Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Neuroscience

Isolement et culture de cellules humaines fongiformes papilles gustatives

doi: 10.3791/3730 Published: May 17, 2012

Summary

Nous avons cherché à élaborer un protocole reproductible pour isoler et de maintenir à long terme des cultures de cellules humaines fongiformes papilles gustatives. Les cellules de l'homme fongiformes papilles obtenus par biopsie ont été avec succès maintenues en culture pendant plus de huit passages (12 mois) sans perte de viabilité.

Abstract

Cellules gustatives sont très spécialisées, avec uniques histologiques, les caractéristiques moléculaires et physiologiques qui permettent la détection d'un large éventail de stimuli simples et molécules chimiques complexes contenus dans les aliments. Chez l'homme, fongiformes papilles individuelle contenir de zéro à un maximum de 20 papilles gustatives. Il n'ya pas de protocole établi pour la culture de cellules gustatives de l'homme, bien que la capacité à maintenir les cellules papilles gustatives de la culture pour les cycles cellulaires multiples serait d'une utilité considérable pour caractériser les propriétés moléculaires, de régénération, et fonctionnelles de ces cellules uniques sensoriels. Des études antérieures de cellules gustatives ont été effectuées en utilisant des cellules isolées fraîchement en culture primaire, des cultures d'explants de rongeurs, ou papilles semi-intactes dans des tranches de tissu 1,2,3,4. Bien que chacune de ces préparations a des avantages, le développement de cultures à long terme aurait apporté des avantages significatifs, en particulier pour les études de cellules gustatives prolifération et différenciation. Plusieurs groupes, dont le nôtre, ont été intéressés par le développement et la mise en place de modèles de culture de cellules gustatives. La plupart des tentatives de cellules gustatives de la culture ont rapporté la viabilité limitée, avec des cellules généralement pas durables au-delà de 3-5 D 5,6,7,8. Nous avons récemment présenté un rapport sur ​​une méthode efficace pour la culture prolongée des cellules gustatives rongeurs 9. Nous rapportons ici pour la première fois la mise en place d'un système de culture in vitro pour les cellules isolées de l'homme fongiformes papilles gustatives. Les cellules de l'homme fongiformes papilles obtenus par biopsie ont été avec succès maintenues en culture pendant plus de huit passages (12 mois) sans perte de viabilité. Cellules affiché de nombreuses fonctionnalités moléculaires et physiologiques caractéristiques des cellules gustatives matures. Gustducin et la phospholipase C β2, (PLC-β2) ARNm ont été détectés dans de nombreuses cellules par réaction en chaîne par polymérase de la transcriptase inverse-et confirmé par séquençage. Analyse Immunocytochimie démontré la présence de rafales deexpression ducin et PLC-β2 dans les cellules gustatives culture. Des cultures de cellules humaines fongiformes également présenté des augmentations de calcium intracellulaire en réponse à des concentrations appropriées de stimuli gustatifs indiquant que plusieurs récepteurs du goût et au moins certains des voies de signalisation étaient présents. Ces résultats indiquent que suffisante cellules gustatives de l'homme adulte peut être générée et maintenue pendant au moins huit passages. Bon nombre des cellules conservent les caractéristiques physiologiques et biochimiques des cellules isolés de manière aiguë à partir de l'épithélium goût des adultes pour soutenir leur utilisation comme un système modèle de goût. Ce système permettra à d'autres études des processus impliqués dans la prolifération, la différenciation et la fonction de mammifères cellules réceptrices du goût dans une préparation in vitro.

Human papilles gustatives fongiformes utilisé pour établir une culture cellulaire humaine fongiformes ont été donnés pour la recherche après consentement éclairé appropriée en vertu des protocoles de recherche qui ont été examinéset approuvé par le comité de la CISR. Le protocole (# 0934) a été approuvé par les Associés Schulman Institutional Review Board Inc, Cincinnati, OH. Protocole écrit ci-dessous est basée sur des paramètres publiés rapportés par Özdener et al. 2011 10.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. Obtention humaines papilles gustatives fongiformes

  1. Retirer de quatre à huit papilles humaine goût fongiformes de la surface dorsale de la partie antérieure de la languette à l'aide microciseaux ressort courbées.
  2. Mettre immédiatement en place dans une solution d'isolation (26 mM de 3 NaHCO, 2,5 mM NaH 2 PO 4, 20 mM de glucose, 65 mM de NaCl, 20 mM de KCl, et 1 mM d'EDTA dissous dans une eau sans nucléase et stérilisé par filtration).

2. Human Digestion fongiformes papilles gustatives

Human papilles fongiformes cellules gustatives peut être dissociée en utilisant deux différents protocoles de digestion enzymatique avec de légères différences.

  1. Incuber fongiformes papilles dans une solution d'isolation avec de la pronase (1 mg / ml, Sigma Aldrich) et de l'élastase (1 mg / ml Sigma Aldrich) à température ambiante pendant 30-45 min (protocole 1).
  2. Incuber fongiformes papilles avec de la collagénase de type I (550 U / ml, à partir de Worthington) + élastase (10 U / ml, à partir de moûtHington) + inhibiteur de la trypsine (0,9 mg / ml, à partir de Worthington) dans 2 ml de solution de Ringer de calcium libre dans 35 ° C bain d'eau à la circulation pendant 30 minutes et l'oxygénation douce avec 95% d'O 2/5% de CO 2. (Alternative pour la digestion, le protocole 2)
  3. Après incubation, laver les papilles avec de la sonnerie et triturer les papilles avec le feu poli pipette en verre Pasteur pour 10 fois.
  4. Il Centrifuger pendant 3 minutes à 2500 rpm à température ambiante et retirez solution d'isolation et ajouter 1 ml de milieu de culture cellulaire goût.
  5. Transfert digéré fongiformes papilles dans un plat en verre.
  6. Disséquer fongiformes papilles en douceur avec le rasoir chirurgicale.
  7. Ajouter 250 pi de papilles disséqué dans le cylindre de clonage sur la lamelle du collagène de queue de rat de type-1 enduit.
  8. Ajouter 1 ml de milieu de culture cellulaire goût dans chaque puits.

3. Culture de cellules humaines fongiformes papilles gustatives

  1. Incuber la plaque à 36 ° C dans un humidifiéincubateur contenant 5% de CO 2.
  2. Placez-les dans un endroit non aménagé incubateur pendant 2 jours avant le premier changement de milieu complet. Cellules gustatives finira par se lier à la lamelle enduit, bien qu'il ne soit pas clairement visible dans 1 à 3 jours.
  3. Retirer le cylindre de clonage de la plaque et moyennes complètement et ajouter 1 ml de milieu cellules gustatives dans chaque puits.
  4. Remplacer 1/3 de tous les moyens de 6-7 jours. Ne changez pas le plus souvent à moyen et / ou complètement.
  5. Vérifiez la croissance des cellules au microscope tous les autres jours. La plupart des nouvelles cellules se développent au-dessous des amas de cellules. Amas de cellules généralement détacher au bout de 2-3 semaines de culture en laissant les cellules nouvellement générées.
  6. Une fois 40-50% du cylindre de clonage est recouverte en expansion cellules du goût, trypsiniser cellules en utilisant 0,25% p / v de trypsine / EDTA pendant 2-3 minutes à 36 ° C.
  7. Transfert des cellules provenant de puits en tubes de 15 ml, ajouter 3 volumes de milieu de culture cellulaire goût suivis par centrifugation à 3000 rpm pendant 5 minutes à tempérament chambrerature.
  8. Supprimer des cellules du surnageant et remettre en suspension avec 1 ml de milieu de cellules gustatives.

4. Propagation de cellules fongiformes homme papilles gustatives

  1. Transfert des cellules en T25 assiette et ajouter 4 ml de milieu cellules gustatives (passage 0). Maintenir les cellules à 36 ° C dans un incubateur humidifié contenant 5% de CO 2.
  2. Remplacer 1/3 de tous les moyens de 6-7 jours jusqu'à ce que les cellules gustatives culture ont atteint 100% de confluence. A cette époque, pour permettre aux cellules gustatives à la récolte, laver les cellules une fois avec du PBS stérile, puis trypsiniser cellules en utilisant 0,25% p / v de trypsine / EDTA pendant 2-3 minutes à 36 ° C.
  3. Après centrifugation, comme décrit ci-dessus, remettre en suspension dans un milieu de goût cellule complète et les cellules de transfert de frais flacons T-75 (passage 1).
  4. Remplacer 1/3 de tous les moyens de 6-7 jours. Ne changez pas le plus souvent à moyen et / ou complètement.
  5. Répétez l'étape 4.3 et 4.4 lorsque les cellules ont atteint près de 100% de confluence. Fractionner les cellules à pas plus que la dilution 1:4 dans un flacon T75suffisante pour maintenir la croissance des cellules dans le temps.

5. Le gel et le dégel de culture de l'homme des cellules fongiformes goût papilles

  1. Pour congeler des stocks de cellules gustatives primaires, après trypsinisation (étape 4.2), ajouter 3 ml de milieu complet cellules gustatives et des cellules de transfert aux stériles tubes de 15 ml à centrifuger coniques. Centrifuger à 2500 rpm pendant 5 min à température ambiante.
  2. Retirez délicatement les cellules surnageantes et Resuspendre doucement avec un volume approprié de milieu de congélation contenant 95% sérum de veau fœtal (FBS) et 5% de DMSO.
  3. Transfert cellules étiquetées, stérile cryotubes, fermer hermétiquement, et placer dans un récipient contenant de l'isopropanol de congélation. Placer dans un congélateur à -80 ° C pendant au moins un jour avant de transférer indéfiniment à l'azote liquide.
  4. Pour décongeler un flacon de surgelés cellules primaires humaines fongiformes papilles gustatives, le lieu à 37 ° C bain-marie jusqu'à ce que tout décongelé (environ 1 minute), tout en travaillant dans une culture cellulaire à flux laminairehotte.
  5. Transfert cellules et le milieu de congélation à une tube de 15 ml stérile à centrifuger conique et ajouter 5 ml de milieu de culture cellulaire goût.
  6. Centrifuger les cellules à 2500 rpm pendant 5 min à température ambiante. Eliminer délicatement le surnageant, les cellules Resuspendre doucement avec le milieu de culture complet goût cellule, et le transfert à un stérile T-25 flacon de culture tissulaire.
  7. Continuer à cultiver des cellules selon l'une étape 3 à 4.

6. Les résultats représentatifs

Les tentatives visant à pousser les biopsies goût de la culture ont réussi 90% du temps. Quelques jours après la biopsie et de la dissociation, les cellules généralement commencé à croître et migrer vers l'extérieur à partir des morceaux de tissu fongiformes disséqué qui sont restés après la procédure de dissociation. Bien que les cellules individuelles étaient visibles 24-48 heures après le placage (figure 1A), les cellules ont augmenté pour un maximum de 2-3 semaines dans des amas de cellules jointes, à l'occasion de générer des cellules filles (figure 1B). De biopsie4-8 ING humaine fongiformes papilles, isolats initiaux de cellules primaires humaines fongiformes papilles gustatives atteignent environ 2000 - 8000 cellules dans 4 semaines de culture. Expansion dans des flacons T25 de culture cellulaire (passage 0) pour 3-4 semaines supplémentaires se traduira par des cellules humaines ayant fongiformes goût papilles dans la culture adaptée (figure 1C). Primaires des cellules fongiformes goût papilles peut être élargi à la culture pour donner vers le haut d'au moins un million de cellules par passage-1 en 3-4 semaines (figure 1D). Cellules gustatives primaires va continuer à croître pendant plus de 8 passages.

La morphologie des cellules en culture fongiformes homme papilles gustatives de la culture était similaire à des cultures de cellules chimiosensoriels décrit précédemment 11,12 .. La plupart des cellules humaines en culture fongiformes goût papilles ont maintenu leur aspect d'origine compacte de corps cellulaires avec ou sans un ou plusieurs processus jusqu'à 15-30 jours. Après avoir atteint la confluence de la culture la plus CElls avaient une apparence polarisée-allongée. Cellules gustatives adultes se composent de plusieurs différents sous-types histologiques et caractéristiques gustatives d'exposition de cellules spécifiques. Ici, nous montrons que les cellules au sein de ces cultures présentent plusieurs caractéristiques moléculaires et physiologiques caractéristiques des cellules gustatives matures. Gustducin et la phospholipase C - β2, (PLC-β2) ARNm ont été détectés par réaction en chaîne de la transcriptase inverse-polymérase et des produits confirmés par séquençage (figure 2). Expression de gustducin et PLC-β2 a été détectée par immunocytochimie indiquant la présence de type II comme-cellules (figure 3 B et D, respectivement). La prévalence et les modes d'expression relatifs de gustducin et PLC-β2 reflétant voies de signalisation cellulaire et des types de cellules ne reflète pas précisément celle observée in vivo. Les facteurs qui régissent la répartition relative des différents types de cellules au sein d'un bourgeon du goût ne sont pas connus, et ne peut être reproduit dans des conditions de culture. Par conséquent, b Oth les similitudes et les différences entre les cellules en culture et leur homologues dans les in vivo fournissent l'occasion d'examiner la réglementation de ces caractéristiques à un niveau moléculaire, dans des conditions qui peuvent être manipulés et contrôlés.

Un critère important pour un système modèle est la présence de propriétés fonctionnelles pertinentes. Les cellules cultivées également présenté des augmentations robustes en calcium intracellulaire en réponse à des concentrations appropriées de stimuli gustatifs plusieurs (figure 4). Dans ces études, les stimuli douces et amères provoquer une augmentation du calcium intracellulaire qui peut correspondre à une dépolarisation. Ces cellules, comme le goût des propriétés des cellules cultivées apporter un soutien à l'affirmation que le système modèle que nous décrivons ici sera un atout précieux pour poursuivre des études des voies de transduction et la capacité régénératrice des cellules gustatives de l'homme.

fig1.jpg "/>
Figure 1. Attachement et la morphologie des cellules cultivées fongiformes homme papilles gustatives. Primaires de l'homme fongiformes cultures cellulaires goût papilles cultivées sur des plaques de collagène de type 1 enrobés ont été imagées au bout de 2 jours (a). Les cellules fongiformes papilles gustatives ont augmenté pour un maximum de 4 semaines sous des amas de cellules attachées, qui semblaient donner lieu à des cellules filles. Les cellules généralement augmenté au confluent dans les quatre semaines (B), et (C et D) représente le jour 2 et 4 semaines après la récolte et le réensemencement, respectivement. Les cellules cultivées ont continué à croître pendant au moins 8 mois. Barres d'échelle = 50 nm. Une partie de la figure 1 a également été présenté dans Özdener et. al. 10.

Figure 2
Figure 2. RT-PCR résultats ont démontré la présence d'ARNm spécifiques de biomarqueurs cellulaires goût (gustducin et PLC-β2,). L'ARN total à partir de cultures de cellules fongiformes de l'homme était transc inverseribed utilisant l'exposant d'abord Système de synthèse de brin pour la RT-PCR (Invitrogen) et utilisé pour la PCR par amplification avec des amorces spécifiques conçus pour la détection de gustducin et PLC-β2. Primaires (Tableau 1) ont été choisis pour couvrir un ou plusieurs introns. Chaque ARNm a été détecté dans des cultures de cellules humaines fongiformes papilles gustatives de passage 4 ou 5 avec des produits d'amplification de la taille attendue, a confirmé par séquençage. ARNm spécifique n'a été détecté dans des expériences de contrôle sans transcriptase inverse indiquant l'absence de contamination de l'ADN génomique. Les produits de PCR ont été séparés sur gels d'agarose 2% et les produits amplifiés sur le gel ont été excisées avec un rasoir. L'ADN a été extrait du gel en utilisant QIAquick Gel Extraction Kit (Qiagen). Les produits de PCR ont été séquencés à l'Université de Pennsylvanie installations de séquençage. C-PCR et RT-C sont des expériences de contrôle pour la PCR et la transcriptase inverse, respectivement. Une partie de la figure 2 a également été présenté dans Özdener et. Al.

Figure 3
Figure 3. Immunomarquage de la culture fongiformes papilles passage les cellules humaines goût 4 ou 5 ont montré la présence de biomarqueurs cellulaires goût. De culture des cellules humaines fongiformes goût papilles (5 jours) ont été fixées avec du paraformaldéhyde à 4%, et incubées avec des anticorps primaires (tableau 2) une nuit à 4 ° C. Les images ont été acquises avec un Leica TCS-SP2 microscope confocal à balayage laser. Environ, 60% des cellules en culture fongiformes papilles gustatives ont été marqués avec gustducin (B) et de 20-30% avec le PLC-β2 (D). Images de transmission de cellules correspondantes sont représentées (A et C). Pour les contrôles, immunomarquage avec un anticorps spécifique d'immunoglobuline a démontré l'absence d'immuno réactivité non spécifique (données non présentées). Barres d'échelle = 50 nm. Partiede la figure 3 a également été présenté dans Özdener et. al. 10.

Figure 4
Figure 4. De culture des cellules humaines fongiformes goût papilles de passage 4 ou 5 répondre à différents stimuli. De culture des cellules humaines fongiformes goût papilles (4-5 jours) ont été chargées avec 1 mM Fura-2 AM (Molecular Probes) et 10 mg / ml Pluronic F127 (Molecular Probes). Changements dans les niveaux de calcium intracellulaire ([Ca 2 +] i) dans des cellules cultivées fongiformes homme papilles gustatives ont été mesurés en utilisant des techniques d'imagerie manuelles. Les cellules ont été visualisés à l'aide d'un microscope inversé à fluorescence à des longueurs d'onde d'excitation de 340 nm et 380 nm et une longueur d'onde d'émission fixée par un filtre passe-bande centré à 510 nm. Les stimuli ont été dissous dans une solution de bain, puis le pH et l'osmolarité réajusté si nécessaire. De culture des cellules humaines fongiformes goût papilles répondu aux stimuli douces et amères. GGRAPHIQUES illustrer les réponses représentatives de [Ca +2] i les niveaux dans des cellules individuelles pendant l'exposition à (A) dénatonium (2 mM), (B) Le sucralose (1 mM). Chaque trace représente simples cellules individuelles.

Gène Séquence État PCR La taille prévue
(Pb)
Référence
β-actine GGACTTCGAGCAAGAGATGG
AGCACTGTGTTGGCGTACAG
7 min
45 sec
45 sec
45 sec
7 min
95
94
53
72
72
234 NM_001101.3
Gustducin TCTGGGTATGTGCCAAATGA
GGCCCAGTGTATTCTGGAAA
7 min
45 sec
45 sec
45 sec
7 min
95
94
53
72
72
386 NM_001102386
PLC-β2 GTCACCTGAAGGCATGGTCT
TTAAAGGCGCTTTCTGCAAT
3 min
30 sec
30 sec
60 sec
7 min
95
94
53
72
72
333 NM_004573

Tableau 1. Les amorces et les conditions utilisées pour la détection de molécules gustatives spécifiques.

Anticorps primaire Source Hôte Dilution Anticorps secondaire Source Hôte Dilution
Gustducin Santacruz Lapin 1:500 Anti-IgG de lapin Alexa 633 Molecular Probes Chèvre 1:500
PLC-β 2 Santacruz Lapin 1:500 Anti-IgG de lapin Alexa 633 Molecular Probes Chèvre 1:500

Anticorps Tableau 2. Utilisé pour détecter l'expression de molécules spécifiques.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Nous avons maintenu les cellules obtenues à partir de papilles fongiformes goût humain depuis plus de 8 passages, couvrant une période de 12 mois. Ces cultures de générer de nouvelles cellules, dont beaucoup viennent à échéance in vitro à l'étape où ils expriment des marqueurs de plusieurs types de cellules matures goût de bourgeon, en plus de clés propriétés moléculaires et physiologiques de cellules réceptrices du goût. La présence de gustducin et PLC-β2 immunoréactivité en sous-ensembles de cellules en culture est compatible avec cette conclusion. Plus important encore, certaines cellules ont répondu aux demandes de stimuli du goût sucré et amer à des augmentations transitoires de calcium intracellulaire, qui est une caractéristique des cellules gustatives dissociés 5, les cellules en tranches 3 et les goûts de l'homme de culture et les cellules gustatives rat 19,10. Ceci indique non seulement que certaines des cellules en culture ont exprimé des récepteurs moléculaires pour sucré et l'amer, mais qu'ils en avaient assez de la cascade couplés aux protéines G de transduction de générer calcieuh réponses.

À long terme des cultures de cellules primaires ne peuvent souvent pas maintenir le tissu d'origine et la structure des cellules et des facteurs cellulaires qui peuvent jouer un rôle dans la fonction physiologique des cellules. Par succès à long terme mise en place de la culture du goût humain fongiformes cellules papilles, de grands progrès n'a encore été prise, un certain nombre de limitations doivent être mentionnés. Au premier rang de ceux-ci, c'est que chaque lot de cellules primaires en culture peut varier en raison des différences dans la population initiale de cellules utilisées pour démarrer la culture. Des cultures de cellules primaires manquent souvent de l'organisation des tissus d'origine et de la structure et des facteurs de croissance qui jouent un rôle dans la fonction physiologique des cellules. Les cellules sont souvent pas toujours et entièrement en contact avec d'autres cellules, comme les cultures ne sont jamais passé à 100% de confluence. En général, les cellules primaires sont également soumis à la dédifférenciation, et l'instabilité chromosomique, caractérisé par des pertes ou des gains de chromosomes lors de la réplication cellulaire dans la cellule continue linda, peut-être un autre problème 13,14,15. La comparaison des cultures de cellules humaines avec des cellules fongiformes nontaste culture de la langue doit être exploré. Ces questions nécessiteront l'utilisation de nombreuses approches expérimentales et des systèmes de modèle avant notre compréhension est terminée.

En conclusion, ce protocole décrit ici permet de maintenir les cellules humaines fongiformes goût papilles in vitro pendant au moins 8 passages (12 mois) sans perdre les caractéristiques pertinentes des cellules physiologiques et moléculaires. La poursuite du développement de cette culture à long terme primaire sera de fournir un système modèle pour les études de la prolifération et la différenciation, la spécificité de relance, la diaphonie et les propriétés d'adaptation de l'homme des cellules réceptrices du goût, ainsi que la régénération des tissus. En outre, les effets des conditions qui nuisent à la fonction des cellules du goût comme une infection, les médicaments, les rayonnements, les expositions toxiques ou chimiques peuvent être examinées aux niveaux moléculaires et physiologiques.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Pas de conflits d'intérêt déclarés.

Acknowledgments

Nous tenons à remercier Aimee Myers et Quayson Esi pour les compétences techniques et d'aide. Ce travail a été soutenu en partie par la NSF 0216310 et Givaudan Inc subvention de scolarisation (TNS).

References

  1. Mbiene, J. P., Maccallum, D. K., Mistretta, C. M. Organ cultures of embryonic rat tongue support tongue and gustatory papilla morphogenesis in vitro without intact sensory ganglia. J. Comp. Neurol. 377, 324-340 (1997).
  2. Miyamoto, T., Fujiyama, R., Okada, Y., Sato, T. Strain difference in amiloride-sensitivity of salt-induced responses in mouse non-dissociated taste cells. Neurosci. Lett. 277, 13-16 (1999).
  3. Caicedo, A., Jafri, M. S., Roper, S. D. In situ Ca2+ imaging reveals neurotransmitter receptors for glutamate in taste receptor cells. J. Neurosci. 20, 7978-7985 (2000).
  4. Qin, Y. M., Shi, J. Q., Zhang, G. H., Deng, S. P., Wang, T. H. A reliable method to obtain cells of taste buds from fungiform papillae of mice. Acta Histochem. 112, 107-112 (2010).
  5. Spielman, A. I., Mody, I., Brand, J. G., Whitney, G., MacDonald, J. F., Salter, M. W. A method for isolating and patch-clamping single mammalian taste receptor cells. Brain Res. 503, 326-329 (1989).
  6. Kishi, M., Emori, Y., Tsukamoto, Y., Abe, K. Primary culture of rat taste bud cells that retain molecular markers for taste buds and permit functional expression of foreign genes. Neuroscience. 106, 217-225 (2001).
  7. Ruiz, C. J., Stone, L. M., McPheeters, M., Ogura, T., Bottger, B., Lasher, R. S., Finger, T. E., Kinnamon, S. C. Maintenance of rat taste buds in primary culture. Chem. Senses. 26, 861-873 (2001).
  8. Stone, L. M., Tan, S. S., Tam, P. P., Finger, T. E. Analysis of cell lineage relationships in taste buds. J. Neurosci. 22, 4522-4529 (2002).
  9. Ozdener, H., Yee, K. K., Cao, J., Brand, J. G., Teeter, J. H., Rawson, N. E. Characterization and long-term maintenance of rat taste cells in culture. Chem. Senses. 31, 279-290 (2006).
  10. Ozdener, M. H., Brand, J. G., Spielman, A. I., Lischka, F. W., Teeter, J. H., Breslin, P. A., Rawson, N. E. Characterization of Human Fungiform Papillae Cells in Culture. Chem. Senses. 36, 601-612 (2011).
  11. Gomez, G., Rawson, N. E., Hahn, C. G., Michaels, R., Restrepo, D. Characteristics of odorant elicited calcium changes in cultured human olfactory neurons. J. Neurosci. Res. 62, 737-749 (2000).
  12. Wolozin, B., Sunderland, T., Zheng, B. B., Resau, J., Dufy, B., Barker, J., Swerdlow, R., Coon, H. Continuous culture of neuronal cells from adult human olfactory epithelium. J. Mol. Neurosci. 3, 137-146 (1992).
  13. Wick, N., Saharinen, P., Saharinen, J., Gurnhofer, E., Steiner, C. W., Raab, I., Stokic, D., Giovanoli, P., Buchsbaum, S., Burchard, A., Thurner, S., Alitalo, K., Kerjaschki, D. Transcriptomal comparison of human dermal lymphatic endothelial cells ex vivo and in vitro. Physiol. Genomics. 17, 179-192 (2007).
  14. Fu, L., Zhu, L., Huang, Y., Lee, T. D., Forman, S. J., Shih, C. C. Derivation of neural stem cells from mesenchymal stemcells: evidence for a bipotential stem cell population. Stem Cells Dev. 17, 1109-1121 (2008).
  15. Sandow, S. L., Grayson, T. H. Limits of isolation and culture: intact vascular endothelium and BKCa. Am. J. Physiol. Heart Circ. Physiol. 297, H1-H7 (2009).
Isolement et culture de cellules humaines fongiformes papilles gustatives
Play Video
PDF DOI

Cite this Article

Ozdener, H., Spielman, A. I., Rawson, N. E. Isolation and Culture of Human Fungiform Taste Papillae Cells. J. Vis. Exp. (63), e3730, doi:10.3791/3730 (2012).More

Ozdener, H., Spielman, A. I., Rawson, N. E. Isolation and Culture of Human Fungiform Taste Papillae Cells. J. Vis. Exp. (63), e3730, doi:10.3791/3730 (2012).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter