen met of zonder een of meer processen tot 15-30 dagen. Nadat ze bereikt samenvloeiing het grootste deel van de gekweekte ceLLS had een gepolariseerde-langwerpige uiterlijk. Rijpe smaak cellen bestaan ​​uit verschillende histologische subtypes en vertonen smaak cel specifieke kenmerken. Hier laten we zien dat cellen in deze culturen veel moleculaire en fysiologische kenmerken vertonen van rijpe smaak cellen weer te geven. Gustducin en fosfolipase C - β2 (PLC-β2) mRNA gedetecteerd door reverse transcriptase-polymerase kettingreactie en producten bevestigd door sequentie (figuur 2). Expressie van gustducin en PLC-β2 gedetecteerd immunocytochemically dat de aanwezigheid van type II-achtige cellen (Figuur 3 B en D respectievelijk). De prevalentie en de relatieve expressie patronen van gustducin en PLC-β2 als gevolg van cell signaling pathways en celtypes niet precies duidelijk te maken dat gezien in vivo. De factoren die de relatieve verdeling van de verschillende celtypes binnen een smaakknop onbekend zijn, en mogen niet worden herhaald in de kweekomstandigheden. Daarom b an de overeenkomsten en verschillen tussen de gekweekte cellen en hun in vivo collega's de gelegenheid bieden om de regulering van deze kenmerken te onderzoeken op een moleculair niveau, onder omstandigheden die kunnen worden gemanipuleerd en gecontroleerd.

Een belangrijk criterium voor een modelsysteem is de aanwezigheid van relevante functionele eigenschappen. Gekweekte cellen ook sterk verhoging van de intracellulaire calciumconcentratie te zien in reactie op geschikte concentraties van verschillende smaak stimuli (figuur 4). In deze studies, zoete en bittere prikkels wekken een toename van de intracellulaire calcium die overeenkomen met een depolarisatie. Deze smaak cel-achtige eigenschappen van de gekweekte cellen geven steun aan de stelling dat het model systeem dat we hier beschrijven zal een waardevolle aanwinst voor verdere studie van de transductie paden en het regeneratievermogen van menselijke smaak cellen.

fig1.jpg "/>
Figuur 1. Bevestiging en de morfologie van gekweekte menselijke fungiform smaak papillen cellen. Primaire humane fungiform smaak papillen celkweken gegroeid op collageen type 1 beklede platen werden belicht na 2 dagen (A). Human fungiform smaak papillen cellen groeide tot 4 weken onder bijgevoegde cel clusters, die leek te leiden tot dochtercellen. De cellen typisch werd tot confluentie binnen vier weken (B) en (C en D) is dag 2 en 4 weken na het oogsten en inzaaiing respectievelijk. Gekweekte cellen bleven groeien minstens 8 maanden. Schaal bars = 50 nm. Een deel van figuur 1 werd ook voorgesteld in Ozdener et. al.. 10.

Figuur 2
Figuur 2. RT-PCR resultaten toonden de aanwezigheid van specifieke smaak cel biomarker mRNA (gustducin en PLC-β2,). Totaal RNA van gekweekte menselijke cellen fungiform was achteruit transcribed met het Superscript eerste streng synthese Systeem voor RT-PCR (Invitrogen) en gebruikt voor PCR door het amplificeren specifieke primers ontworpen voor de detectie van gustducin en PLC-β2. Primers (Tabel 1) werden gekozen voor een of meer introns omvatten. Elke mRNA gedetecteerd in gekweekte humane fungiform smaak papillen cellen doorgang 4 of 5 met amplificatie producten van de verwachte grootte, bevestigd door sequencing. Specifieke mRNA werd niet waargenomen in controle-experimenten zonder reverse transcriptase aangeeft dat er geen genomisch DNA verontreiniging. PCR producten werden gescheiden op een 2% agarose gels en de geamplificeerde producten op de gel werd uitgesneden met een scheermes. DNA werd geëxtraheerd uit de gel met QIAquick-gelextractiekit (Qiagen). PCR-producten werd de sequentie van de Universiteit van Pennsylvania Sequencing faciliteiten. C-C-PCR en RT zijn controle-experimenten voor PCR en Reverse Transcriptase respectievelijk. Een deel van figuur 2 is ook weergegeven in Ozdener et. al.

Figuur 3
Figuur 3. Immunokleuring van gekweekte menselijke fungiform smaak papillen cellen doorgang 4 of 5 toonde de aanwezigheid van de smaak cel biomarkers. Gekweekte humane fungiform smaak papillen cellen (5 dagen oud) werden met 4% paraformaldehyde en geïncubeerd met primaire antilichamen (Tabel 2) overnacht bij 4 ° C. Beelden werden verkregen met een Leica TCS-SP2 confocale laser scanning microscoop. Ongeveer 60% werd van gekweekte fungiform smaak papillen cellen gelabeld met gustducin (B) en 20-30% met PLC-β2 (D). Transmissie beelden overeenkomstige cellen worden getoond (A en C). Voor controles immunokleuring met specifieke antilichamen immunoglobuline de afwezigheid van niet-specifieke immuno-reactiviteit (gegevens niet getoond). Schaal bars = 50 nm. Deelvolgens figuur 3 werd ook voorgesteld in Ozdener et. al.. 10.

Figuur 4
Figuur 4. Gekweekte menselijke fungiform smaak papillen cellen uit passage 4 of 5 reageren op verschillende stimuli. Gekweekte humane fungiform smaak papillen cellen (4-5 dagen oud) werden geladen met 1 mM Fura-2 AM (Molecular Probes) en 10 mg / ml Pluronic F127 (Molecular Probes). Veranderingen in de intracellulaire calcium niveaus ([Ca 2 +] i) in gekweekte humane fungiform smaak papillen cellen werden gemeten met behulp van standaard handmatige beeldvormende technieken. De cellen werden gevisualiseerd met een geïnverteerde fluorescentiemicroscoop bij golflengten van 340 nm en 380 nm en een emissie golflengte die door een banddoorlaatfilter gecentreerd bij 510 nm. Stimuli werden opgelost in badoplossing en pH en osmolaliteit aangepast indien noodzakelijk. Gekweekte menselijke fungiform smaak papillen cellen gereageerd op zoete en bittere prikkels. Graphs illustreren representatief reacties van [Ca +2] i niveaus in individuele cellen bij blootstelling aan (A) Denatonium (2 mM), (B) sucralose (1 mM). Elk spoor staat voor enkele individuele cellen.

Gen Volgorde PCR staat De verwachte lengte
(Bp)
Referentie
β-actine GGACTTCGAGCAAGAGATGG
AGCACTGTGTTGGCGTACAG
7 min
45 sec
45 sec
45 sec
7 min
95
94
53
72
72
234 NM_001101.3
Gustducin TCTGGGTATGTGCCAAATGA
GGCCCAGTGTATTCTGGAAA
7 min
45 sec
45 sec
45 sec
7 min
95
94
53
72
72
386 NM_001102386
PLC-β2 GTCACCTGAAGGCATGGTCT
TTAAAGGCGCTTTCTGCAAT
3 min
30 sec
30 sec
60 sec
7 min
95
94
53
72
72
333 NM_004573

Tabel 1. Primers en voorwaarden voor het opsporen van smaak specifieke moleculen.

Primaire antilichamen Bron Gastheer Verdunning Secundair antilichaam Bron Gastheer Verdunning
Gustducin Santacruz Konijn 1:500 Anti-konijn IgG Alexa 633 Molecular Probes Geit 1:500
PLC-β 2 Santacruz Konijn 1:500 Anti-konijn IgG Alexa 633 Molecular Probes Geit 1:500

Tabel 2. Antilichamen voor het opsporen expressie van specifieke moleculen.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

We hebben vastgehouden aan cellen verkregen uit menselijke fungiform smaak papillen voor meer dan 8 passages, verspreid over een periode van 12 maanden. Deze culturen genereren nieuwe cellen, waarvan vele in vitro rijpen tot de fase waarin drukken zij verschillende merkers volwassen smaakknop celtypen naast belangrijke moleculaire en fysiologische eigenschappen van smaak receptor cellen. De aanwezigheid van gustducin-en PLC-β2 immunoreactiviteit in subsets van gekweekte cellen is in overeenstemming met deze conclusie. Het belangrijkste is dat sommige cellen reageerden op toepassingen van zoete en bittere smaak stimuli met een tijdelijke toename van intracellulair calcium, dat is een kenmerk van gedissocieerde smaak cellen 5, cellen in smaakknop plakjes 3 en gekweekte menselijke en rat smaak cellen 19,10. Dit betekent niet alleen dat sommige van de cellen in cultuur moleculaire receptoren voor zoete en bittere uitgedrukt, maar dat ze genoeg van de G-eiwit gekoppelde transductie cascade naar Calci genererenum reacties.

Lange termijn primaire celculturen kunnen vaak niet handhaven van de oorspronkelijke weefsel-en celstructuur en cellulaire factoren die een rol kunnen spelen bij de fysiologische functie van cellen. Door succesvolle langdurige vestiging van de menselijke fungiform smaak papillen celkweek, is grote vooruitgang geboekt nog een aantal beperkingen worden vermeld. De belangrijkste hiervan is dat elke partij primaire gekweekte cellen kunnen variëren als gevolg van verschillen in de oorspronkelijke populatie van cellen gebruikt om de cultuur te starten. Primaire celculturen missen vaak het oorspronkelijke weefsel organisatie en de structuur en groei factoren die een rol spelen in de fysiologische functie van cellen. Cellen zijn echter niet altijd geheel en in contact met andere cellen, culturen niet gegroeid tot 100% confluentie. In het algemeen, elektrische elementen zijn ook onderhevig aan dedifferentiatie, en chromosomale instabiliteit, gekenmerkt door verliezen of winsten van de chromosomen tijdens de celdeling in continue cel lines, kan een ander probleem 13,14,15 zijn. De vergelijking van gekweekte menselijke cellen fungiform met gekweekte nontaste cellen van de tong moet worden onderzocht. Deze vragen zullen vereisen het gebruik van veel experimentele benaderingen en modelsystemen voor ons begrip is voltooid.

Tot slot wordt in dit protocol beschreven staat behoud van de menselijke fungiform smaak papillen cellen in vitro gedurende ten minste 8 passages (12 maanden) zonder verlies van relevante cel-fysiologische en moleculaire kenmerken. De verdere ontwikkeling van deze lange termijn primaire cultuur zal een modelsysteem voor studies van de proliferatie en differentiatie, stimulus specificiteit, cross-talk en aanpassing eigenschappen van de menselijke smaak receptor cellen, evenals weefselregeneratie. Bovendien zijn de effecten van de voorwaarden die smaak celfunctie zoals infectie aantasten, kunnen medicijnen, straling, giftige of blootstelling aan chemische stoffen worden onderzocht op moleculaire en fysiologische niveaus.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Geen belangenconflicten verklaard.

Acknowledgments

Wij danken Aimee Myers en Esi Quayson voor technische vaardigheden en hulp. Dit werk werd mede ondersteund door NSF 0216310 en Givaudan Inc subsidie ​​(NER).

References

  1. Mbiene, J. P., Maccallum, D. K., Mistretta, C. M. Organ cultures of embryonic rat tongue support tongue and gustatory papilla morphogenesis in vitro without intact sensory ganglia. J. Comp. Neurol. 377, 324-340 (1997).
  2. Miyamoto, T., Fujiyama, R., Okada, Y., Sato, T. Strain difference in amiloride-sensitivity of salt-induced responses in mouse non-dissociated taste cells. Neurosci. Lett. 277, 13-16 (1999).
  3. Caicedo, A., Jafri, M. S., Roper, S. D. In situ Ca2+ imaging reveals neurotransmitter receptors for glutamate in taste receptor cells. J. Neurosci. 20, 7978-7985 (2000).
  4. Qin, Y. M., Shi, J. Q., Zhang, G. H., Deng, S. P., Wang, T. H. A reliable method to obtain cells of taste buds from fungiform papillae of mice. Acta Histochem. 112, 107-112 (2010).
  5. Spielman, A. I., Mody, I., Brand, J. G., Whitney, G., MacDonald, J. F., Salter, M. W. A method for isolating and patch-clamping single mammalian taste receptor cells. Brain Res. 503, 326-329 (1989).
  6. Kishi, M., Emori, Y., Tsukamoto, Y., Abe, K. Primary culture of rat taste bud cells that retain molecular markers for taste buds and permit functional expression of foreign genes. Neuroscience. 106, 217-225 (2001).
  7. Ruiz, C. J., Stone, L. M., McPheeters, M., Ogura, T., Bottger, B., Lasher, R. S., Finger, T. E., Kinnamon, S. C. Maintenance of rat taste buds in primary culture. Chem. Senses. 26, 861-873 (2001).
  8. Stone, L. M., Tan, S. S., Tam, P. P., Finger, T. E. Analysis of cell lineage relationships in taste buds. J. Neurosci. 22, 4522-4529 (2002).
  9. Ozdener, H., Yee, K. K., Cao, J., Brand, J. G., Teeter, J. H., Rawson, N. E. Characterization and long-term maintenance of rat taste cells in culture. Chem. Senses. 31, 279-290 (2006).
  10. Ozdener, M. H., Brand, J. G., Spielman, A. I., Lischka, F. W., Teeter, J. H., Breslin, P. A., Rawson, N. E. Characterization of Human Fungiform Papillae Cells in Culture. Chem. Senses. 36, 601-612 (2011).
  11. Gomez, G., Rawson, N. E., Hahn, C. G., Michaels, R., Restrepo, D. Characteristics of odorant elicited calcium changes in cultured human olfactory neurons. J. Neurosci. Res. 62, 737-749 (2000).
  12. Wolozin, B., Sunderland, T., Zheng, B. B., Resau, J., Dufy, B., Barker, J., Swerdlow, R., Coon, H. Continuous culture of neuronal cells from adult human olfactory epithelium. J. Mol. Neurosci. 3, 137-146 (1992).
  13. Wick, N., Saharinen, P., Saharinen, J., Gurnhofer, E., Steiner, C. W., Raab, I., Stokic, D., Giovanoli, P., Buchsbaum, S., Burchard, A., Thurner, S., Alitalo, K., Kerjaschki, D. Transcriptomal comparison of human dermal lymphatic endothelial cells ex vivo and in vitro. Physiol. Genomics. 17, 179-192 (2007).
  14. Fu, L., Zhu, L., Huang, Y., Lee, T. D., Forman, S. J., Shih, C. C. Derivation of neural stem cells from mesenchymal stemcells: evidence for a bipotential stem cell population. Stem Cells Dev. 17, 1109-1121 (2008).
  15. Sandow, S. L., Grayson, T. H. Limits of isolation and culture: intact vascular endothelium and BKCa. Am. J. Physiol. Heart Circ. Physiol. 297, H1-H7 (2009).
Isolatie en Cultuur van de Mens Fungiform Smaak papillen Cellen
Play Video
PDF DOI

Cite this Article

Ozdener, H., Spielman, A. I., Rawson, N. E. Isolation and Culture of Human Fungiform Taste Papillae Cells. J. Vis. Exp. (63), e3730, doi:10.3791/3730 (2012).More

Ozdener, H., Spielman, A. I., Rawson, N. E. Isolation and Culture of Human Fungiform Taste Papillae Cells. J. Vis. Exp. (63), e3730, doi:10.3791/3730 (2012).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter