Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Neuroscience

Выделение и культуры клеток человека Вкус Fungiform Сосочки

doi: 10.3791/3730 Published: May 17, 2012

Summary

Мы, направленных на развитие воспроизводимый протокол выделения и поддержания долгосрочных культурах клеток человека вкус fungiform сосочков. Клетки человека fungiform сосочков, полученных при биопсии были успешно эксплуатируется в культуре в течение более чем восьми проходов (12 месяцев) без потери жизнеспособности.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. Получение прав Сосочки Вкус Fungiform

  1. Удалить 7:56 человека сосочков вкус fungiform от дорсальной поверхности передней части языка использованием изогнутого microscissors весной.
  2. Место сразу в изоляцию решение (26 мМ NaHCO 3, 2,5 мМ NaH 2 PO 4, 20 мМ глюкозы, 65 мМ NaCl, 20 мМ KCl, 1 мМ ЭДТА растворяются в нуклеазы без воды и фильтрации стерилизовать).

2. Вкус человека Fungiform Сосочки пищеварения

Вкус человека fungiform клетки сосочков могут быть отделены с помощью двух различных ферментативных протоколов пищеварения с небольшими различиями.

  1. Инкубируйте fungiform сосочков в изоляции решение проназой (1 мг / мл, Sigma Aldrich) и эластазы (1 мг / мл, Sigma Aldrich) при комнатной температуре в течение 30-45 мин (протокол 1).
  2. Инкубируйте fungiform сосочков с коллагеназы типа I (550 Ед / мл, от Уортингтон) + эластаза (10 Ед / мл, от суслаhington) + ингибитор трипсина (0,9 мг / мл, от Уортингтон) в 2 мл кальция бесплатно раствор Рингера в 35 ° C водяную баню с циркуляцией в течение 30 минут и нежный кислорода с 95% O 2/5% CO 2. (Альтернативный метод пищеварения, протокол 2)
  3. После инкубации промыть с сосочками звонка и растереть сосочков с огнем полированное стекло пипетки Пастера в 10 раз.
  4. Центрифуга в течение 3 минут при 2500 оборотов в минуту при комнатной температуре и удаления изоляции решение и добавьте 1 мл вкус питательную среду клетки.
  5. Передача переваривается fungiform сосочков в стеклянную посуду.
  6. Проанализируйте fungiform сосочки нежно с хирургической бритвой.
  7. Добавить 250 мкл расчлененный сосочков на клонирование цилиндр на хвост крысы коллагена типа 1 покрытые покровным.
  8. Добавить 1 мл вкус среднего культуре клеток в каждую лунку.

3. Культивирование клеток человека Вкус Fungiform Сосочки

  1. Инкубируйте пластины на 36 ° C в увлажненнойинкубатор, содержащий 5% CO 2.
  2. Поместите в инкубаторе в покое на 2 дня до первого изменения полной среды. Вкус клетки в конечном итоге связываться с покрытием покровное, хотя оно не может быть хорошо видны от 1 до 3 дней.
  3. Удалить клонирование цилиндр из пластин и среднего полностью и добавьте 1 мл вкус среднего клетки в каждую лунку.
  4. Заменить 1/3 от средней каждый 6-7 дней. Не изменяйте среднего чаще и / или полностью.
  5. Проверьте рост клеток под микроскопом каждый день. Большинство новых клетки растут под клетки кластеров. Сотовые кластеров обычно отделить через 2-3 недели в культуре оставив вновь созданные клетки.
  6. Как только 40-50% от клонирования цилиндр покрыт расширения вкусовых клеток, trypsinize клеток с использованием 0,25% вес / объем трипсин / ЭДТА в течение 2-3 минут при 36 ° C.
  7. Передача клеток из скважин в 15 мл труб, добавьте 3-х томах вкуса среднего культуре клеток с последующим центрифугированием при 3000 оборотов в минуту в течение 5 минут при комнатной температурепературы.
  8. Удалить супернатант и ресуспендирования клеток в 1 мл вкус средней клетке.

4. Распространение клеток человека Вкус Fungiform Сосочки

  1. Передача клеток в T25 плиты и добавить 4 мл вкусовая клетка среды (переход 0). Поддерживать клетки при 36 ° C в увлажненном инкубаторе, содержащем 5% CO 2.
  2. Заменить 1/3 от средней каждый 6-7 дней до культивируемых клеток вкус достигли 100% слияния. В это время, чтобы вкусовые клетки для уборки, мытья клетки раз стерильной PBS то trypsinize клеток с использованием 0,25% вес / объем трипсин / ЭДТА в течение 2-3 минут при 36 ° C.
  3. После центрифугирования, как описано выше, ресуспендируют в полной среде клетки вкус и передачи клеткам свежий Т-75 колб (проход 1).
  4. Заменить 1/3 от средней каждый 6-7 дней. Не изменяйте среднего чаще и / или полностью.
  5. Повторите шаги 4.3 и 4.4, когда клетки достигли почти 100% слияния. Сплит клеток не более чем на разведении 1:4 в колбе T75для поддержания нормального роста клеток с течением времени.

5. Замораживание и размораживание культивируемых клетках человека Вкус Fungiform Сосочки

  1. Чтобы заморозить запасы первичных клеток вкус, после трипсинизации (шаг 4.2), добавить 3 мл полной среды клетки вкус и передачи клеток стерильной 15 мл конические пробирки. Центрифуга на 2500 оборотов в минуту в течение 5 мин при комнатной температуре.
  2. Осторожно удалите супернатант и осторожно ресуспендируют клеток с соответствующим объемом замораживание среде, содержащей 95% эмбриональной телячьей сыворотки (FBS) и 5% ДМСО.
  3. Передача меченых клеток, стерильная криопробирки, крышка плотно, и место в замораживания контейнер, содержащий изопропиловый спирт. Место в -80 ° C морозильник по крайней мере за день до передачи на неопределенное время в жидком азоте.
  4. Чтобы таять флакон замороженных первичных человеческих fungiform вкус сосочков клетки, место при 37 ° С водяной бане, пока только талые (примерно 1 минуту), во время работы в ламинарный поток клеточных культуркапот.
  5. Передача и замораживании клетки средних стерильный 15 мл конические трубки центрифуги и добавляют 5 мл вкус питательную среду клетки.
  6. Центрифуга клеток при 2500 оборотов в минуту в течение 5 мин при комнатной температуре. Тщательно отказаться супернатант, мягко ресуспендирования клеток с полным вкусом культуре клеток средних и передачи стерильных Т-25 колбу культуре ткани.
  7. Продолжайте культуре клеток в соответствии с шагом от 3 до 4.

6. Представитель Результаты

Попытки выращивать вкус биопсии в области культуры были успешными 90% времени. Через несколько дней после биопсии и диссоциации, клетки обычно начал расти и мигрировать наружу из частей расчлененного fungiform ткани, которая осталась после процедуры диссоциации. Несмотря на отдельные клетки были видны через 24-48 ч после покрытия (рис. 1а), клетки росли в течение 2-3 недель по прилагаемой кластеров клетки, иногда создание дочерних клеток (рис. 1б). С биопсииING 4-8 человека fungiform сосочков, начальная изолятов первичных клеток человека вкус fungiform сосочков достигает примерно 2000 - 8000 клеток в течение 4 недель в культуре. Расширение в культуре клеток T25 колбы (переход 0) дополнительные 3-4 недели приведет с человеческими клетками вкус fungiform сосочков в области культуры адаптированные (рис. 1в). Первичные человеческие клетки вкус fungiform сосочки могут быть расширены в области культуры, чтобы дать вверх, по крайней мере миллион клеток проход-1 в течение 3-4 недель (рис. 1D). Первичные элементы вкус будет продолжать расти в течение более 8 проходов.

Морфология культурного человека fungiform вкус сосочков клеток в культуре была похожа на культурные хемосенсорной клеток описано выше 11,12 .. Большинство культивируемых клетках человека вкус fungiform сосочков сохранили свой первоначальный внешний вид компактного клеточных тел с или без одного или нескольких процессов до 15-30 дней. После того, как они достигли слияния большинство культурных сеООО было поляризованным вытянутый вид. Зрелые клетки вкус состоит из нескольких различных гистологических подтипов и выставки вкусовая клетка особенностей. Здесь мы показываем, что клетки в пределах этих культур отображать многие молекулярные и физиологические особенности, характерные для зрелых клеток вкус. Gustducin и фосфолипазы С - β2 (PLC-β2) мРНК были обнаружены обратной транскриптазы-полимеразной цепной реакции и продукции подтверждено последовательности (рис. 2). Выражение gustducin и PLC-β2 был обнаружен immunocytochemically указывающие на наличие типа II-подобных клеток (рис. 3 B и D соответственно). Распространенность и относительная модели выражение gustducin и PLC-β2 отражает клетки сигнальных путей и типы клеток, не точно отражают, что видел в естественных условиях. Факторов, определяющих относительное распределение различных типов клеток в почку вкус неизвестны и не могут быть воспроизведены в культуре условиях. Таким образом, б др. сходства и различия культур клеток и их коллеги в естественных условиях дают возможность изучить регулирование этих характеристик на молекулярном уровне, в условиях которой можно манипулировать и контролировать.

Важным критерием для модельной системы является наличие соответствующих функциональных свойств. Культивируемых клеток также демонстрируют надежную увеличение внутриклеточного кальция в ответ на соответствующие концентрации несколько стимулов вкус (рис. 4). В этих исследованиях, сладкие и горькие стимулы вызывают увеличение внутриклеточного кальция, что может соответствовать к деполяризации. Эти вкус клеточных свойства культивируемых клеток оказывать поддержку утверждения, что модель системы, которую мы описываем здесь станет ценным активом для дальнейшего исследования трансдукции и регенеративные способности клеток человека вкус.

fig1.jpg "/>
Рисунок 1. Вложений и морфология культивируемых клетках человека вкус fungiform сосочков. Первичные человеческие fungiform вкус сосочков клеточных культурах, выращенных на коллаген 1-го типа покрытия пластин были обследованы через 2 дня (A). В клетках человека вкус fungiform сосочков вырос до 4 недель в прилагаемом кластеров клетки, которые, казалось, приводят к дочерним клеткам. Клетки обычно выросла до слияния в течение четырех недель (B) и (C и D) представляет собой 2-й день и через 4 недели после сбора урожая и пересев соответственно. Культивируемые клетки продолжали расти, по крайней мере 8 месяцев. Масштаб баров = 50 нм. Часть Рисунок 1 также был представлен в Ozdener и др.. ал. 10.

Рисунок 2
Рисунок 2. RT-PCR результаты показали наличие специфических биомаркеров вкусовая клетка мРНК (gustducin и PLC-β2). Тотальная РНК из культивируемых клеток человека fungiform была обратной Закавкribed использованием Надстрочный Первая система синтеза Strand для RT-PCR (Invitrogen) и используется для ПЦР путем усиления конкретных праймеры для выявления gustducin и PLC-β2. Грунтовки (табл. 1) было выбрано, чтобы охватить одну или несколько интронов. Каждый мРНК был обнаружен в культуре человека fungiform вкус сосочков клетки от прохождения 4 или 5 продуктов амплификации ожидаемого размера, подтверждает последовательность. Конкретные мРНК не была обнаружена в контрольных опытах без обратной транскриптазы, указывающее на отсутствие геномной ДНК. ПЦР-продукты были разделены на 2% агарозном геле и усиленный продукции на геле вырезали бритвой. ДНК выделяли из геля использованием QIAquick гель Добыча Kit (Qiagen). Продукты ПЦР последовательно в университете Пенсильвании средств виртуализации. C-PCR и C-RT являются контрольные эксперименты для ПЦР и обратной транскриптазы, соответственно. Часть 2 также была представлена ​​в Ozdener и др.. др..

Рисунок 3
Рисунок 3. Иммуноокрашивание культурного человека fungiform вкус сосочков клеток проход 4 или 5 показали наличие биомаркеров вкусовая клетка. Искусственный человеческий fungiform вкус сосочков клетки (5 дней) были зафиксированы 4% параформальдегида, и инкубировали с первичными антителами (табл. 2) в течение ночи при 4 ° C. Изображения были получены с Leica TCS-SP2 конфокальной микроскопии лазерного сканирования. Около 60% культивируемых клеток вкус fungiform сосочки были помечены gustducin (B) и 20-30% с PLC-β2 (D). Передача изображений в соответствующих ячейках показаны (А и С). Для элементов управления, с антителами иммунной специфического иммуноглобулина показал отсутствие неспецифической реактивности иммунной (данные не представлены). Масштаб баров = 50 нм. Частьна рисунке 3 также был представлен в Ozdener и др.. ал. 10.

Рисунок 4
Рисунок 4. Искусственного человека fungiform вкус сосочков клетки от прохождения 4 или 5 реагировать на различные раздражители. Искусственный человеческий fungiform вкус сосочков клеток (4-5 дней) были загружены 1mM Фура-2 AM (Molecular Probes) и 10 мг / мл Pluronic F127 (Molecular Probes). Изменения внутриклеточного уровня кальция ([Ca 2 +] я) в культивируемых клетках человека вкус fungiform сосочки были измерены с помощью стандартных методов визуализации руководства. Клетки были визуализированы использованием перевернутой флуоресцентного микроскопа при возбуждении длиной волны 340 нм и 380 нм и длине волны излучения установленных фильтров полосы пропускания с центром в точке 510 нм. Стимулы растворяли в ванной раствором, а затем рН и осмолярность скорректировать при необходимости. Культивируемых клетках человека вкус fungiform сосочков ответ на сладкие и горькие стимулы. Graphs иллюстрации представитель ответы [Ca +2] я уровней в отдельных клетках при воздействии (А) Denatonium (2 мм), (B), сукралоза (1 мм). Каждая кривая представляет одну отдельных клеток.

Ген Последовательность ПЦР состояние Ожидаемый размер
(Б.п.)
Ссылка
β-актина GGACTTCGAGCAAGAGATGG
AGCACTGTGTTGGCGTACAG
7 мин
45 сек
45 сек
45 сек
7 мин
95
94
53
72
72
234 NM_001101.3
Gustducin TCTGGGTATGTGCCAAATGA
GGCCCAGTGTATTCTGGAAA
7 мин
45 сек
45 сек
45 сек
7 мин
95
94
53
72
72
386 NM_001102386
PLC-β2 GTCACCTGAAGGCATGGTCT
TTAAAGGCGCTTTCTGCAAT
3 мин
30 сек
30 сек
60 сек
7 мин
95
94
53
72
72
333 NM_004573

Таблица 1. Праймеры и условия, используемые для определения вкуса конкретных молекул.

Первичное антитело Источник Хозяин Разбавление Вторичными антителами Источник Хозяин Разбавление
Gustducin Сантакрус Кролик 1:500 Анти-IgG кролика Alexa 633 Молекулярные зонды Козел 1:500
PLC-β 2 Сантакрус Кролик 1:500 Анти-IgG кролика Alexa 633 Молекулярные зонды Козел 1:500

Таблица 2. Антитела для выявления экспрессии специфических молекул.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Мы поддерживаем клеток, полученных из человеческих сосочков вкус fungiform более 8 проходов, охватывающий период в 12 месяцев. Эти культуры генерировать новые клетки, многие из которых созревают в пробирке до стадии, когда они выражают несколько маркеров зрелых типов бутон вкус клетки, в дополнение к основной молекулярные и физиологические свойства клетки вкусовых рецепторов. Наличие gustducin и PLC-β2 иммунореактивности в подмножества культивируемых клеток согласуется с этим выводом. Самое главное, некоторые клетки ответили на применение сладкий и горький вкус стимулов с переходной увеличение внутриклеточного кальция, что является особенностью диссоциированных клеток вкус 5 клеток вкусовой рецептор ломтиками 3 и культивированных человеческих клеток крыс и вкус 19,10. Это означает не только то, что некоторые из клеток в культуре выражается молекулярные рецепторы сладкого и горького, но что у них достаточно G-белка каскада трансдукции связанной генерировать Calciмкм ответов.

Долгосрочные первичных клеточных культур часто не могут сохранить первоначальную тканей и клеточных структур и клеточных факторов, которые могут играть важную роль в физиологических функций клеток. К успешным долгосрочное создание человеческого вкуса fungiform культуре клеток сосочков, большой прогресс был достигнут еще целый ряд ограничений должны быть указаны. Главным среди них является то, что каждая партия первичных культурах клеток может изменяться в зависимости от различий в исходной популяции клеток, используемых для запуска культуры. Первичные культуры клеток часто не хватает оригинальных тканей и организации структуры и факторов роста, которые играют важную роль в физиологических функций клеток. Клетки часто не всегда и не полностью в контакте с другими клетками, а культуры, никогда не выросла до 100% слияния. В целом, первичные клетки также подвергаются дедифференцировки и хромосомной нестабильности, характеризуется проигрыша или выигрыша хромосом во время репликации клетки в непрерывном литийРЭШ, может возникнуть другая проблема 13,14,15. Сравнение культивируемых клетках человека fungiform с культивируемых клеток nontaste языка необходимо изучить. Эти вопросы требуют использования многих экспериментальных подходов и моделей систем до нашего понимания является полным.

В заключение этого протокола, описанные здесь позволяет поддерживать человека fungiform вкус сосочков клетки в пробирке, по крайней мере, 8 проходов (12 месяцев), не теряя при соответствующей клетки-физиологические и молекулярные характеристики. Дальнейшее развитие этой долгосрочной первичной культуре обеспечит модельной системы для изучения пролиферации и дифференцировки, стимул специфику, перекрестных помех и адаптации свойств человеческой вкусовых рецепторов клеток, а также регенерации тканей. Кроме того, влияние условий, которые ухудшают вкус клеточных функций, таких как инфекции, лекарства, радиации, токсических или химического воздействия могут быть рассмотрены на молекулярном и физиологическом уровнях.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Нет конфликта интересов объявлены.

Acknowledgments

Мы благодарим Эйми Майерс и Esi Quayson для технических навыков и помощи. Эта работа была частично поддержана NSF 0216310 и Givaudan Inc гранта (НКО).

References

  1. Mbiene, J. P., Maccallum, D. K., Mistretta, C. M. Organ cultures of embryonic rat tongue support tongue and gustatory papilla morphogenesis in vitro without intact sensory ganglia. J. Comp. Neurol. 377, 324-340 (1997).
  2. Miyamoto, T., Fujiyama, R., Okada, Y., Sato, T. Strain difference in amiloride-sensitivity of salt-induced responses in mouse non-dissociated taste cells. Neurosci. Lett. 277, 13-16 (1999).
  3. Caicedo, A., Jafri, M. S., Roper, S. D. In situ Ca2+ imaging reveals neurotransmitter receptors for glutamate in taste receptor cells. J. Neurosci. 20, 7978-7985 (2000).
  4. Qin, Y. M., Shi, J. Q., Zhang, G. H., Deng, S. P., Wang, T. H. A reliable method to obtain cells of taste buds from fungiform papillae of mice. Acta Histochem. 112, 107-112 (2010).
  5. Spielman, A. I., Mody, I., Brand, J. G., Whitney, G., MacDonald, J. F., Salter, M. W. A method for isolating and patch-clamping single mammalian taste receptor cells. Brain Res. 503, 326-329 (1989).
  6. Kishi, M., Emori, Y., Tsukamoto, Y., Abe, K. Primary culture of rat taste bud cells that retain molecular markers for taste buds and permit functional expression of foreign genes. Neuroscience. 106, 217-225 (2001).
  7. Ruiz, C. J., Stone, L. M., McPheeters, M., Ogura, T., Bottger, B., Lasher, R. S., Finger, T. E., Kinnamon, S. C. Maintenance of rat taste buds in primary culture. Chem. Senses. 26, 861-873 (2001).
  8. Stone, L. M., Tan, S. S., Tam, P. P., Finger, T. E. Analysis of cell lineage relationships in taste buds. J. Neurosci. 22, 4522-4529 (2002).
  9. Ozdener, H., Yee, K. K., Cao, J., Brand, J. G., Teeter, J. H., Rawson, N. E. Characterization and long-term maintenance of rat taste cells in culture. Chem. Senses. 31, 279-290 (2006).
  10. Ozdener, M. H., Brand, J. G., Spielman, A. I., Lischka, F. W., Teeter, J. H., Breslin, P. A., Rawson, N. E. Characterization of Human Fungiform Papillae Cells in Culture. Chem. Senses. 36, 601-612 (2011).
  11. Gomez, G., Rawson, N. E., Hahn, C. G., Michaels, R., Restrepo, D. Characteristics of odorant elicited calcium changes in cultured human olfactory neurons. J. Neurosci. Res. 62, 737-749 (2000).
  12. Wolozin, B., Sunderland, T., Zheng, B. B., Resau, J., Dufy, B., Barker, J., Swerdlow, R., Coon, H. Continuous culture of neuronal cells from adult human olfactory epithelium. J. Mol. Neurosci. 3, 137-146 (1992).
  13. Wick, N., Saharinen, P., Saharinen, J., Gurnhofer, E., Steiner, C. W., Raab, I., Stokic, D., Giovanoli, P., Buchsbaum, S., Burchard, A., Thurner, S., Alitalo, K., Kerjaschki, D. Transcriptomal comparison of human dermal lymphatic endothelial cells ex vivo and in vitro. Physiol. Genomics. 17, 179-192 (2007).
  14. Fu, L., Zhu, L., Huang, Y., Lee, T. D., Forman, S. J., Shih, C. C. Derivation of neural stem cells from mesenchymal stemcells: evidence for a bipotential stem cell population. Stem Cells Dev. 17, 1109-1121 (2008).
  15. Sandow, S. L., Grayson, T. H. Limits of isolation and culture: intact vascular endothelium and BKCa. Am. J. Physiol. Heart Circ. Physiol. 297, H1-H7 (2009).
Выделение и культуры клеток человека Вкус Fungiform Сосочки
Play Video
PDF DOI

Cite this Article

Ozdener, H., Spielman, A. I., Rawson, N. E. Isolation and Culture of Human Fungiform Taste Papillae Cells. J. Vis. Exp. (63), e3730, doi:10.3791/3730 (2012).More

Ozdener, H., Spielman, A. I., Rawson, N. E. Isolation and Culture of Human Fungiform Taste Papillae Cells. J. Vis. Exp. (63), e3730, doi:10.3791/3730 (2012).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter