Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Neuroscience

Isolamento e la coltura di cellule umane Gusto papille fungiformi

doi: 10.3791/3730 Published: May 17, 2012

Summary

Abbiamo puntato a sviluppare un protocollo riproducibile per isolare e mantenere a lungo termine colture di cellule umane papille gustative fungiformi. Le cellule di papille fungiformi umana ottenuti con la biopsia sono stati correttamente mantenuti in coltura per più di otto passaggi (12 mesi) senza perdita di vitalità.

Abstract

Gusto cellule sono altamente specializzati, con uniche istologiche, caratteristiche molecolari e fisiologiche che permettono il rilevamento di una vasta gamma di stimoli semplici e complessi molecole chimiche contenute negli alimenti. In umana, individuale papille fungiformi contengono da zero a un massimo di 20 papille gustative. Non vi è alcun protocollo stabilito per cellule gustative coltura umane, anche se la capacità di mantenere papille gustative cellule in coltura per più cicli cellulari sarebbe di notevole utilità per caratterizzare le proprietà molecolari, rigenerativa, e funzionali di queste cellule uniche sensoriali. Gli studi precedenti di cellule gustative sono stati condotti utilizzando cellule isolate fresco in coltura primaria, culture espianti da roditori, o semi-intatte le papille gustative in fette di tessuto 1,2,3,4. Sebbene ciascuna di queste preparazioni di vantaggi, lo sviluppo delle colture a lungo termine avrebbe fornito vantaggi significativi, in particolare per studi di proliferazione cellulare gusto e differentiation. Diversi gruppi, compreso il nostro, sono stati interessati nello sviluppo e nella definizione di modelli di coltura delle cellule gustative. La maggior parte dei tentativi di cellule gustative della cultura hanno riferito di agibilità limitata, con cellule di solito non durano oltre il 3-5 d 5,6,7,8. Recentemente abbiamo segnalato su un metodo di successo per la cultura estesa di cellule gustative roditore 9. Noi qui riferire per la prima volta l'istituzione di un sistema di coltura in vitro di cellule umane isolate papille gustative fungiformi. Le cellule di papille fungiformi umana ottenuti con la biopsia sono stati correttamente mantenuti in coltura per più di otto passaggi (12 mesi) senza perdita di vitalità. Cellule visualizzato molte caratteristiche molecolari e fisiologiche caratteristici delle cellule mature gustative. Gustducin e fosfolipasi C β2, (β2-PLC) mRNA sono stati rilevati in molte cellule di trascrittasi inversa-reazione polimerasica a catena e confermato tramite sequenziamento. Analisi immunocitochimica dimostrato la presenza di rafficaespressione ducin e PLC-β2 in coltura cellule gustative. Colture di cellule umane fungiformi anche mostrato un aumento del calcio intracellulare in risposta a stimoli concentrazioni appropriate di diversi gusti e indicano che i recettori gusto e almeno alcune delle vie di segnalazione erano presenti. Questi risultati indicano che sufficienti cellule gustative di esseri umani adulti può essere generata e mantenuta per almeno otto passaggi. Molte delle cellule conservano caratteristiche fisiologiche e biochimiche di cellule isolate dal acutamente l'epitelio gusto degli adulti per sostenere il loro uso come sistema modello di gusto. Questo sistema consentirà ulteriori studi dei processi coinvolti nella proliferazione, differenziamento e la funzione delle cellule di mammifero recettori gusto in un preparato in vitro.

Umano papille gustative fungiformi utilizzato per la determinazione umana coltura cellulare fungiformi sono stati donati per la ricerca, seguendo le apposite consenso informato ai sensi dei protocolli di ricerca che sono stati recensionee approvato dal comitato IRB. Il protocollo (# 0934) è stato approvato dalla Schulman Institutional Review Board Associates Inc., Cincinnati, OH. Protocollo scritto qui di seguito si basa su parametri pubblicati segnalati da Ozdener et al. 2011 10.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. Ottenere umana papille gustative fungiformi

  1. Rimuovere 4-8 umana papille gustative fungiformi dalla superficie dorsale della porzione anteriore della lingua utilizzando microscissors primavera curve.
  2. Inserire immediatamente in una soluzione di isolamento (26 mM NaHCO 3, 2,5 mM NaH 2 PO 4, 20 mM di glucosio, 65 mM NaCl, 20 mM KCl, e 1 mM EDTA disciolto in acqua priva di nucleasi e sterilizzato per filtrazione).

2. Umano digestione Papille fungiformi Taste

Umano papille gustative fungiformi cella può essere dissociato utilizzando due differenti protocolli digestione enzimatica con lievi differenze.

  1. Incubare papille fungiformi in soluzione di isolamento con pronasi (1 mg / ml, Sigma Aldrich) e elastasi (1 mg / ml Sigma Aldrich) a temperatura ambiente per 30-45 min (protocollo 1).
  2. Incubare papille fungiformi con collagenasi di tipo I (550 U / mL, da Worthington) + elastasi (10 U / mL, dal Worthington) + inibitore della tripsina (0,9 mg / mL, da Worthington) in 2 ml di soluzione di calcio Ringer libero in 35 ° C Il metodo bagnomaria con circolazione per 30 minuti e l'ossigenazione delicata con il 95% O 2/5% di CO 2. (Alternativa per la digestione, protocollo 2)
  3. Dopo l'incubazione, lavare papille con suoneria e triturare le papille lucido fuoco pipetta Pasteur di vetro per 10 volte.
  4. Centrifugare per 3 minuti a 2500 rpm a temperatura ambiente e rimuovere la soluzione di isolamento e aggiungere 1 ml di mezzo di coltura cellulare gusto.
  5. Trasferimento digerito papille fungiformi nel piatto di vetro.
  6. Staccare delicatamente con papille fungiformi rasoio chirurgico.
  7. Aggiungere 250 microlitri di papille sezionato nel cilindro clonazione sul vetrino collagene coda di topo di tipo-1 rivestito.
  8. Aggiungere 1 ml di mezzo di coltura cellulare gusto in ciascun pozzetto.

3. Coltura di cellule umane Gusto papille fungiformi

  1. Incubare la piastra a 36 ° C in un umidificataincubatore contenente il 5% di CO 2.
  2. Mettere in un indisturbato incubatore per 2 giorni prima del primo cambio di terreno completo. Gusto cellule finalmente legarsi al vetrino rivestito, anche se non può essere chiaramente visibile in 1 a 3 giorni.
  3. Rimuovere la clonazione cilindro dalla piastra e medie completamente e aggiungere 1 ml di terreno gusto cellulare in ciascun pozzetto.
  4. Sostituire 1/3 di media ogni 6-7 giorni. Non modificare medie più spesso e / o completamente.
  5. Controllare la crescita delle cellule sotto microscopio ogni altro giorno. La maggior parte delle nuove cellule crescere sotto gruppi di cellule. Gruppi di cellule di solito staccare dopo 2-3 settimane in coltura lasciando le nuove cellule generate.
  6. Dopo 40-50% del cilindro clonazione è coperto in espansione cellule gustative, Tripsinizzare le cellule che utilizzano 0,25% w / v di tripsina / EDTA per 2-3 minuti a 36 ° C.
  7. Trasferire cellule di pozzetti in provette da 15 ml, aggiungere 3 volumi di mezzo di coltura cellulare gusto seguita da centrifugazione a 3000 rpm per 5 minuti a carattere stanzaperatura.
  8. Rimuovere le cellule supernatante e risospendere con 1 ml di mezzo il gusto delle cellule.

4. Propagazione di cellule umane Gusto papille fungiformi

  1. Trasferire le cellule in T25 piatto e aggiungere 4 ml di terreno gusto cellulare (passaggio 0). Mantenere le cellule a 36 ° C in un incubatore umidificato contenente il 5% CO 2.
  2. Sostituire 1/3 di ogni 6-7 giorni medi fino cellule gustative coltura ha raggiunto il 100% confluenza. A questo punto, per consentire cellule gustative di raccolta, le cellule lavare una volta con PBS sterile quindi Tripsinizzare le cellule che utilizzano 0,25% w / v di tripsina / EDTA per 2-3 minuti a 36 ° C.
  3. Dopo centrifugazione come descritto sopra, risospendere in mezzo completo cella gusto e trasferire le cellule a nuove T-75 beute (passaggio 1).
  4. Sostituire 1/3 di media ogni 6-7 giorni. Non modificare medie più spesso e / o completamente.
  5. Ripetere il punto 4.3 e 4.4 quando le cellule hanno raggiunto quasi il 100% di confluenza. Split cellule a non più di diluizione 1:4 in una beuta T75per mantenere un'adeguata crescita delle cellule nel tempo.

5. Congelamento e lo scongelamento coltivate cellule umani fungiformi papille gustative

  1. Per bloccare le scorte di cellule gustative primarie, dopo tripsinizzazione (passo 4.2), aggiungere 3 ml completo medie cellulare gusto e trasferire le cellule sterili 15 provette ml. Centrifugare a 2500 rpm per 5 min a temperatura ambiente.
  2. Rimuovere delicatamente le cellule supernatante e Risospendere delicatamente con volume appropriato di congelamento mezzo contenente 95% siero bovino fetale (FBS) e 5% DMSO.
  3. Trasferimento cellule etichettato, sterile cryovials, cap stretto, e posto in un contenitore al congelamento contenenti isopropanolo. Inserire in un congelatore a -80 ° C per almeno un giorno prima di trasferire indefinitamente in azoto liquido.
  4. Per scongelare un flacone di surgelati cellule primarie umane papille gustative fungiformi, posto a 37 ° C bagnomaria fino a poco sciolto (circa 1 minuto), mentre lavorava in un flusso laminare coltura cellularecappuccio.
  5. Trasferimento di cellule e medie di congelamento ad un tubo da centrifuga sterile 15 ml ed aggiungere 5 ml di terreno di coltura delle cellule gusto.
  6. Centrifugare celle a 2500 rpm per 5 min a temperatura ambiente. Gettare il surnatante con cura, le cellule Risospendere delicatamente con completo mezzo di coltura cellulare gusto, e il trasferimento ad una sterile T-25 pallone di coltura di tessuti.
  7. Continuare a cellule di coltura in base al punto 3 a 4.

6. Risultati rappresentativi

I tentativi di crescere in cultura biopsie gusto avuto successo 90% del tempo. Pochi giorni dopo la biopsia e la dissociazione, le cellule di solito ha cominciato a crescere e migrare verso l'esterno i pezzi di tessuto fungiformi sezionato che sono rimasti dopo la procedura di dissociazione. Sebbene le celle individuali erano visibili 24-48 ore dopo la placcatura (Figura 1A), cellule cresciuta fino a 2-3 settimane di età inferiore a cluster cellulari allegate, occasionalmente generando cellule figlie (figura 1B). Dalla biopsiaING 4-8 umana papille fungiformi, isolati iniziali di cellule primarie umane papille gustative fungiformi raggiungere circa 2000 - 8000 in 4 settimane le cellule in coltura. Espansione in fiasche di coltura cellulare T25 (passaggio 0) per ulteriori 3-4 settimane porterà ad avere umani papille gustative fungiformi cellule in coltura adatto (Figura 1C). Cellule primarie umane fungiformi papille gustative può essere ulteriormente ampliato in coltura a cedere verso l'alto di almeno un milione di cellule per passaggio-1 in 3-4 settimane (Figura 1D). Cellule gustative primarie continuerà a crescere per più di 8 passaggi.

La morfologia delle cellule umane in coltura papille gustative fungiformi della cultura era simile a una coltura di cellule chemosensoriali descritto in precedenza 11,12 .. La maggior parte umane in coltura cellule papille gustative fungiformi hanno mantenuto la loro aspetto originale compatto di corpi cellulari con o senza uno o più processi fino a 15-30 giorni. Dopo aver raggiunto la maggior confluenza del colta ceLLS aveva un aspetto allungata-polarizzata. Cellule gustative mature composto da diversi sottotipi istologici diversi e presentano caratteristiche specifiche delle cellule gustative. Qui mostriamo che le cellule all'interno di queste culture presentano molte caratteristiche molecolari e fisiologiche tipiche delle cellule gustative mature. Gustducin e fosfolipasi C - β2, (β2-PLC) mRNA sono state rilevate mediante trascrittasi inversa-reazione a catena della polimerasi e prodotti confermato tramite sequenziamento (Figura 2). Espressione di gustducin e PLC-β2 stato rilevato immunocytochemically indica la presenza di tipo II cellule simili (Figura 3 B e D, rispettivamente). La prevalenza e modelli di espressione relativi gustducin e PLC-β2 che riflette i percorsi di segnalazione cellulare e tipi di cellule non riflettono precisamente quello osservato in vivo. I fattori che regolano la distribuzione relativa dei diversi tipi di cellule all'interno di una papilla gustativa sono sconosciuti, e non possono essere replicati nelle condizioni di coltura. Pertanto, b nor le somiglianze e le differenze tra le cellule coltivate e le loro controparti in vivo offrono l'opportunità di esaminare la regolamentazione di queste caratteristiche a livello molecolare, in condizioni che possono essere manipolati e controllati.

Un criterio importante per un sistema modello è la presenza di rilevanti proprietà funzionali. Cellule in coltura esposti anche aumenti robusti del calcio intracellulare in risposta a stimoli concentrazioni appropriate di diversi gusti (Figura 4). In questi studi, stimoli dolci e amaro provocare un aumento nel calcio intracellulare, che può corrispondere ad una depolarizzazione. Queste cellule, come il gusto le proprietà delle cellule coltivate appoggiare l'affermazione che il modello di sistema che descriviamo qui sarà una risorsa preziosa per ulteriori studi delle vie di trasduzione e capacità rigenerativa delle cellule gustative umane.

fig1.jpg "/>
Figura 1. Attaccamento e la morfologia di colture di cellule umane papille gustative fungiformi. Primari umani fungiformi papille gustative colture di cellule coltivate in piastre di collagene di tipo-1 rivestiti sono stati ripresi dopo 2 giorni (A). Fungiformi cellule umane papille gustative è cresciuto fino a 4 settimane in gruppi di cellule allegati, che sembravano dare origine a cellule figlie. Le cellule in genere è cresciuta alla confluenza entro quattro settimane (B), e (C e D) rappresenta il giorno 2 e 4 settimane dopo la raccolta e reseeding rispettivamente. Cellule in coltura hanno continuato a crescere per almeno 8 mesi. Barre di scala = 50 nm. Parte della figura 1 è stata presentata anche in Ozdener et. al. 10.

Figura 2
Figura 2. RT-PCR risultati hanno dimostrato la presenza di mRNA specifici delle cellule gustative biomarker (gustducin e PLC-β2,). L'RNA totale da colture di cellule umane era fungiformi transc inversoribed utilizzando la Superscript primo sistema di sintesi del filamento per RT-PCR (Invitrogen) e utilizzato per PCR da amplificare con primer specifici progettati per il rilevamento di gustducin e di PLC-β2. Primers (Tabella 1) sono stati scelti per coprire uno o più introni. Ogni mRNA è stata rilevata in colture di cellule umane papille gustative fungiformi da passaggio 4 o 5 con prodotti di amplificazione della dimensione prevista, confermato mediante sequenziamento. MRNA specifico non è stata rilevata in esperimenti di controllo senza trascrittasi inversa indica nessuna contaminazione di DNA genomico. I prodotti di PCR sono stati separati su gel di agarosio 2% e dei prodotti amplificati sul gel sono state escisse con un rasoio. DNA è stato estratto dal gel usando QIAquick Gel Extraction Kit (Qiagen). I prodotti di PCR sono stati sequenziati presso l'Università di Pennsylvania strutture sequenziamento. C e C-PCR-RT sono esperimenti di controllo per la PCR e la trascrittasi inversa, rispettivamente. Parte di figura 2 è stata presentata anche in Ozdener et. al.

Figura 3
Figura 3. Immunostaining di coltura umana gusto papille fungiformi passaggio cellule 4 o 5 ha mostrato la presenza di biomarcatori delle cellule gustative. Coltivate cellule umane fungiformi papille gustative (5 giorni) sono state fissate con 4% paraformaldeide, ed incubate con anticorpi primari (Tabella 2) notte a 4 ° C. Le immagini sono state acquisite con uno TCS-SP2 microscopio a scansione laser confocale Leica. Circa il 60% delle cellule in coltura fungiformi papille gustative sono stati etichettati con gustducin (B) e 20-30% con PLC-β2 (D). Immagini trasmissione di cellule corrispondenti sono mostrati (A e C). Per i controlli, immunocolorazione con immunoglobulina specifica dimostrato l'assenza di reattività aspecifica immuno (dati non mostrati). Barre di scala = 50 nm. Partedella figura 3 è stata presentata anche in Ozdener et. al. 10.

Figura 4
Figura 4. Umane coltivate cellule gustative papille fungiformi passaggio da 4 o 5 di rispondere a stimoli diversi. Coltivate cellule umane fungiformi papille gustative (4-5 giorni) sono state caricate con Fura 1mM-2 AM (Molecular Probes) e 10 mg / ml Pluronic F127 (Molecular Probes). Variazioni dei livelli intracellulari di calcio ([Ca 2 +] i) in colture di cellule umane fungiformi papille gustative sono stati misurati utilizzando le normali tecniche di imaging manuali. Le cellule sono state visualizzate utilizzando un microscopio a fluorescenza invertito a lunghezze d'onda di eccitazione di 340 nm e 380 nm e una lunghezza d'onda di emissione fissato da un filtro passa banda centrato a 510 nm. Gli stimoli sono stati disciolti in soluzione Bath e poi pH e osmolarità riadattato se necessario. Colture di cellule umane fungiformi papille gustative hanno risposto agli stimoli dolci e amare. Graphs illustrano risposte rappresentativi di [Ca +2] i livelli in singole cellule durante l'esposizione a (A) Denatonium (2 mM), (B) sucralosio (1 mM). Ciascuna traccia rappresenta singole cellule singole.

Gene Sequenza PCR condizione Dimensioni attese
(Bp)
Riferimento
β-Actina GGACTTCGAGCAAGAGATGG
AGCACTGTGTTGGCGTACAG
7 min
45 sec
45 sec
45 sec
7 min
95
94
53
72
72
234 NM_001101.3
Gustducin TCTGGGTATGTGCCAAATGA
GGCCCAGTGTATTCTGGAAA
7 min
45 sec
45 sec
45 sec
7 min
95
94
53
72
72
386 NM_001102386
PLC-β2 GTCACCTGAAGGCATGGTCT
TTAAAGGCGCTTTCTGCAAT
3 min
30 sec
30 sec
60 sec
7 min
95
94
53
72
72
333 NM_004573

Tabella 1. Primers e condizioni usate per rilevare molecole specifiche gusto.

Anticorpo primario Fonte Ospite Diluizione Anticorpo secondario Fonte Ospite Diluizione
Gustducin Santacruz Coniglio 1:500 Anti-IgG di coniglio Alexa 633 Molecular Probes Capra 1:500
PLC-β 2 Santacruz Coniglio 1:500 Anti-IgG di coniglio Alexa 633 Molecular Probes Capra 1:500

Anticorpi Tabella 2. Utilizzato per rivelare l'espressione di molecole specifiche.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Abbiamo mantenuto cellule ottenute da papille fungiformi gusto umano per oltre 8 brani, che coprono un periodo di 12 mesi. Queste colture generano nuove cellule, molti dei quali maturazione in vitro allo stadio dove esprimono marcatori diversi tipi di cellule adulte gusto germoglio, oltre a chiave proprietà molecolari e fisiologiche di cellule recettori gustative. La presenza di gustducin e PLC-β2 immunoreattività in sottogruppi di cellule in coltura è coerente con questa conclusione. La cosa più importante, alcune cellule hanno risposto alle domande degli stimoli gusto dolce e amaro, con aumenti transitori del calcio intracellulare, che è una caratteristica delle cellule gustative dissociate 5, celle a fette papille gustative 3 e umane colta e cellule gustative ratto 19,10. Ciò indica non solo che alcune delle cellule in cultura che si esprime recettori molecolari per la dolce e l'amaro, ma che avevano abbastanza del G-protein coupled cascata di trasduzione per generare Calcium risposte.

Lungo termine colture cellulari primarie spesso non può mantenere il tessuto originale e la struttura cellulare e fattori cellulari che possono giocare un ruolo nella funzione fisiologica di cellule. Con il successo a lungo termine della creazione umana cultura del gusto cellule papille fungiformi, grandi progressi sono stati compiuti ancora, una serie di limitazioni deve essere menzionata. Primo tra questi è che ogni lotto di cellule primarie in coltura può variare a causa delle differenze nella popolazione iniziale di cellule utilizzate per avviare la cultura. Colture cellulari primarie spesso manca l'organizzazione originale tessuto e la struttura e fattori di crescita che giocano un ruolo nella funzione fisiologica di cellule. Le cellule sono spesso non sempre completamente in contatto con altre cellule, come colture non sono coltivate a confluenza del 100%. In generale, le cellule primarie sono inoltre soggetti a de-differenziazione, e l'instabilità cromosomica, caratterizzata da perdite o guadagni di cromosomi durante la replicazione cellulare nella cella li continuanes, può essere un altro problema 13,14,15. Il confronto tra fungiformi colture di cellule umane con cellule in coltura nontaste di lingua deve essere esplorato. Queste domande richiedono l'uso di molti approcci sperimentali e sistemi modello, prima la nostra comprensione è completa.

In conclusione, questo protocollo qui descritto consente di mantenere umane cellule gustative papille fungiformi in vitro per almeno 8 passaggi (12 mesi) senza perdere caratteristiche importanti cellule fisiologiche e molecolari. L'ulteriore sviluppo di questa coltura a lungo termine primario fornirà un sistema modello per lo studio di proliferazione e differenziazione, specificità stimolo, cross-talk e proprietà di adattamento di cellule umane recettore gusto, così come la rigenerazione dei tessuti. Inoltre, gli effetti delle condizioni che compromettono la funzionalità delle cellule gusto, come infezioni, farmaci, radiazioni, sostanze tossiche o chimiche possono essere esaminati a livello molecolare e fisiologico.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Non ci sono conflitti di interesse dichiarati.

Acknowledgments

Ringraziamo Aimee Myers e Quayson Esi per le competenze tecniche e di aiuto. Questo lavoro è stato sostenuto in parte da NSF 0216310 e Givaudan Inc sovvenzione (NER).

References

  1. Mbiene, J. P., Maccallum, D. K., Mistretta, C. M. Organ cultures of embryonic rat tongue support tongue and gustatory papilla morphogenesis in vitro without intact sensory ganglia. J. Comp. Neurol. 377, 324-340 (1997).
  2. Miyamoto, T., Fujiyama, R., Okada, Y., Sato, T. Strain difference in amiloride-sensitivity of salt-induced responses in mouse non-dissociated taste cells. Neurosci. Lett. 277, 13-16 (1999).
  3. Caicedo, A., Jafri, M. S., Roper, S. D. In situ Ca2+ imaging reveals neurotransmitter receptors for glutamate in taste receptor cells. J. Neurosci. 20, 7978-7985 (2000).
  4. Qin, Y. M., Shi, J. Q., Zhang, G. H., Deng, S. P., Wang, T. H. A reliable method to obtain cells of taste buds from fungiform papillae of mice. Acta Histochem. 112, 107-112 (2010).
  5. Spielman, A. I., Mody, I., Brand, J. G., Whitney, G., MacDonald, J. F., Salter, M. W. A method for isolating and patch-clamping single mammalian taste receptor cells. Brain Res. 503, 326-329 (1989).
  6. Kishi, M., Emori, Y., Tsukamoto, Y., Abe, K. Primary culture of rat taste bud cells that retain molecular markers for taste buds and permit functional expression of foreign genes. Neuroscience. 106, 217-225 (2001).
  7. Ruiz, C. J., Stone, L. M., McPheeters, M., Ogura, T., Bottger, B., Lasher, R. S., Finger, T. E., Kinnamon, S. C. Maintenance of rat taste buds in primary culture. Chem. Senses. 26, 861-873 (2001).
  8. Stone, L. M., Tan, S. S., Tam, P. P., Finger, T. E. Analysis of cell lineage relationships in taste buds. J. Neurosci. 22, 4522-4529 (2002).
  9. Ozdener, H., Yee, K. K., Cao, J., Brand, J. G., Teeter, J. H., Rawson, N. E. Characterization and long-term maintenance of rat taste cells in culture. Chem. Senses. 31, 279-290 (2006).
  10. Ozdener, M. H., Brand, J. G., Spielman, A. I., Lischka, F. W., Teeter, J. H., Breslin, P. A., Rawson, N. E. Characterization of Human Fungiform Papillae Cells in Culture. Chem. Senses. 36, 601-612 (2011).
  11. Gomez, G., Rawson, N. E., Hahn, C. G., Michaels, R., Restrepo, D. Characteristics of odorant elicited calcium changes in cultured human olfactory neurons. J. Neurosci. Res. 62, 737-749 (2000).
  12. Wolozin, B., Sunderland, T., Zheng, B. B., Resau, J., Dufy, B., Barker, J., Swerdlow, R., Coon, H. Continuous culture of neuronal cells from adult human olfactory epithelium. J. Mol. Neurosci. 3, 137-146 (1992).
  13. Wick, N., Saharinen, P., Saharinen, J., Gurnhofer, E., Steiner, C. W., Raab, I., Stokic, D., Giovanoli, P., Buchsbaum, S., Burchard, A., Thurner, S., Alitalo, K., Kerjaschki, D. Transcriptomal comparison of human dermal lymphatic endothelial cells ex vivo and in vitro. Physiol. Genomics. 17, 179-192 (2007).
  14. Fu, L., Zhu, L., Huang, Y., Lee, T. D., Forman, S. J., Shih, C. C. Derivation of neural stem cells from mesenchymal stemcells: evidence for a bipotential stem cell population. Stem Cells Dev. 17, 1109-1121 (2008).
  15. Sandow, S. L., Grayson, T. H. Limits of isolation and culture: intact vascular endothelium and BKCa. Am. J. Physiol. Heart Circ. Physiol. 297, H1-H7 (2009).
Isolamento e la coltura di cellule umane Gusto papille fungiformi
Play Video
PDF DOI

Cite this Article

Ozdener, H., Spielman, A. I., Rawson, N. E. Isolation and Culture of Human Fungiform Taste Papillae Cells. J. Vis. Exp. (63), e3730, doi:10.3791/3730 (2012).More

Ozdener, H., Spielman, A. I., Rawson, N. E. Isolation and Culture of Human Fungiform Taste Papillae Cells. J. Vis. Exp. (63), e3730, doi:10.3791/3730 (2012).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter