Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Neuroscience

Isolering og kultur for Human Fungiform Taste papillae Cells

doi: 10.3791/3730 Published: May 17, 2012

Summary

Vi ønsket å utvikle en reproduserbar protokoll for å isolere og vedlikeholde langsiktige kulturer av humane fungiform smak papiller celler. Celler fra menneskelig fungiform papillae fremstilt ved biopsi ble vellykket opprettholdt i kulturen for mer enn åtte passasjer (12 måneder) uten tap av levedyktighet.

Abstract

Smak celler er svært spesialiserte, med unike histologiske, molekylære og fysiologiske egenskaper som tillater påvisning av et bredt spekter av enkle stimuli og komplekse kjemiske molekyler som finnes i matvarer. I menneskelig, individuell fungiform papillae inneholde fra null til så mange som 20 smaksløker. Det er ingen etablert protokoll for dyrking menneskelige smak celler, selv om evnen til å opprettholde smak papiller celler i kultur for flere celle sykluser ville være av stor nytte for å karakterisere den molekylære, regenerativ, og funksjonelle egenskapene til disse unike sanseceller. Tidligere studier av smak celler er gjort med nybakte isolerte celler i primær kultur, eksplantering kulturer fra gnagere, eller semi-intakte smaksløkene i vev skiver 1,2,3,4. Selv om hver av disse preparatene har fordeler, ville utviklingen av langsiktige kulturer har gitt betydelige fordeler, særlig for studier av smak celleproliferasjon og forskjellerrentiation. Flere grupper, blant annet vår, har vært interessert i utvikling og etablering av smak cellekultur modeller. De fleste forsøk på kultur smak celler har rapportert begrenset levedyktighet, med celler vanligvis ikke varige utover 3-5 d 5,6,7,8. Vi har nylig rapportert om en vellykket metode for den utvidede kultur gnager smak celler 9. Vi her rapporterer for første gang etableringen av en in vitro kultur system for isolerte menneskelige fungiform smak papiller celler. Celler fra menneskelig fungiform papillae fremstilt ved biopsi ble vellykket opprettholdt i kulturen for mer enn åtte passasjer (12 måneder) uten tap av levedyktighet. Celler vist mange molekylære og fysiologiske egenskaper som kjennetegner modne smak celler. Gustducin og fosfolipase C β2, (PLC-β2) mRNA ble oppdaget i mange celler ved revers transkriptase-polymerase kjedereaksjon og bekreftet av sekvensering. Immunocytochemistry analyse viste tilstedeværelse av vindkastducin og PLC-β2 uttrykk i dyrkede smak celler. Dyrkede humane fungiform celler også utstilt økninger i intracellulært kalsium i respons til passende konsentrasjoner av flere smaks stimuli som tyder på at smak reseptorer og minst noen av de signalveier var til stede. Disse resultatene indikerer at tilstrekkelig smak celler fra voksne mennesker kan genereres og opprettholdes i minst åtte passeringer. Mange av cellene beholder fysiologiske og biokjemiske egenskaper akutt isolerte celler fra voksne smak epitelet til å støtte deres bruk som en modell smak system. Dette systemet vil gjøre det mulig videre studier av de prosessene som er involvert i spredning, differensiering og funksjon av mammalske smak reseptor celler i en in vitro forberedelse.

Menneskelig fungiform smak papillae brukt for å opprette menneskelig fungiform cellekultur ble donert til forskning etter riktig informert samtykke under forskning protokoller som ble anmeldtog godkjent av IRB komiteen. Protokollen (# 0934) ble godkjent av Schulman Associates Institutional Review Board Inc., Cincinnati, OH. Skriftlig protokoll nedenfor er basert på publiserte parametere som rapporteres av Ozdener et al. 2011 10.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. Innhenting Menneskelig Fungiform Taste papiller

  1. Fjern 07:56 menneskelig fungiform smak papillae fra framsiden av fremre del av tungen med buede våren microscissors.
  2. Plasser umiddelbart inn en isolert løsning (26 mm 3 NaHCO, 2,5 mm NaH 2 4 PO, 20 mM glukose, 65 mM NaCl, 20 mM KCl, og 1 mm EDTA oppløst i nukleasefritt vann og filtrere sterilisert).

2. Menneskelig Fungiform Taste papillae Fordøyelse

Menneskelig fungiform smak celle papiller kan være skilt med to forskjellige enzymatiske fordøyelsen protokoller med små forskjeller.

  1. Inkuber fungiform papillae isolert løsning med pronase (1 mg / ml, Sigma Aldrich) og elastase (1 mg / ml Sigma Aldrich) ved romtemperatur i 30-45 min (protokoll 1).
  2. Inkuber fungiform papillae med collagenase type I (550 U / ml, fra Worthington) + elastase (10 U / ml, fra Worthington) + Trypsin inhibitor (0,9 mg / ml, fra Worthington) i 2 ml kalsium gratis Ringer løsning på 35 ° C vannbad med sirkulasjon i 30 minutter og skånsom Oksygenering med 95% O 2/5% CO 2. (Alternativ metode for fordøyelse, 2 protokoll)
  3. Etter inkubasjon, vask papillae med ringelyd og triturate papillae med ilden polert glass Pasteur pipette for 10 ganger.
  4. Sentrifuger det i 3 minutter ved 2500 rpm på RT og fjerne isolasjon løsning og tilsett 1 ml smak cellekultur medium.
  5. Overfør fordøyd fungiform papillae inn glassfat.
  6. Dissekere fungiform papillae forsiktig med kirurgisk barberhøvel.
  7. Tilsett 250 mL av dissekert papillae inn kloning sylinder på rotte hale kollagen type-1 belagt dekkglass.
  8. Tilsett 1 ml av smak cellekultur medium i hver brønn.

3. Dyrkning av menneskerettigheter Fungiform Taste papillae Cells

  1. Inkuber platen ved 36 ° C i en fuktetinkubator som inneholder 5% CO 2.
  2. Plasser i en inkubator uforstyrret i 2 dager før den første endringen av komplette medium. Smak cellene vil til slutt binde seg til den belagte dekkglass, selv om det kanskje ikke er godt synlig i 1 til 3 dager.
  3. Fjern kloning sylinder fra plate-og mellomstore helt og tilsett 1 ml smak celle medium i hver brønn.
  4. Bytt 1/3 av middels hver 6-7 dager. Ikke endre medium oftere og / eller fullstendig.
  5. Sjekk cellevekst under mikroskop annenhver dag. De fleste av de nye cellene vokse under celle klynger. Cell klynger vanligvis løsne etter 2-3 uker i kultur forlater nylig genererte cellene.
  6. Når 40-50% av kloning sylinder er dekket i å utvide smak celler, trypsinize celler ved hjelp av 0,25% w / v trypsin / EDTA i 2-3 minutter ved 36 ° C.
  7. Overfør cellene fra brønner inn i 15 ml rør, legg 3 bind av smak cellekultur medium etterfulgt av sentrifugering ved 3000 rpm i 5 minutter ved romtemperatur temperamentperatur.
  8. Fjern supernatanten og resuspender celler med 1 ml av smak celle medium.

4. Propagation of Human Fungiform Taste papillae Cells

  1. Overfør cellene til T25 plate og tilsett 4 ml smak celle medium (passasje 0). Opprettholde celler ved 36 ° C i en fuktet inkubator med 5% CO 2.
  2. Bytt 1/3 av middels hver 6-7 dager før dyrkede smak celler har nådd 100% samløpet. På denne tiden, slik at smak celler til å høste, vaske cellene gang med steril PBS så trypsinize celler ved hjelp av 0,25% w / v trypsin / EDTA i 2-3 minutter ved 36 ° C.
  3. Etter sentrifugering som beskrevet ovenfor, resuspender i fullstendig smak celle medium og overføre celler til ferske T-75 kolber (passasje 1).
  4. Bytt 1/3 av middels hver 6-7 dager. Ikke endre medium oftere og / eller fullstendig.
  5. Gjenta trinn 4,3 og 4,4 når cellene har nådd nær 100% samløpet. Dele celler til ikke mer enn 1:04 fortynning i en T75 kolbefor å opprettholde tilstrekkelig vekst av cellene over tid.

5. Frysing og tining dyrkede humane Fungiform Taste papillae Cells

  1. Til fryse bestander av primære smak celler, etter trypsinization (trinn 4,2), tilsett 3 ml komplett smak celle medium og overføre celler til sterile 15 ml koniske sentrifugerør. Sentrifuger ved 2500 rpm i 5 min ved romtemperatur.
  2. Fjern forsiktig supernatanten og forsiktig resuspender celler med passende volum av fryse medium som inneholder 95% fostermedisin Bovine serum (FBS) og 5% DMSO.
  3. Overfør cellene til merket, steril cryovials, hetten, og plasser i en fryser beholder som inneholder isopropanol. Plasser i en -80 ° C fryseren i minst en dag før overføring på ubestemt tid til flytende nitrogen.
  4. Å tine en ampulle med frosne primære humane fungiform smak papiller celler, sted ved 37 ° C vannbad før like tint (ca. 1 minutt), mens du arbeider i en laminær-flow cellekulturhette.
  5. Overføre celler og frysing middels til et sterilt 15 ml konisk sentrifugerør og tilsett 5 ml smak cellekultur medium.
  6. Sentrifuger cellene ved 2500 rpm i 5 min ved romtemperatur. Nøye kast supernatanten, forsiktig Resuspender celler med komplett smak cellekultur medium, og overføring til en steril T-25 vevskultur kolbe.
  7. Fortsett til kultur celler i henhold til trinn 3-4.

6. Representative Resultater

Forsøk på å vokse smak biopsi i kulturen var vellykket 90% av tiden. Noen dager etter biopsi og dissosiasjon, celler vanligvis begynte å vokse og migrere utover fra de deler av dissekert fungiform vev som forble etter dissosiasjon prosedyren. Selv om individuelle celler var synlige 24-48 time etter plating (figur 1A), vokste celler i opptil 2-3 uker under vedlagte celle klynger, tidvis generere datterceller (figur 1b). Fra biopsiing 4-8 menneskelig fungiform papiller, innledende isolater av primære humane fungiform smak papiller celler nå ca 2000 - 8000 celler i 4 uker i kultur. Ekspansjon i T25 cellekultur kolber (passasje 0) for ytterligere 3-4 uker vil resultere i at menneskelige fungiform smak papiller celler i kultur tilpasset (figur 1C). Primære humane fungiform smak papiller celler kan bli ytterligere utvidet i kultur for å gi oppover på minst en million celler ved passasje-1 i 3-4 uker (figur 1D). Primære smak cellene vil fortsette å vokse i mer enn 8 passasjer.

Morfologi av dyrkede humane fungiform smak papiller celler i kultur var lik dyrkede chemosensory celler beskrevet tidligere 11,12 .. De fleste dyrkede humane fungiform smak papiller celler opprettholdt sin opprinnelige kompakte utseende celle organer med eller uten en eller flere prosesser opp til 15-30 dager. Etter at de nådde Confluence mesteparten av den kultiverte CELLS hadde en polarisert-langstrakt utseende. Eldre smak celler består av flere ulike histologiske subtyper og utstillingsområde smak celle spesifikke funksjoner. Her viser vi at cellene innenfor disse kulturene vise mange molekylære og fysiologiske egenskaper som kjennetegner modne smak celler. Gustducin og fosfolipase C - β2, (PLC-β2) mRNA ble oppdaget av revers transkriptase-polymerase kjedereaksjon og produkter bekreftet ved sekvensering (figur 2). Expression of gustducin og PLC-β2 ble oppdaget immunocytochemically indikerer tilstedeværelse av type II-lignende celler (figur 3 B og D henholdsvis). Forekomsten og relative uttrykk mønstre av gustducin og PLC-β2 reflekterende celle signalveier og celletyper ikke reflekterer nettopp det sett in vivo. Faktorene som styrer den relative fordelingen av ulike celletyper innen et smak knopp er ukjent, og kan ikke bli kopiert i kulturen forhold. Derfor b oth likheter og forskjeller mellom de dyrkede celler og deres in vivo kolleger gir en mulighet til å undersøke reguleringen av disse egenskapene på et molekylært nivå, under forhold som kan manipuleres og overvåkes.

Et viktig kriterium for en modell system er tilstedeværelsen av relevante funksjonelle egenskaper. Dyrkede celler også utstilt robuste økninger i intracellulært kalsium i respons til passende konsentrasjoner av flere smaks stimuli (figur 4). I disse studiene, søte og bitre stimuli framprovosere en økning i intracellulær kalsium som kan tilsvare en depolarisering. Disse smak celle-lignende egenskaper dyrkede celler gir støtte til påstanden om at modellen systemet vi beskriver her vil være en verdifull ressurs for videre studier av transduksjon stier og regenererende kapasitet på menneskelige smak celler.

fig1.jpg "/>
Figur 1. Vedlegg og morfologi av dyrkede humane fungiform smak papiller celler. Primære humane fungiform smak papiller cellekulturer dyrket på kollagen type-1 belagte plater ble fotografert etter 2 dager (A). Menneskelige fungiform smak papiller cellene vokste opp til 4 uker under vedlagte celle klynger, som syntes å gi opphav til datterceller. Cellene typisk vokste til samløpet innen fire uker (B), og (C og D) representerer dag 2 og 4 uker etter høsting og reseeding henholdsvis. Dyrkede celler fortsatte å vokse i minst 8 måneder. Skala barer = 50 nm. En del av Figur 1 ble også presentert i Ozdener et. al. ti.

Figur 2
Figur 2. RT-PCR resultater viste tilstedeværelse av spesifikke smak celle biomarkør mRNA (gustducin og PLC-β2,). Totalt RNA fra dyrkede humane fungiform celler var omvendt transcribed bruker Superscript First Strand Synthesis System for RT-PCR (Invitrogen) og brukes til PCR ved å forsterke med spesifikke primere designet for deteksjon av gustducin og PLC-β2. Primere (Tabell 1) ble valgt til spenne ett eller flere introner. Hver mRNA ble oppdaget i dyrkede humane fungiform smak papiller celler fra passasje 4 eller 5 med forsterkning produkter av forventet størrelse, bekreftet av sekvensering. Spesifikk mRNA ble ikke oppdaget i kontroll eksperimenter uten revers transkriptase indikerer ingen genomisk DNA forurensning. PCR produktene ble separert på 2% agarose gels og den forsterkede produktene på gelen ble fjernet med en barberhøvel. DNA ble ekstrahert fra gelen ved hjelp QIAquick Gel Extraction Kit (Qiagen). PCR produktene ble sekvensert ved University of Pennsylvania sekvensering fasiliteter. C-PCR og C-RT er kontroll eksperimenter for PCR og revers transkriptase, henholdsvis. En del av Figur 2 ble også presentert i Ozdener et. al.

Figur 3
Figur 3. Farging av dyrkede humane fungiform smak papillae celler passasje 4 eller 5 viste tilstedeværelse av smak celle biomarkører. Dyrkede humane fungiform smak papiller celler (5 dager gammel) ble fiksert med 4% paraformaldehyde, og inkubert med primære antistoffer (tabell 2) over natten ved 4 ° C. Bilder ble kjøpt med en Leica TCS-SP2 confocal laserskanning mikroskop. Omtrent ble 60% av kultiverte fungiform smak papiller celler merket med gustducin (B) og 20-30% med PLS-β2 (D). Transmisjon bilder av tilsvarende celler er vist (A og C). For kontroller, farging med antistoff spesifikt immunglobulin demonstrert fravær av uspesifikk immuno reaktivitet (data ikke vist). Skala barer = 50 nm. Delav Figur 3 ble også presentert i Ozdener et. al. ti.

Figur 4
Figur 4. Dyrkede humane fungiform smak papiller celler fra passasje 4 eller 5 reagerer på ulike stimuli. Dyrkede humane fungiform smak papiller celler (4-5 dager gammel) var lastet med 1mm Fura-2 AM (molekylære prober) og 10 mg / ml Pluronic F127 (molekylære prober). Endringer i intracellulære kalsiumnivået ([Ca 2 +] i) i dyrkede humane fungiform smak papiller celler ble målt ved hjelp av standard manuelle avbildningsteknikker. Cellene var visualisert ved hjelp av en omvendt fluorescens mikroskop ved eksitasjonsbølgelengdene av 340 nm og 380 nm og en emisjon bølgelengde satt av et band pass filter sentrert ved 510 nm. Stimuli ble oppløst i Bath løsning og deretter pH og osmolaritet readjusted hvis nødvendig. Dyrkede humane fungiform smak papiller celler reagert søte og bitre stimuli. Graphs illustrere representative svarene av [Ca 2] i nivåer i individuelle celler ved eksponering for (A) Denatonium (2 mm), (B) Sukralose (1 mm). Hver spor representerer enkle individuelle celler.

Gene Sequence PCR tilstand Forventet størrelse
(Bp)
Referanse
β-Actin GGACTTCGAGCAAGAGATGG
AGCACTGTGTTGGCGTACAG
7 min
45 sek
45 sek
45 sek
7 min
95
94
53
72
72
234 NM_001101.3
Gustducin TCTGGGTATGTGCCAAATGA
GGCCCAGTGTATTCTGGAAA
7 min
45 sek
45 sek
45 sek
7 min
95
94
53
72
72
386 NM_001102386
PLC-β2 GTCACCTGAAGGCATGGTCT
TTAAAGGCGCTTTCTGCAAT
3 min
30 sek
30 sek
60 sek
7 min
95
94
53
72
72
333 NM_004573

Tabell 1. Primere og vilkår som benyttes for å påvise smaken spesifikke molekyler.

Primary Antibody Kilde Host Fortynning Sekundær Antistoff Kilde Host Fortynning
Gustducin Santacruz Kanin 1:500 Anti-kanin IgG Alexa 633 Molekylære prober Goat 1:500
PLC-β 2 Santacruz Kanin 1:500 Anti-kanin IgG Alexa 633 Molekylære prober Goat 1:500

Tabell 2. Antistoffer brukes for å påvise uttrykk av bestemte molekyler.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Vi har opprettholdt celler hentet fra menneskers fungiform smak papillae i over åtte passeringer, som spenner over en periode på 12 måneder. Disse kulturene generere nye celler, hvorav mange forfall in vitro til det stadiet der de uttrykker flere markører med moden smak knoppen celletyper, i tillegg til viktige molekylære og fysiologiske egenskaper smak reseptor celler. Tilstedeværelsen av gustducin-og PLC-β2 immunoreaktivitets i undergrupper av dyrkede celler er i samsvar med denne konklusjonen. Viktigst, svarte noen celler til anvendelser av søte og bitter smak stimuli med forbigående økning i intracellulær kalsium, som er en funksjon av dissosiert smak celler 5, celler i smak knoppen skiver 3 og kultiverte mennesker og rotter smak celler 19,10. Dette indikerer ikke bare at noen av cellene i kultur uttrykt molekylære reseptorer for søtt og bittert, men at de hadde nok av G-protein coupled transduksjon kaskade å generere CalciUM svar.

Langsiktige primære cellekulturer ofte ikke kan opprettholde den opprinnelige vev og cellestruktur og cellulære faktorer som kan spille en rolle i den fysiologiske funksjon av celler. Ved vellykket langsiktig etablering av menneskelig fungiform smak papillae cellekultur, har stor fremgang blitt gjort ennå, må en rekke begrensninger nevnes. Fremst blant disse er at hvert parti av primære dyrkede celler kan variere på grunn av forskjeller i den første bestanden av celler som brukes til å starte kultur. Primære cellekulturer ofte savner den opprinnelige vevet organisering og struktur og vekstfaktorer som spiller en rolle i den fysiologiske funksjon av celler. Cellene er ofte ikke alltid og helt i kontakt med andre celler, som kulturer aldri vokst til 100% samløpet. Generelt primære celler er også underlagt dedifferentiation, og kromosomal instabilitet, preget av tap eller gevinst av kromosomer under celle replikering i kontinuerlig celle Lines, kan være en annen problem 13,14,15. Sammenligningen av dyrkede humane fungiform celler med dyrkede nontaste celler fra tunge skal utforskes. Disse spørsmålene vil kreve bruk av mange eksperimentelle tilnærminger og modellere systemer før vår forståelse er fullført.

I konklusjonen, beskrev denne protokollen her kan opprettholde menneskelig fungiform smak papiller celler in vitro for minst 8 passasjer (12 måneder) uten å miste relevante celle-fysiologiske og molekylære egenskaper. Den videre utvikling av dette langsiktige primære kultur vil gi en modell for studier av spredning og differensiering, stimulans spesifisitet, cross-talk og tilpasningstiltak egenskaper av menneskelige smak reseptor celler, samt vev regenerasjon. I tillegg effekten av forhold som svekker smak celle funksjon, for eksempel infeksjon, kan medisiner, stråling, giftige eller kjemisk eksponering undersøkes ved molekylære og fysiologiske nivåer.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Ingen interessekonflikter erklært.

Acknowledgments

Vi takker Aimee Myers og Esi Quayson for tekniske ferdigheter og hjelp. Dette arbeidet ble støttet delvis av NSF 0216310 og Givaudan Inc stipend (NER).

References

  1. Mbiene, J. P., Maccallum, D. K., Mistretta, C. M. Organ cultures of embryonic rat tongue support tongue and gustatory papilla morphogenesis in vitro without intact sensory ganglia. J. Comp. Neurol. 377, 324-340 (1997).
  2. Miyamoto, T., Fujiyama, R., Okada, Y., Sato, T. Strain difference in amiloride-sensitivity of salt-induced responses in mouse non-dissociated taste cells. Neurosci. Lett. 277, 13-16 (1999).
  3. Caicedo, A., Jafri, M. S., Roper, S. D. In situ Ca2+ imaging reveals neurotransmitter receptors for glutamate in taste receptor cells. J. Neurosci. 20, 7978-7985 (2000).
  4. Qin, Y. M., Shi, J. Q., Zhang, G. H., Deng, S. P., Wang, T. H. A reliable method to obtain cells of taste buds from fungiform papillae of mice. Acta Histochem. 112, 107-112 (2010).
  5. Spielman, A. I., Mody, I., Brand, J. G., Whitney, G., MacDonald, J. F., Salter, M. W. A method for isolating and patch-clamping single mammalian taste receptor cells. Brain Res. 503, 326-329 (1989).
  6. Kishi, M., Emori, Y., Tsukamoto, Y., Abe, K. Primary culture of rat taste bud cells that retain molecular markers for taste buds and permit functional expression of foreign genes. Neuroscience. 106, 217-225 (2001).
  7. Ruiz, C. J., Stone, L. M., McPheeters, M., Ogura, T., Bottger, B., Lasher, R. S., Finger, T. E., Kinnamon, S. C. Maintenance of rat taste buds in primary culture. Chem. Senses. 26, 861-873 (2001).
  8. Stone, L. M., Tan, S. S., Tam, P. P., Finger, T. E. Analysis of cell lineage relationships in taste buds. J. Neurosci. 22, 4522-4529 (2002).
  9. Ozdener, H., Yee, K. K., Cao, J., Brand, J. G., Teeter, J. H., Rawson, N. E. Characterization and long-term maintenance of rat taste cells in culture. Chem. Senses. 31, 279-290 (2006).
  10. Ozdener, M. H., Brand, J. G., Spielman, A. I., Lischka, F. W., Teeter, J. H., Breslin, P. A., Rawson, N. E. Characterization of Human Fungiform Papillae Cells in Culture. Chem. Senses. 36, 601-612 (2011).
  11. Gomez, G., Rawson, N. E., Hahn, C. G., Michaels, R., Restrepo, D. Characteristics of odorant elicited calcium changes in cultured human olfactory neurons. J. Neurosci. Res. 62, 737-749 (2000).
  12. Wolozin, B., Sunderland, T., Zheng, B. B., Resau, J., Dufy, B., Barker, J., Swerdlow, R., Coon, H. Continuous culture of neuronal cells from adult human olfactory epithelium. J. Mol. Neurosci. 3, 137-146 (1992).
  13. Wick, N., Saharinen, P., Saharinen, J., Gurnhofer, E., Steiner, C. W., Raab, I., Stokic, D., Giovanoli, P., Buchsbaum, S., Burchard, A., Thurner, S., Alitalo, K., Kerjaschki, D. Transcriptomal comparison of human dermal lymphatic endothelial cells ex vivo and in vitro. Physiol. Genomics. 17, 179-192 (2007).
  14. Fu, L., Zhu, L., Huang, Y., Lee, T. D., Forman, S. J., Shih, C. C. Derivation of neural stem cells from mesenchymal stemcells: evidence for a bipotential stem cell population. Stem Cells Dev. 17, 1109-1121 (2008).
  15. Sandow, S. L., Grayson, T. H. Limits of isolation and culture: intact vascular endothelium and BKCa. Am. J. Physiol. Heart Circ. Physiol. 297, H1-H7 (2009).
Isolering og kultur for Human Fungiform Taste papillae Cells
Play Video
PDF DOI

Cite this Article

Ozdener, H., Spielman, A. I., Rawson, N. E. Isolation and Culture of Human Fungiform Taste Papillae Cells. J. Vis. Exp. (63), e3730, doi:10.3791/3730 (2012).More

Ozdener, H., Spielman, A. I., Rawson, N. E. Isolation and Culture of Human Fungiform Taste Papillae Cells. J. Vis. Exp. (63), e3730, doi:10.3791/3730 (2012).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter