Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Neuroscience

Aislamiento y cultivo de células humanas las papilas fungiformes gusto

doi: 10.3791/3730 Published: May 17, 2012

Summary

El objetivo fue desarrollar un protocolo reproducible para aislar y mantener a largo plazo de cultivos de células humanas las papilas fungiformes gusto. Las células de las papilas fungiformes humana obtenidas por biopsia se mantuvieron con éxito en la cultura durante más de ocho pasos (12 meses) sin pérdida de viabilidad.

Abstract

Las células del gusto son altamente especializado, con características histológicas, moleculares y fisiológicos que permiten la detección de una amplia gama de estímulos simples y moléculas químicas complejas contenidas en los alimentos. En papilas humana, individual fungiformes contener de cero a un máximo de 20 papilas gustativas. No existe un protocolo establecido para el cultivo de células gustativas humanos, aunque la capacidad de mantener las células del gusto papilas en la cultura de los ciclos múltiples de la célula sería de considerable utilidad para la caracterización de las propiedades moleculares, regeneradoras y funcionales de estas células sensoriales únicas. Los primeros estudios de las células gustativas se han realizado utilizando recién células aisladas en cultivo primario, cultivos de explantes de los roedores, o semi-intactas las papilas gustativas en cortes de tejido 1,2,3,4. Aunque cada una de estas preparaciones tiene ventajas, el desarrollo de cultivos a largo plazo se han proporcionado beneficios significativos, en particular para los estudios de células sabor proliferación y diferenciaciónrentiation. Varios grupos, incluyendo el nuestro, se han interesado en el desarrollo y establecimiento de modelos de cultivo de células gustativas. La mayoría de los intentos de las células gustativas de la cultura han informado de viabilidad limitada, con las células por lo general no duran más allá de 3-5 días 5,6,7,8. Recientemente hemos informado de un método exitoso para el cultivo prolongado de las células gustativas de roedores 9. Estamos aquí informe por primera vez el establecimiento de un sistema de cultivo in vitro de células aisladas de humanos fungiformes papilas gustativas. Las células de las papilas fungiformes humana obtenidas por biopsia se mantuvieron con éxito en la cultura durante más de ocho pasos (12 meses) sin pérdida de viabilidad. Las células muestran muchas características moleculares y fisiológicos característicos de las células gustativas maduros. Gustducin y la fosfolipasa C β2, (PLC-β2) mRNA se detectó en muchas células por reacción en cadena de la polimerasa-transcriptasa y confirmados por secuenciación. Análisis de inmunohistoquímica demostraron la presencia de ráfagasducin y el PLC β2-expresión en las células gustativas cultivadas. Cultivadas células fungiformes humanos también mostraron aumentos en el calcio intracelular en respuesta a concentraciones apropiadas de los estímulos de sabor que indican que varios receptores del sabor y al menos algunas de las vías de señalización estaban presentes. Estos resultados indican que suficientes células del gusto de los humanos adultos pueden ser generados y mantenidos durante al menos ocho pasajes. Muchas de las células conservan las características fisiológicas y bioquímicas de las células aisladas de forma aguda el epitelio gusto de adultos para apoyar su uso como un sistema modelo de gusto. Este sistema permitirá realizar más estudios sobre los procesos implicados en la proliferación, diferenciación y función de mamíferos, células receptoras del gusto de una preparación in vitro.

Papilas fungiformes el gusto humano utiliza para el establecimiento de la cultura humana de células fungiformes fueron donados para la investigación tras el consentimiento informado adecuado bajo protocolos de investigación que fueron revisadosy aprobado por el comité del IRB. El protocolo (# 0934) fue aprobado por los Asociados Schulman Junta de Revisión Institucional Inc., Cincinnati, OH. Protocolo escrito a continuación se basa en los parámetros publicados reportados por Ozdener et al. 2011 10.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. La obtención de papilas fungiformes Humanos Sabor

  1. Retire cuatro hasta ocho papilas fungiformes humana sabor de la superficie dorsal de la porción anterior de la lengua con microtijeras curvas de primavera.
  2. Colocar inmediatamente en una solución de aislamiento (26 mM NaHCO 3, 2,5 mM de NaH 2 PO 4, 20 mM de glucosa, 65 mM de NaCl, 20 mM de KCl, y EDTA 1 mM disuelto en agua libre de nucleasa y se esteriliza por filtración).

2. Gusto humano papilas fungiformes digestión

El gusto humano papilas fungiformes de células se puede disociar el uso de dos diferentes protocolos de digestión enzimática con ligeras diferencias.

  1. Incubar las papilas fungiformes en solución de aislamiento con pronasa (1 mg / ml, Sigma Aldrich) y la elastasa (1 mg / ml de Sigma Aldrich) a temperatura ambiente durante 30-45 minutos (protocolo 1).
  2. Incubar las papilas fungiformes con colagenasa tipo I (550 U / ml, de Worthington) + elastasa (10 U / ml, a partir de mostohington) + inhibidor de tripsina (0,9 mg / ml, de Worthington) en 2 ml de solución de calcio Ringer libre en 35 ° C método de baño de agua con la circulación durante 30 minutos y una suave oxigenación con O 95% 5.2% de CO 2. (Alternativa para la la digestión, el protocolo de 2)
  3. Después de la incubación, lavar las papilas con el timbre y triturar las papilas con el fuego, pulido pipeta Pasteur de vidrio de 10 veces.
  4. Centrifugar durante 3 minutos a 2500 rpm a temperatura ambiente y eliminar la solución de aislamiento y se añade 1 ml de medio de cultivo celular el sabor.
  5. Traslado digerido las papilas fungiformes en el plato de vidrio.
  6. Diseccionar las papilas fungiformes suavemente con navaja quirúrgica.
  7. Añadir 250 ml de papilas disecados en el cilindro de clonación en la cola de rata cubreobjetos colágeno tipo 1, recubierto.
  8. Añadir 1 ml de medio de cultivo celular sabor en cada pocillo.

3. El cultivo de células humanas las papilas fungiformes gusto

  1. Incubar la placa a 36 ° C en un humidificadoincubadora que contiene 5% de CO 2.
  2. Coloque en un tranquilo incubadora de 2 días antes de que el primer cambio de medio completo. Las células del gusto eventualmente se unirá al cubreobjetos recubiertos, aunque puede que no sea claramente visible en 1 a 3 días.
  3. Quite el cilindro de la clonación de la placa y el medio completamente y añadir 1 ml de medio de el gusto de células en cada pocillo.
  4. Sustituir 1/3 de 6-7 días cada medio. No cambie más a menudo a medio y / o en su totalidad.
  5. Comprobar el crecimiento de células bajo el microscopio cada dos días. La mayoría de las nuevas células crecen por debajo de los grupos de células. Los agregados celulares generalmente desconectar después de 2-3 semanas en la cultura de salir de las células recién generadas.
  6. Una vez que el 40-50% de la clonación cilindro está cubierto en la expansión de las células del gusto, trypsinize células utilizando 0,25% w / v de tripsina / EDTA durante 2-3 minutos a 36 ° C.
  7. Transferir las células de los pocillos en tubos de 15 ml, añadir 3 volúmenes de medio de cultivo celular sabor seguido por centrifugación a 3000 rpm durante 5 minutos a temple habitacióntura.
  8. Eliminar sobrenadante y resuspender las células con 1 ml de medio de sabor de la célula.

4. La propagación de las células humanas las papilas fungiformes gusto

  1. Transferir células T25 en placa y añadir 4 ml de medio de sabor celular (paso 0). Mantener las células a 36 ° C en una incubadora humidificada con 5% de CO 2.
  2. Sustituir 1/3 de 6-7 días hasta que todos los medios células cultivadas gustativas han llegado a 100% de confluencia. En este momento, para permitir a las células del gusto de la cosecha, lavar las células una vez con PBS estéril a continuación trypsinize células utilizando 0,25% w / v de tripsina / EDTA durante 2-3 minutos a 36 ° C.
  3. Después de la centrifugación como se describió anteriormente, resuspender en medio completo de células gusto y células de transferencia a nuevos matraces T-75 (paso 1).
  4. Sustituir 1/3 de 6-7 días cada medio. No cambie más a menudo a medio y / o en su totalidad.
  5. Repita el paso 4.3 y 4.4, cuando las células han alcanzado casi el 100% de confluencia. Dividir las células a no más de dilución 1:4 en un matraz T75para mantener un crecimiento adecuado de las células con el tiempo.

5. La congelación y descongelación cultivadas Humanos células papilas fungiformes papilas gustativas

  1. Para congelar las existencias de las células gustativas primarias, después de tripsinización (paso 4.2), añadir 3 ml de medio completo células gustativas y las células de transferencia de hasta 15 tubos de centrífuga estériles ml cónicos. Centrifugar a 2500 rpm durante 5 min a temperatura ambiente.
  2. Retirar con cuidado las células sobrenadante y resuspender suavemente con un volumen adecuado de medio de congelación que contiene 95% suero bovino fetal (FBS) y 5% de DMSO.
  3. Transferir las células a la etiqueta, crioviales estériles tapa, con fuerza, y colóquelo en un contenedor de congelación con isopropanol. Colocar en un congelador -80 ° C durante al menos un día antes de transferir indefinidamente en nitrógeno líquido.
  4. Para descongelar un vial de células primarias congelados humanos fungiformes papilas gustativas, el lugar a 37 ° C baño de agua hasta que esté descongelado (aproximadamente 1 minuto), mientras trabajaba en un cultivo de células de flujo laminarcampana.
  5. Transferencia de células y el medio de congelación a un tubo de centrífuga estéril de 15 ml cónico y añadir 5 ml de medio de cultivo celular el sabor.
  6. Centrifugar las células a 2500 rpm durante 5 min a temperatura ambiente. Elimine con cuidado las células sobrenadante, resuspender suavemente con medio de cultivo completo el sabor de células, y la transferencia a un estéril T-25 frasco de cultivo de tejidos.
  7. Continuar las células de cultivo de acuerdo con el Paso 3 a 4.

6. Los resultados representativos

Los intentos para hacer crecer las biopsias de sabor en la cultura tuvieron éxito 90% del tiempo. Pocos días después de la biopsia y la disociación, las células comenzaron a crecer normalmente y migran hacia el exterior de las piezas de tejido fungiformes disecados que quedaron después del procedimiento de disociación. Aunque las células individuales eran visibles 24-48 horas después de placas (Figura 1A), las células crecieron hasta 2-3 semanas bajo racimos de células adjuntos, en ocasiones generar células hijas (Figura 1B). Desde la biopsia4-8 ción humana papilas fungiformes, los aislamientos iniciales de células primarias humanas fungiformes papilas gustativas llegar a aproximadamente 2000 - 8000 células en 4 semanas en cultivo. La expansión en T25 frascos de cultivo celular (paso 0) por 3-4 semanas adicionales dará lugar a tener células humanas fungiformes papilas gustativas en la cultura adaptada (fig. 1C). Primarios humanos células fungiformes papilas gustativas se puede ampliar en la cultura para producir más de al menos un millón de células por el paso-1 en 3-4 semanas (Figura 1D). Las células primarias del gusto seguirá creciendo durante más de 8 pasajes.

La morfología de las células humanas cultivadas fungiformes papilas gustativas en cultivo fue similar a las células cultivadas quimiosensoriales descrito previamente 11,12 .. La mayoría de las células cultivadas de humanos fungiformes papilas gustativas mantiene su aspecto original compacta de cuerpos celulares con o sin uno o más procesos hasta 15-30 días. Después de que llegó a la confluencia la mayor parte del cultivo ceLLS tenía una apariencia polarizada-alargada. Las células maduras del gusto consisten en varios subtipos histológicos diferentes y presentan características de células gustativas específicas. Aquí nos muestran que las células dentro de estas culturas muestran muchas características moleculares y fisiológicos característicos de las células gustativas maduros. Gustducin y fosfolipasa C - β2, (PLC-β2) ARNm se detectaron por reacción en cadena de la polimerasa transcriptasa y productos confirmados por secuenciación (Figura 2). Expresión de gusducina y PLC β2-fue detectado immunocytochemically indicando la presencia de tipo II-como las células (Figura 3 B y D, respectivamente). La prevalencia y los patrones de expresión relativa de gustducin y el PLC-β2 refleja vías de señalización celular y tipos de células no refleja con precisión que se ve en vivo. Los factores que rigen la distribución relativa de los diferentes tipos de células dentro de una papila gustativa son desconocidos, y no puede ser replicado en las condiciones de cultivo. Por lo tanto, b anto las similitudes y diferencias entre las células cultivadas y sus homólogos en vivo ofrecen una oportunidad para examinar la regulación de estas características a nivel molecular, en las condiciones que pueden ser manipulados y controlados.

Un criterio importante para un sistema modelo es la presencia de relevantes propiedades funcionales. Las células cultivadas también mostraron aumentos sólidos en el calcio intracelular en respuesta a concentraciones apropiadas de los estímulos de sabor varios (Figura 4). En estos estudios, los estímulos dulces y amargas provocan un aumento del calcio intracelular que puede corresponder a una despolarización. Estas células sabor a las propiedades de las células cultivadas dan soporte a la afirmación de que el modelo de sistema que describimos aquí será un activo valioso para futuros estudios de las vías de transducción y la capacidad regenerativa de las células del gusto humanos.

fig1.jpg "/>
Figura 1. El apego y la morfología de las células cultivadas de humanos fungiformes papilas gustativas. Primarios humanos fungiformes papilas gustativas cultivos de células cultivadas en placas de colágeno tipo 1, se obtuvieron imágenes recubiertos después de 2 días (a). Humanos células papilas gustativas fungiformes creció hasta 4 semanas en grupos de células anexas, que parecían dar lugar a células hijas. Las células crecieron hasta confluencia típicamente dentro de cuatro semanas (B), y (C y D) representa 2 días y 4 semanas después de la cosecha y resiembra respectivamente. Las células cultivadas siguió creciendo por lo menos 8 meses. Las barras de escala = 50 nm. Parte de la Figura 1 se presenta también en Ozdener et. col. 10.

Figura 2
Figura 2. RT-PCR demostró la presencia de ARNm específicos del gusto de biomarcadores celulares (gustducin y el PLC β2-,). ARN total de cultivos de células humanas fungiformes era transc inversaribed utilizando el Superíndice el primer sistema de síntesis de la hebra para RT-PCR (Invitrogen) y se utiliza para la PCR mediante la amplificación con los cebadores específicos diseñados para la detección de gustducin y el PLC β2-. Los cebadores (Tabla 1) fueron elegidos para abarcar uno o más intrones. Cada mRNA se detectó en cultivos de células humanas fungiformes papilas gustativas del pasaje 4 o 5 con los productos de amplificación del tamaño esperado, confirmado por secuenciación. ARNm específico no fue detectado en los experimentos de control sin transcriptasa inversa indica que no hay contaminación de ADN genómico. Productos de PCR se separaron en geles de agarosa al 2% y los productos amplificados en el gel fueron extirpados con una maquinilla de afeitar. Se extrajo el ADN a partir del gel utilizando QIAquick gel extracción kit (Qiagen). Productos de PCR fueron secuenciados en la Universidad de Pensilvania instalaciones de secuenciación. C-PCR y RT-C son los experimentos de control de la PCR y la transcriptasa inversa, respectivamente. Parte de la figura 2 también se presentó en Ozdener et. col.

Figura 3
Figura 3. La inmunotinción de cultivo gusto humano las células de las papilas fungiformes el paso 4 o 5 mostraron la presencia de biomarcadores de células gustativas. Cultivadas humanos fungiformes células papilas gustativas (5 días de edad) se fijaron con paraformaldehído al 4%, y se incubaron con anticuerpos primarios (Tabla 2) durante la noche a 4 ° C. Las imágenes fueron adquiridas con una Leica TCS-SP2 microscopio confocal de barrido láser. Aproximadamente, el 60% de las células cultivadas fungiformes papilas gustativas se marcaron con gustducin (B) y un 20-30% con el PLC-β2 (D). Imágenes de transmisión de celdas correspondientes se muestran (A y C). Para los controles, inmunotinción con anticuerpo inmunoglobulina específica demostró la ausencia de reactividad inespecífica inmuno (datos no presentados). Las barras de escala = 50 nm. Partede la Figura 3 se presentan también en Ozdener et. col. 10.

Figura 4
Figura 4. Cultivadas humanos fungiformes células papilas gustativas de paso de 4 o 5 responden a diferentes estímulos. Cultivadas de las células humanas fungiformes papilas gustativas (4-5 días de edad) fueron cargados con 1 mM Fura-2 AM (Molecular Probes) y 10 mg / ml de Pluronic F127 (Molecular Probes). Los cambios en los niveles de calcio intracelular ([Ca 2 +] i) en cultivos de células humanas fungiformes papilas gustativas se midieron utilizando las técnicas de imagen manual. Las células se visualizaron utilizando un microscopio invertido de fluorescencia a longitudes de onda de excitación de 340 nm y 380 nm y una longitud de onda de emisión establecido por un filtro de paso de banda centrado a 510 nm. Los estímulos se disolvieron en solución del baño y luego reajustó el pH y la osmolaridad, si es necesario. Cultivadas de las células humanas fungiformes papilas gustativas responde a los estímulos dulces y amargas. Graphs ilustran las respuestas representativas de [Ca +2] i niveles en células individuales durante la exposición a (A) denatonio (2 mM), (B) sucralosa (1 mM). Cada traza representa solo las células individuales.

Gene Secuencia PCR condiciones El tamaño esperado
(Pb)
Referencia
β-actina GGACTTCGAGCAAGAGATGG
AGCACTGTGTTGGCGTACAG
7 min
45 seg
45 seg
45 seg
7 min
95
94
53
72
72
234 NM_001101.3
Gustducin TCTGGGTATGTGCCAAATGA
GGCCCAGTGTATTCTGGAAA
7 min
45 seg
45 seg
45 seg
7 min
95
94
53
72
72
386 NM_001102386
PLC-β2 GTCACCTGAAGGCATGGTCT
TTAAAGGCGCTTTCTGCAAT
3 min
30 seg
30 seg
60 seg
7 min
95
94
53
72
72
333 NM_004573

Tabla 1. Los cebadores y las condiciones utilizadas para la detección de moléculas de sabor específicas.

Anticuerpo primario Fuente Anfitrión Dilución Anticuerpo secundario Fuente Anfitrión Dilución
Gustducin SantaCruz Conejo 1:500 Anti-IgG de conejo Alexa 633 Molecular Probes Cabra 1:500
PLC-β 2 SantaCruz Conejo 1:500 Anti-IgG de conejo Alexa 633 Molecular Probes Cabra 1:500

Anticuerpos Tabla 2. Utilizado para detectar la expresión de moléculas específicas.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Hemos mantenido las células obtenidas a partir de las papilas fungiformes humana gusto por más de 8 pasajes, que abarca un período de 12 meses. Estas culturas generar nuevas células, muchos de los que maduran in vitro a la etapa en la que expresan marcadores de varios tipos de células maduras sabor brote, además de importantes propiedades moleculares y fisiológicas de las células receptoras del gusto. La presencia de gusducina y el PLC-β2 inmunoreactividad en los subconjuntos de células en cultivo es consistente con esta conclusión. Más importante aún, algunas células respondieron a las solicitudes de estímulos de sabor dulce y amargo con aumentos transitorios en el calcio intracelular, que es una característica de las células gustativas disociados 5, células en rodajas gustativas 3 y humanas cultivadas y las células de rata gusto 19,10. Esto indica no sólo que algunas de las células en cultivo expresan receptores moleculares para el dulce y lo amargo, pero que no tenían lo suficiente de la cascada de acoplamiento G-proteína de transducción de generar calcium respuestas.

Cultivos a largo plazo de células primarias a menudo no pueden mantener el tejido original y la estructura celular y factores celulares que pueden jugar un papel en la función fisiológica de las células. Por el éxito a largo plazo el establecimiento de la cultura humana de células papilas fungiformes gusto, un gran progreso se ha hecho, sin embargo, una serie de limitaciones deben ser mencionados. La primera de ellas es que cada lote de células primarias de cultivo puede variar debido a diferencias en la población inicial de células que se utilizan para iniciar el cultivo. Los cultivos primarios de células a menudo se pierda la organización del tejido original y la estructura y factores de crecimiento que juegan un papel en la función fisiológica de las células. Las células son a menudo no siempre y totalmente en contacto con otras células, como cultivos nunca se hacen crecer hasta 100% de confluencia. En general, las células primarias son también objeto de desdiferenciación, y la inestabilidad cromosómica, caracterizada por pérdidas o ganancias de cromosomas durante la replicación celular en celular continua Lines, puede ser otro problema 13,14,15. La comparación de los cultivos de células humanas con células fungiformes nontaste cultivo de la lengua, hay que explorar. Estas preguntas requieren el uso de muchos enfoques experimentales y los sistemas de modelo antes de que nuestra comprensión es completa.

En conclusión, este protocolo aquí descrito permite el mantenimiento de las células humanas fungiformes papilas gustativas in vitro durante al menos 8 pasos (12 meses) sin perder las características relacionadas con las células fisiológicos y moleculares. El desarrollo de este cultivo primario a largo plazo, proporcionará un sistema modelo para el estudio de la proliferación y la diferenciación, la especificidad del estímulo, diafonía y las propiedades de adaptación de las células receptoras del gusto, así como la regeneración de tejidos. Además, los efectos de las condiciones que impiden la función celular gusto, como una infección, medicamentos, radiaciones, exposición a sustancias tóxicas o químicas pueden ser examinadas a nivel molecular y fisiológico.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

No hay conflictos de interés declarado.

Acknowledgments

Damos las gracias a Aimee Myers y Quayson Esi por sus habilidades técnicas y de ayuda. Este trabajo fue apoyado en parte por la NSF 0216310 y Givaudan Inc subvención (NER).

References

  1. Mbiene, J. P., Maccallum, D. K., Mistretta, C. M. Organ cultures of embryonic rat tongue support tongue and gustatory papilla morphogenesis in vitro without intact sensory ganglia. J. Comp. Neurol. 377, 324-340 (1997).
  2. Miyamoto, T., Fujiyama, R., Okada, Y., Sato, T. Strain difference in amiloride-sensitivity of salt-induced responses in mouse non-dissociated taste cells. Neurosci. Lett. 277, 13-16 (1999).
  3. Caicedo, A., Jafri, M. S., Roper, S. D. In situ Ca2+ imaging reveals neurotransmitter receptors for glutamate in taste receptor cells. J. Neurosci. 20, 7978-7985 (2000).
  4. Qin, Y. M., Shi, J. Q., Zhang, G. H., Deng, S. P., Wang, T. H. A reliable method to obtain cells of taste buds from fungiform papillae of mice. Acta Histochem. 112, 107-112 (2010).
  5. Spielman, A. I., Mody, I., Brand, J. G., Whitney, G., MacDonald, J. F., Salter, M. W. A method for isolating and patch-clamping single mammalian taste receptor cells. Brain Res. 503, 326-329 (1989).
  6. Kishi, M., Emori, Y., Tsukamoto, Y., Abe, K. Primary culture of rat taste bud cells that retain molecular markers for taste buds and permit functional expression of foreign genes. Neuroscience. 106, 217-225 (2001).
  7. Ruiz, C. J., Stone, L. M., McPheeters, M., Ogura, T., Bottger, B., Lasher, R. S., Finger, T. E., Kinnamon, S. C. Maintenance of rat taste buds in primary culture. Chem. Senses. 26, 861-873 (2001).
  8. Stone, L. M., Tan, S. S., Tam, P. P., Finger, T. E. Analysis of cell lineage relationships in taste buds. J. Neurosci. 22, 4522-4529 (2002).
  9. Ozdener, H., Yee, K. K., Cao, J., Brand, J. G., Teeter, J. H., Rawson, N. E. Characterization and long-term maintenance of rat taste cells in culture. Chem. Senses. 31, 279-290 (2006).
  10. Ozdener, M. H., Brand, J. G., Spielman, A. I., Lischka, F. W., Teeter, J. H., Breslin, P. A., Rawson, N. E. Characterization of Human Fungiform Papillae Cells in Culture. Chem. Senses. 36, 601-612 (2011).
  11. Gomez, G., Rawson, N. E., Hahn, C. G., Michaels, R., Restrepo, D. Characteristics of odorant elicited calcium changes in cultured human olfactory neurons. J. Neurosci. Res. 62, 737-749 (2000).
  12. Wolozin, B., Sunderland, T., Zheng, B. B., Resau, J., Dufy, B., Barker, J., Swerdlow, R., Coon, H. Continuous culture of neuronal cells from adult human olfactory epithelium. J. Mol. Neurosci. 3, 137-146 (1992).
  13. Wick, N., Saharinen, P., Saharinen, J., Gurnhofer, E., Steiner, C. W., Raab, I., Stokic, D., Giovanoli, P., Buchsbaum, S., Burchard, A., Thurner, S., Alitalo, K., Kerjaschki, D. Transcriptomal comparison of human dermal lymphatic endothelial cells ex vivo and in vitro. Physiol. Genomics. 17, 179-192 (2007).
  14. Fu, L., Zhu, L., Huang, Y., Lee, T. D., Forman, S. J., Shih, C. C. Derivation of neural stem cells from mesenchymal stemcells: evidence for a bipotential stem cell population. Stem Cells Dev. 17, 1109-1121 (2008).
  15. Sandow, S. L., Grayson, T. H. Limits of isolation and culture: intact vascular endothelium and BKCa. Am. J. Physiol. Heart Circ. Physiol. 297, H1-H7 (2009).
Aislamiento y cultivo de células humanas las papilas fungiformes gusto
Play Video
PDF DOI

Cite this Article

Ozdener, H., Spielman, A. I., Rawson, N. E. Isolation and Culture of Human Fungiform Taste Papillae Cells. J. Vis. Exp. (63), e3730, doi:10.3791/3730 (2012).More

Ozdener, H., Spielman, A. I., Rawson, N. E. Isolation and Culture of Human Fungiform Taste Papillae Cells. J. Vis. Exp. (63), e3730, doi:10.3791/3730 (2012).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter