Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Biology

में प्रोटीन परिसरों की पहचान doi: 10.3791/4057 Published: November 12, 2012

Summary

आत्मीयता के साथ टैग मास स्पेक्ट्रोमेट्री (APMS) संयोजन में प्रोटीन की शुद्धि प्रोटीन बातचीत नेटवर्क के व्यवस्थित मानचित्रण और जैविक प्रक्रियाओं के यंत्रवत आधार की जांच के लिए एक शक्तिशाली तरीका है. यहाँ, हम एक अनुकूलित अनुक्रमिक पेप्टाइड आत्मीयता (एसपीए) APMS जीवाणु विकसित प्रक्रिया का वर्णन

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. जीन विशेष ई. में SPA - टैगिंग का निर्माण कोलाई DY330 तनाव

  1. प्लाज्मिड pJL148 SPA-टैग डीएनए के अनुक्रम और kanamycin एंटीबायोटिक प्रतिरोध मार्कर कैसेट (कान आर) शामिल पोलीमरेज़ चेन रिएक्शन (पीसीआर) 7 प्रवर्धन में एक टेम्पलेट के रूप में उपयोग किया जाता है. एक 45 NT जीन विशेष आगे प्राइमर, फ्रेम में लक्ष्य जीन स्टॉप कोडोन तुरंत नदी के ऊपर एक 27 बीपी (5'AGCTGGAGGATCCATGGAAAAGAGAAG -3) टैग विशिष्ट आगे प्राइमर के साथ स्थित है, और एक 45 NT के जीन विशेष रिवर्स प्राइमर, तुरंत स्थित 94: के साथ एक 27 (5'-GGCCCCATATGAATATCCTCCTTAGTT -3 ') टैग विशिष्ट रिवर्स प्राइमर बीपी, फ्रेम में लक्ष्य जीन स्टॉप कोडोन के बहाव SPA टैग और कान आर कैसेट pJL148 से निम्नलिखित पीसीआर साइकिल चालन की स्थिति का उपयोग बढ़ाना करने के लिए उपयोग किया जाता है ° सी, 5 मिनट के लिए 1 मिनट, 55 ° 1 मिनट, 68 के लिए सी सी ° 2 मिनट 10 सेकंड के लिए, 10 मिनट के लिए 68 डिग्री सेल्सियस के लिए 94 डिग्री सेल्सियस के 30 चक्र. इन प्रवर्धित दृश्यों में सेवा करते हैंectopically शुरू की λ लाल मुताबिक़ पुनर्संयोजन मशीनरी के लिए substrates (देखें नीचे).
  2. पीसीआर उत्पाद एक Qiaquick पीसीआर शुद्धि किट का उपयोग करने के लिए कि नमक electroporation के साथ हस्तक्षेप कर सकते हैं को दूर शुद्ध होता है. शुद्ध पीसीआर उत्पाद बाद 3 'अंत है जिसमें लाल λ पुनर्संयोजन मशीनरी 10 व्यक्त की है DY330 तनाव में एक विशेष जीन (तुरंत देशी बंद codon के अपस्ट्रीम) में एकीकृत करने के लिए लक्षित है.
  3. Λ लाल DY330 व्यक्त तनाव रातोंरात 2 मिलीलीटर मध्यम Luria Bertani (पौंड) में उगाया जाता है 180 rpm पर झटकों से 32 डिग्री सेल्सियस पर है. रातोंरात संस्कृति के 1 मिलीलीटर बाद में 500 मिलीलीटर शंक्वाकार फ्लास्क में 70 मिलीलीटर ताजा लेग मध्यम में inoculated. inoculum 32 डिग्री सेल्सियस पर 180 rpm पर मिलाते आयुध डिपो 600 तक 0.8 ~ तक उगाया जाता है.
  4. संस्कृति एक ताजा 250 मिलीलीटर शंक्वाकार फ्लास्क, जहां कोशिकाओं को 42 डिग्री पर धीरे झटकों से सी एक पानी में स्नान फ्लास्क incubating द्वारा प्रेरित कर रहे हैं में स्थानांतरित कर रहा है15 मिनट के लिए 180 rpm. अधिष्ठापन के बाद तुरंत, फ्लास्क झटकों के साथ कम से कम 30 मिनट के लिए एक बर्फ के पानी घोल स्नान में incubated है.
  5. ठंडा संस्कृति तुरंत पूर्व ठंडा 50 मिलीलीटर polypropylene ट्यूब में स्थानांतरित कर रहा है और 4 में 6 मिनट के लिए 3993 XG पर centrifugation ° अधीन सी. सेल गोली 50 मिलीलीटर ठंडा बाँझ पानी में resuspended है और 6 मिनट के लिए 3993 XG पर एक बार फिर से 4 डिग्री सेल्सियस पर centrifuged सेल गोली तो ठंडे पानी की 1 मिलीलीटर में resuspended है और 1.5 मिलीग्राम Effendorf ट्यूब हस्तांतरित, और 20 सेकंड के लिए अधिकतम गति से 4 डिग्री सेल्सियस पर centrifuged बर्फ के ठंडे पानी के साथ दो या तीन वाशिंग कदम के बाद, सेल गोली अंत में ठंडा बाँझ पानी के 700 μl में resuspended है, विद्युत सक्षम कोशिकाओं में जिसके परिणामस्वरूप.
  6. Electroporation के माध्यम से शुद्ध amplicon की एक μl विद्युत सक्षम कोशिकाओं के 40 μl में शुरू की है. 2.5 केवी, 25 नाड़ी के साथ μF: कोशिकाओं एक जैव रेड GenePulser द्वितीय में निम्नलिखित सेटिंग्स के साथ electroporated200 Ω के नियंत्रक. मुताबिक़ पुनर्संयोजन और एकीकरण के बाद, कि सफलतापूर्वक टैग / गुणसूत्र में कैसेट recombined transformants कान (चित्रा 1 ए) के प्रतिरोध के आधार पर चयन कर रहे हैं. एकाधिक transformants पश्चिमी SPA टैग संलयन प्रोटीन की सही (यानी सकारात्मक संकेत) विरोधी झंडा M2 एंटीबॉडी कि SPA टैग का ध्वज epitopes के खिलाफ चयनात्मक है साथ पीढ़ी को सत्यापित सोख्ता के लिए चयन कर रहे हैं.
  7. की पुष्टि की carboxy टर्मिनल संलयन तनाव एक बड़े पैमाने पर काटा स्पा शुद्धि प्रोटोकॉल का उपयोग कोशिकाओं से घुलनशील प्रोटीन परिसरों को अलग SPA टैग पर सभ्य है. आत्मीयता टैग शोधन प्रक्रिया में शामिल कदम की रूपरेखा चित्रा 1 बी में दिखाया गया है.

2. संवर्धन और Sonication

  1. 100 एक SPA टैग ई. μl टीका लगाना कोलाई 50 मिलीलीटर भयानक शोरबा (टीबी) में ग्लिसरॉल स्टॉक तरल माध्यम 25 ग्राम / एमएल ओ की 50 μl के साथ पूरकच एक 250 मिलीलीटर शंक्वाकार फ्लास्क में कान समाधान. 32 डिग्री सेल्सियस पर संस्कृति रातोंरात आगे बढ़ें
    नोट: चूंकि DY330 तनाव में λ तापमान inducible लाल कैसेट एक तापमान के प्रति संवेदनशील repressor 10 के नियंत्रण के तहत है, SPA टैग ई. कोलाई तनाव 32 डिग्री सेल्सियस पर उगाया जाता है
  2. 990 मिलीलीटर ताजा एक 4 लीटर फ्लास्क में 25 / कान की ग्राम मिलीलीटर के साथ पूरक टीबी में स्थानांतरण रातोंरात संस्कृति की 10 मिलीलीटर. संस्कृति 32 डिग्री पर 250 rpm पर लगातार 5 से 6 घंटा, मिलाते हुए साथ सी हो गई है, आयुध डिपो 600 तक ~ 2 3 के लिए पहुंचता है.
  3. 1 लीटर स्थानांतरण ई. कोलाई SPA टैग के centrifugation बोतलों को साफ करने के लिए और 4 ° Beckman में सी अपकेंद्रित्र J6-HC 15 मिनट के लिए 3993 XG कोशिकाओं स्पिन संस्कृति.
  4. तैरनेवाला centrifugation बोतलों से हटा दिया है. ई. Resuspend कोलाई sonication बफर के 25 मिलीलीटर के साथ सेल छर्रों. सभी समय पर बर्फ पर centrifugation की बोतलें रखने के लिए सुनिश्चित करें.
  5. resuspended गोली50 मिलीलीटर polypropylene बाज़ ट्यूब को हस्तांतरित और तरल नाइट्रोजन का उपयोग करते हुए जमे हुए. जमे हुए कोशिकाओं -80 ° लंबे समय तक इस्तेमाल के लिए सी संग्रहीत हैं.
  6. पहले sonication, जमे हुए कोशिकाओं को पूरी तरह से पिघलना करने के लिए द्वारा बर्फ पर छर्रों रखने. thawed नमूने एक बाँझ स्टेनलेस स्टील sonication के लिए बर्फ पर रखा कप के लिए स्थानांतरित कर रहे हैं. जांच के नमूने में डूबे हुए है और 3 मिनट के लिए sonicated. एक अतिरिक्त 2 मिनट overheating से नमूना शांत करने के लिए अनुमति दी है.
  7. sonicated सेल lysate पूर्व ठंडा बाँझ centrifugation ट्यूब में स्थानांतरित कर रहा है, और 4 डिग्री सेल्सियस पर Beckman अपकेंद्रित्र में दो बार 15 मिनट के लिए एक जावेद 17 रोटर @ XG 35,267 (16,000 rpm) का उपयोग कर centrifugation के अधीन करने के लिए.
    नोट: झिल्ली प्रोटीन शोधन के मामले में, sonicated सेल lysate केवल एक बार 15 मिनट के लिए centrifuged है क्योंकि हम नहीं जानते कि जो अंश में झिल्ली प्रोटीन होते हैं, जो या तो गोली या तैरनेवाला अंश में है. तो मेम से अधिक नुकसान से बचने के लिएbrane प्रोटीन, हम उच्च गति centrifugation पर 15 मिनट और तैरनेवाला बाद में शुद्धि के लिए कार्रवाई की है (कदम नीचे देखें) जहां 1% डिटर्जेंट झिल्ली प्रोटीन solubilize लिए इस्तेमाल किया है के लिए कोशिकाओं स्पिन.
  8. centrifugation ट्यूब से सतह पर तैरनेवाला ध्यान से एक 50 मिलीलीटर polypropylene बाज़ ट्यूब को सौंप दिया है और तरल नाइट्रोजन का उपयोग जमे हुए है. sonicated जमे हुए सेल निकालने -80 डिग्री सेल्सियस पर भविष्य में उपयोग के लिए 6 महीने की अधिकतम अवधि के लिए भंडारित किया जाता है.

3. संबंध शुद्धीकरण

  1. उपयोग करने के लिए पहले, विरोधी झंडा M2 मोती के 100 μl एएफसी बफर के 10 संस्करणों (30 मिमी Tris एचसीएल, 150 मिमी NaCl, 0.1% डिटर्जेंट, और 0.1-0.5 मिमी [tris (2 carboxyethyl TCEP) phosphine से धोया जाता है - हाइड्रोक्लोरिक] डिटर्जेंट के बिना) एसिड और कम एजेंट TCEP (tris phosphine (2-carboxyethyl)).
  2. जमे हुए, sonicated सेल निकालने के ठंडे पानी में ट्यूब डाल द्वारा thawed है. thawed सेल निकालने benzo की 3 μl साथ incubated है4 डिग्री सेल्सियस पर 30 मिनट के लिए nase nuclease इस मिश्रण को जोड़ने के लिए, गैर ईओण डिटर्जेंट (डिटर्जेंट के अंतिम एकाग्रता 0.1% होना चाहिए) ट्राइटन X-100 और 200 μl निलंबन विरोधी झंडा M2 agarose मोतियों की.
    नोट: सभी घुलनशील प्रोटीन Purifications के लिए, 0.1% ट्राइटन X-100 गैर विशिष्ट सोखना, कम से कम करने के लिए प्रयोग किया जाता है, जहां के रूप में एक झिल्ली प्रोटीन, अलग C12E8 (Octaethylene glycol Dodecyl ईथर) जैसे हल्के गैर ईओण डिटर्जेंट, DDM सफ़ाई के लिए ( n-Dodecyl) β-D-maltoside और माल्टोस - neopentyl glycol (MNG) 1% डिटर्जेंट एकाग्रता में इस्तेमाल किया जा सकता solubilization बढ़ाने के. चूंकि अलग डिटर्जेंट झिल्ली प्रोटीन के solubilization क्षमता अलग है, यह करने के लिए स्वतंत्र प्रोटीन Purifications एक से अधिक डिटर्जेंट का उपयोग कर प्रदर्शन करने के लिए सिफारिश की है.
  3. सामग्री धीरे से 3 घंटे के लिए 4 डिग्री सेल्सियस पर ट्यूब एक LabQuake हिलनेवाला का उपयोग कर घूर्णन द्वारा मिलाया जाता है. रोटेशन के 3 घंटा के बाद, ट्यूब 6 मिनट के लिए 1700 XG पर centrifuged है. तैरनेवाला तो है rध्यान emoved है, के रूप में संभव के रूप में ज्यादा ढीला मनका गोली को परेशान करने के बिना,.
  4. गोली शेष तैरनेवाला में resuspended है और फिर एक 0.8 x 4 सेमी जैव रेड polypropylene प्रस्तुत करने का कॉलम में स्थानांतरित. स्तंभ के नीचे आउटलेट प्लग को दूर करने के लिए सुनिश्चित करने के लिए eluates गुरुत्वाकर्षण प्रवाह से पलायन करने के लिए अनुमति देते हैं. स्तंभ TEV दरार कदम के साथ 5 बार धोएं.
  5. धोया eluates draining के बाद, स्तंभ के नीचे दुकान बंद कर दिया है. उसी स्तंभ, दरार स्तंभ पर ~ TEV protease और 1X एएफसी बफर के 400 μl के 5 से 10 μl (50 इकाइयों) जोड़ने के द्वारा किया जाता है. एक टोपी के साथ स्तंभ के ऊपर बंद करने के लिए सुनिश्चित करें. मोती युक्त स्तंभ धीरे घुमाया रातोंरात 4 ° C रातोंरात में एक LabQuake हिलनेवाला का उपयोग कर.
  6. और स्तंभ के नीचे दुकान के प्लग शीर्ष पर टोपी निकालें, और eluates एक ताजा calmodulin sepharose मोती के 200 μl निलंबन, जो 10 से धोया जाता है युक्त स्तंभ में TEV दरार के बाद बरामद नालीcalmodulin बाध्यकारी बफर की मात्रा.
  7. दोनों शीर्ष और स्तंभ के नीचे कसकर बांधा जाता है, और स्तंभ में सामग्री धीरे 4 में 3 घंटे के लिए घूर्णन ° C एक LabQuake हिलनेवाला का उपयोग कर से मिश्रित कर रहे हैं.
  8. रोटेशन के 3 घंटा के बाद, प्रोद्धावन में प्रयोग किया जाने वाला घोलक शीर्ष और स्तंभ के नीचे प्लग टोपी हटाने के द्वारा सूखा है. स्तंभ एक calmodulin धोने बफर के 400 μl साथ कड़े धोने द्वारा पीछा 1X calmodulin बाध्यकारी बफर के 200 μl के साथ चार बार धोया जाता है.
  9. बाध्य प्रोटीन 1X calmodulin क्षालन बफर का उपयोग एक ताजा Eppendorf ट्यूब में 50 μl के चार भागों में eluted है. eluted अंश दो बराबर मात्रा में साफ Eppendorf ट्यूब में वितरित किया जाता है. दोनों ट्यूबों बाद में एक गति निर्वात का उपयोग सूख रहे हैं.
  10. एक ट्यूब से सूखे प्रोद्धावन में प्रयोग किया जाने वाला घोलक एक चांदी धुंधला हो जाना जेल चलाने के लिए प्रयोग किया जाता है, जबकि अन्य -80 डिग्री सेल्सियस में संग्रहीत किया जाता है, मास स्पेक्ट्रोमेट्री का उपयोग करने से पहले,.

4. रजत धुंधला

  1. चांदी staini के लिएएनजी, 3X (सोडियम Dodecyl सल्फेट) एसडीएस नमूना बफर का आधा मात्रा सूखे प्रोद्धावन में प्रयोग किया जाने वाला घोलक के 50 μl जोड़ा जाता है. 5 मिनट के लिए मिश्रण उबलते के बाद, नमूने एक एसडीएस polyacrylamide जेल पर लोड कर रहे हैं.
  2. बाद जेल चल रहा समाप्त हो गया है, यह ध्यान फिक्सिंग समाधान में रखा गया है (50% और 10% मेथनॉल एसिटिक एसिड) और 20 मिनट के लिए एक रोटरी हिलनेवाला पर धीरे उत्तेजित. जेल में फिर 10 मिनट के लिए 20% इथेनॉल में rinsed है.
  3. निश्चित जेल में दो बार दोहरा आसुत जल के 500 मिलीलीटर के साथ 10 मिनट के लिए अच्छी तरह से धोया जाता है यह सुनिश्चित हो सके कि वर्दी पृष्ठभूमि करने के लिए कम है.
  4. जेल तो 500 मिलीग्राम सोडियम thiosulfate में धीरे 1 मिनट, 20 सेकंड के लिए दो धोने आसुत जल के साथ कदम से बाद के लिए उत्तेजित.
  5. पानी खारिज कर दिया है, और 30 मिनट के लिए 0.1% चांदी नाइट्रेट के 200 मिलीलीटर जेल में incubated है. उस समय के बाद, चांदी नाइट्रेट हटा दिया है और जेल आसुत जल के साथ 20 सेकंड के लिए धोया जाता है ताकि अतिरिक्त चांदी नाइट्रेट हटाने.
  6. जेल के अंत में 75 मिलीलीटर में उत्तेजित हाथविकासशील समाधान के. जब वांछित तीव्रता हासिल की है, के विकास समाधान त्याग और एसिटिक एसिड के 80 मिलीलीटर प्रतिक्रिया को रोकने के लिए जोड़ा जाता है. जेल बैंड के उचित दृश्य के लिए 20 मिनट की एक न्यूनतम के लिए एसिटिक एसिड में जेल सेते हैं सुनिश्चित करें.

5. और मास स्पेक्ट्रोमेट्री के लिए नमूना तैयार proteolysis

  1. सूखे नमूना, पाचन बफर के 50 μl और 100 मिमी TCEP एचसीएल ((2-carboxyethyl) tris phosphine - हाइड्रोक्लोरिक एसिड) के 0.9 μl जोड़ने और कमरे के तापमान पर 45 मिनट के लिए मिश्रण सेते हैं कमी के लिए कदम. अगले, 500 मिमी iodoacetamide के 1 μl जोड़ी जाती है और नमूना alkylation के लिए अनुमति देने के लिए एक और 40 मिनट के लिए अंधेरे में incubated.
  2. ऊष्मायन के दूसरे दौर के बाद, मिश्रण immobilized trypsin की 1 ग्राम जोड़ने और 5 घंटा या कमरे के तापमान पर रात भर के लिए या तो 37 डिग्री सेल्सियस पर सेते हैं. एसिटिक एसिड की 1 μl जोड़कर प्रतिक्रिया को रोकने के सुनिश्चित करें.
  3. पूर्व गीला Millipoपुनः ज़िप टिप aspirating गीला और संतुलन समाधान के 10 μl विंदुक टिप. बर्बाद करने के लिए समाधान बांटना. इसके बाद वाशिंग समाधान के 10 μl aspirate और बर्बाद करने के लिए समाधान बांटना. इस कदम को दो बार दोहराएँ.
  4. टिप करने के लिए पेप्टाइड मिश्रण के कुशल बंधन के लिए, पिपेट पेप्टाइड मिश्रण 20 गुना मिश्रण. पेप्टाइड मिश्रण है कि टिप का पालन aspirating और धोने समाधान वितरण से धोया जाता है. पेप्टाइड मिश्रण के कुशल टिप करने के लिए बाध्य करने के लिए इस प्रक्रिया को दो बार दोहराएँ.
  5. बाध्य पेप्टाइड युक्त टिप के साथ, गीला और संतुलन समाधान के 10 μl aspirate, और एक साफ Eppendorf ट्यूब में बांटना. इस कदम दो बार दोहराएँ. गति शून्य में eluted नमूने सुखाने के बाद, नमूने मास स्पेक्ट्रोमेट्री द्वारा तुरंत विश्लेषण कर सकते हैं या -80 पर संग्रहीत ° C उपयोग करने के लिए पूर्व.

6. LTQ Orbitrap Velos मास स्पेक्ट्रोमीटर से प्रोटीन की पहचान

गुअलग परिसरों की ई पॉलीपेप्टाइड घटकों एक LTQ Orbitrap Velos संकर अग्रानुक्रम मास स्पेक्ट्रोमीटर का उपयोग की पहचान कर रहे हैं. Orbitrap असाधारण हल करने (> 60,000 पूर्ण चौड़ाई आधा अधिकतम, या FWHM) शक्ति और जन (<2 पीपीएम) सटीकता कि अप्रासंगिक गैर विशिष्ट पृष्ठभूमि नियंत्रण Purifications में पाया contaminants एमएस / एमएस के नमूने minimizes है, जबकि उच्च गति Velos आयन जाल घटक का पता लगाने और टुकड़ा कम बहुतायत पेप्टाइड्स दोनों इलेक्ट्रॉन हस्तांतरण हदबंदी और टक्कर प्रेरित पृथक्करण मोड का उपयोग कर सकते हैं. जिसके परिणामस्वरूप एमएस / एमएस स्पेक्ट्रा के बीच उच्च आत्मविश्वास मैचों संदर्भ ई. को मैप किए जाते हैं कोलाई प्रोटीन दृश्यों SEQUEST और प्रत्येक मिलान STATQUEST 11 की तरह एक संभावना एल्गोरिथ्म के दौरान मूल्यांकन अनुक्रम की तरह डेटाबेस खोज एल्गोरिथ्म का इस्तेमाल करते हैं. कुल स्पेक्ट्रा संख्या, पेप्टाइड अनुक्रम विशिष्टता और आम पृष्ठभूमि नकारात्मक (यानी नकली) नियंत्रण Purifications में पाया contaminants के एक कम अनुभवजन्य झूठी जिले को प्राप्त करने के लिए माना जाता हैcovery दर. निम्नलिखित कदम प्रोटीन की पहचान के लिए प्रदर्शन कर रहे हैं:

  1. सूक्ष्म कॉलम लूना 3 - सी 18 राल सुक्ष्ममापी ~ 10 सेमी के साथ पैक कर रहे हैं और एक Proxeon nanoelectrospray आयन स्रोत है कि Orbitrap साधन के साथ लाइन में रखा गया है interfaced हैं.
  2. एक Proxeon नैनो प्रवाह बाइनरी HPLC पंप पेप्टाइड separations के दौरान ~ 300 nl मिनट -1 के एक स्थिर टिप प्रवाह दर देने के लिए प्रयोग किया जाता है.
  3. पेप्टाइड क्षालन को प्राप्त करने के लिए, एक कार्बनिक बफर ढाल नमूना जटिलता के अनुसार सेट कर दिया जाता है. उदाहरण के लिए, निम्न ढाल आमतौर ई. के लिए सेट कोलाई SPA नमूने: विलायक बी 2% से 6% से 1 मिनट में वृद्धि हुई है, 38 मिनट में 24% करने के लिए अगले 4 मिनट, 1 मिनट के लिए 100% पर आयोजित में 100% करने के लिए, तो 1 मिनट में 2% की कमी हुई है, और अंतिम 2% से कम 15 मिनट के लिए पकड़. मोबाइल चरण विलायक 95% HPLC ढाल और 0.1% फार्मिक एसिड के साथ 5% ACN पानी है, जबकि विलायक बी 5% HPLC ढाल और 0.1% फार्मिक aci के साथ 95% ACN पानीd. सुई की नोक पर प्रवाह की दर को 60 मिनट के लिए 300 nl मिनट -1 के लिए सेट कर दिया जाता है.
  4. मास स्पेक्ट्रोमीटर चक्र के रूप में 60,000 प्रस्तावों पर एक पूर्ण जन स्कैन के माध्यम से चलाने के लिए, 10 सहवर्ती मिलकर विखंडन जन स्कैन सबसे तीव्र अग्रदूत आयनों के लिए एकत्र होते हैं. गतिशील अपवर्जन, monoisotopic बड़े पैमाने पर चयन, और वास्तविक समय डाटा निर्भर अधिग्रहण साधन सुविधाओं सक्षम हैं.
  5. स्पेक्ट्रा ई. के एक डेटाबेस के खिलाफ SEQUEST के रूप में एक डेटाबेस खोज एल्गोरिथ्म का उपयोग कर खोजा कोलाई प्रोटीन दृश्यों, और परिणाम सांख्यिकीय ऐसे 11 STAQUEST रूप में एक संभावना एल्गोरिथ्म का उपयोग करने के लिए एक कम झूठी खोज दर सुनिश्चित फ़िल्टर्ड है. केवल उच्च आत्मविश्वास (99% संभावना) उम्मीदवारों का चयन कर रहे हैं, जबकि मैच सैद्धांतिक पेप्टाइड द्रव्यमान की तुलना में 10 से अधिक पीपीएम जन त्रुटि दिखा रहे हैं आगे विचार से सफाया कर दिया.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

SPA आधारित APMS दृष्टिकोण का एक महत्वपूर्ण पहलू यहाँ वर्णित है कि टैगिंग प्राकृतिक गुणसूत्र संदर्भ में किया जाता है, जिससे सामान्य जीन विनियमन सुनिश्चित करने (यानी देशी चारा प्रमोटर संरक्षित, इसलिए अभिव्यक्ति के स्तर परेशान नहीं है) बनाए रखा है और stably से जुड़े देशी प्रोटीन परिसरों के पास अंतर्जात स्तर पर बरामद कर रहे हैं. ओपेरोन polarity मुद्दों पर भी चयन मार्कर में एक बाहर उन्मुख प्रमोटर सहित परहेज कर रहे हैं. यह स्पा टैगिंग दृष्टिकोण काफी प्रभावी निकट एकरूपता कम बहुतायत परिसरों, झिल्ली जुड़े विधानसभाओं सहित, के घटकों को शुद्ध भी अगर सब यूनिटों नीचे केवल बैक्टीरियल सेल प्रति कुछ अणुओं को व्यक्त कर रहे हैं है. कुल मिलाकर, इस प्रोटोकॉल स्केल अप आसानी से ई. में टैग घुलनशील प्रोटीन के बड़े सेट सफ़ाई के लिए हो सकता है कोली या सिद्धांत रूप में किसी भी अन्य बैक्टीरियल प्रजातियों जो लिए recombineering माध्यम टैगिंग संभव है, या हैं कि posses स्वाभाविक रूप से उच्च transformation क्षमता, बैक्टीरियल आनुवंशिकी के एक उभरते workhorse, इस्तेमाल किया गया है कि उदाहरण के लिए, लक्षित जीन 13 knockouts के एक तनाव पुस्तकालय का निर्माण, Acinetobacter तरह.

प्रोटिओमिक दृष्टिकोण के लिए निहित के लिए बड़े पैमाने पर एक प्रमुख चिंता अनेक प्रकार का गैर विशिष्ट interactors और नकली ट्रेस संदूषण की पहचान की है. संवर्धन के दो दौर के बावजूद नियमित रूप से हमारी दिनचर्या स्पा Purifications अक्सर contaminants जो आम तौर पर कर रहे हैं उच्च बहुतायत ribosomal प्रोटीन और संरक्षिकाओं, जो chromatographic राल और / या चारा प्रोटीन गैर विशेष रूप से बाइंड करने के लिए के रूप में गृह व्यवस्था प्रोटीन, का पता लगाने के लिए. दो मायनों में इस समस्या को कम किया जा सकता है. सबसे पहले, कुल वर्णक्रमीय और प्रत्येक एक विशेष रूप से चारे के साथ पहचान की प्रोटीन की संख्या विशिष्टता कई असंबंधित प्रोटीन फँसाना चाहे का Purifications की एक व्यापक सेट रिश्तेदार और untagged (यानी जंगली प्रकार) नकारात्मक नियंत्रण उपभेदों (यानी नकली संबंध शुद्धीकरण अनुभव से माना जाता है) iments झूठी सकारात्मक संघों को कम करने के लिए. दूसरा, सभी उम्मीदवार प्रोटीन बातचीत पारस्परिक टैगिंग और ख्यात बाध्यकारी साथी की शुद्धि का उपयोग करते हुए स्वतंत्र रूप से की पुष्टि व्यक्ति प्रोटीन, प्रोटीन बातचीत के लक्ष्य के लिए दुर्लभ मामलों में स्पा टैग की उपस्थिति में देशी प्रोटीन का समावेश perturbs से बचने के साथ मान्य किया जाना चाहिए अंतर्जात प्रोटीन विधानसभा.

APMS आधारित प्रोटिओमिक सर्वेक्षण क्षणिक या उप stoichiometric बातचीत की पहचान के मामले में संवेदनशीलता की कमी के द्वारा सीमित कर रहे हैं. ऐसे मामलों में, एकल चरण शुद्धि प्रक्रिया कमजोर बातचीत भागीदारों की पहचान बढ़ाने के लिए इस्तेमाल किया जा सकता है. ई. के लिए चल रहे हमारे दशक लंबे अध्ययन के पाठ्यक्रम के दौरान कोलाई interactome, हम नई पीढ़ी मास स्पेक्ट्रोमीटर का पता लगाने क्षमताओं में तेजी से सुधार देखा है. वृध्द उपकरण अत्यधिक प्रचुर मात्रा में प्रोटीन की आवर्तक पहचान करने के लिए पक्षपातपूर्ण है, अक्सर कम अबू का पता लगाने precludingndant लेकिन संभवतः बहुत महत्वपूर्ण बातचीत प्रोटीन. इसके विपरीत, Orbitrap संकर मास स्पेक्ट्रोमीटर हम वर्तमान में उल्लेखनीय सुधार संकल्प, जन सटीकता, और संवेदनशीलता जिससे कहीं अधिक कुशल, कम बहुतायत प्रोटीन की उच्च throughput पता लगाने क्षणिक बातचीत शामिल है, की अनुमति का उपयोग Velos. अंत में, यदि बातचीत की प्रकृति को पूरी तरह से अनजान है हम शोधकर्ताओं का सुझाव है: (i) कड़े मापदंड लागू करने के लिए सभी ख्यात डेटाबेस खोज मैचों के लिए आत्मविश्वास स्कोर आवंटित. दो या दो से अधिक अद्वितीय पेप्टाइड्स के साथ प्रोटीन आमतौर पर सकारात्मक माना जाता है, यह मानते हुए प्रत्येक मैच में 99% या अधिक से अधिक संभावना की एक न्यूनतम संभावना सीमा काट के साथ गुजरता है, (ii) उम्मीदवार प्रोटीन interactors की विशिष्टता टैग में चारा के साथ दर्ज की जांच सुनिश्चित करें नकारात्मक नियंत्रण untagged (नकली प्रयोगों) उपभेदों असंबंधित या प्रोटीन फँसाना चाहे के साथ प्राप्त परिणामों की तुलना, (iii) आपस में संभावित अंतर का एक अज्ञात प्रोटीन युक्त बातचीत की पुष्टिस्था शुद्धि के लिए बड़े पैमाने पर इसी SPA टैग चारा संलयन बनाने या प्रोटीन विशिष्ट या टैग विशिष्ट एंटीबॉडी के साथ जोड़ी वार पारंपरिक सह immunoprecipitation का उपयोग कर बातचीत मान्य के द्वारा.

तिथि करने के लिए, इस व्यवस्थित दृष्टिकोण का उपयोग, हम टैग और ~ +२,७५० ई. के दो तिहाई के आसपास शुद्ध में कामयाब रहे हैं कोलाई घुलनशील प्रोटीन है कि अमीर मध्यम 1, 2 में detectably संस्कृति के तहत व्यक्त. हम भी इस एक ही मूल विधि अनुकूलित है के लिए व्यवस्थित झिल्ली जुड़े प्रोटीन परिसरों को अलग करने के लिए, और अब शेष ई. ~ 1000 से प्रत्येक को शुद्ध करने का प्रयास कर रहे हैं कोलाई प्रोटीन झिल्ली बाध्य होने की भविष्यवाणी की. जबकि झिल्ली प्रोटीन की शुद्धि अक्सर अद्वितीय चुनौती बन गया है क्योंकि वे अक्सर निष्कर्षण बफर द्वारा कुशलतापूर्वक नहीं solubilized कि हम सामान्य रूप SPA विधि के लिए उपयोग, गैर ईओण डिटर्जेंट हमारे buffers के अलावा solubilization और के बहुमत के शुद्धि के लिए सक्षम बनाता है ई. कोलाई </ Em> झिल्ली प्रोटीन हम आज तक करने का प्रयास किया है (बाबू एट अल, अप्रकाशित डेटा).

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

ब्याज की कोई संघर्ष की घोषणा की.

Acknowledgments

यह काम अभिनव, जीनोम कनाडा, ओंटारियो जीनोमिक्स संस्थान, अभिनव के ओंटारियो मंत्रालय, और स्वास्थ्य अनुसंधान अनुदान के कनाडा JG संस्थानों और ई. लाल व्यक्त AE के लिए कनाडा फाउंडेशन से धन के द्वारा समर्थित किया गया था कोलाई DY330 तनाव डोनाल्ड एल कोर्ट (राष्ट्रीय कैंसर संस्थान, फ्रेडरिक, एमडी) से एक तरह का उपहार था.

Materials

Name Company Catalog Number Comments
I. Antibiotics
Kanamycin Bioshop #KAN201
Ampicillin Bioshop #AMP201
2. Terrific-Broth medium
Bio-Tryptone Bioshop #TRP 402
Yeast extract Bioshop #YEX 555
Glycerol Bioshop #GLY 002
K2HPO4 Bioshop #PPM 302
KH2PO4 Bioshop #PPM 303
3. Bacterial Strain and Plasmid
DY330 Yu et al. (2000)10
pJL148 Zeghouf et al. (2004)7
4. PCR and Electrophoresis Reagents
Taq DNA polymerase Fermentas # EP0281
10 X PCR buffer Fermentas # EP0281
10 mM dNTPs Fermentas # EP0281
25 mM MgCl2 Fermentas # EP0281
Agarose Bioshop # AGA002
Loading dye NEB #B7021S
Ethidium bromide Bioshop # ETB444
10X TBE buffer Thermo Scientific #28355
Tris Base Bioshop #TRS001
Boric acid Bioshop #BOR001
0.5 M EDTA (pH 8.0) Sigma # E6768
DNA ladder NEB #N3232L
5. Plasmid isolation and Clean-up Kits
Plasmid Midi kit Qiagen #12143
QIAquick PCR purification kit Qiagen #28104
6. PCR and Transformation Equipments
Thermal cycler BioRad iCycler
Agarose gel electrophoresis BioRad
Electroporator Bio-Rad GenePulser II
0.2 cm electroporation cuvette Bio-Rad
42 °C water bath shaker Innova 3100
Beckman Coulter TJ-25 centrifuge Beckman Coulter TS-5.1-500
32 °C Shaker New Brunswick Scientific, USA
32 °C large Shaker New Brunswick Scientific, USA
32 °C plate incubator Fisher Scientific
7. Electrophoresis and Western blotting
Acrylamide monomer, N,N'- methylenebis-acrylamide Bio-Rad #161-0125
Ammonium persulfate Bioshop # AMP001
n-butanol Sigma # B7906
TEMED Bioshop #TEM001
Whatman No. 1 filter paper Fischer Scientific #09-806A
Mini protean 3 cell Bio-Rad #165-3301
iBlot gel transfer device Invitrogen #IB1001
Nitrocellulose membranes Bio-Rad #162-0115
Monoclonal Anti-Flag M2 antibody Sigma #F3165
Horseradish peroxidase Amersham #NA931V
Pre-stained protein molecular weight standards Bio-Rad #161-0363
Chemiluminescence reagent PIERCE #1856136
Autoradiography film Clonex Corp #CLEC810
Quick Draw blotting paper Sigma #P7796
C2 platform rocking shaker New Brunswick Scientific, USA
8. Sonication Equipment and Reagents
Sonicator Branson Ultrasonic #23395
NaCl Bioshop #SOD001
Protease inhibitors Roche #800-363-5887
0.5 mM TCEP-HCl Thermo Scientific #20490
9. Affinity Purification Reagents and Equipment
0.8 x 4 cm Bio-Rad polypropylene column Bio-Rad #732-6008
Benzonase nuclease Novagen #70746
Anti-FLAG M2 agarose beads Sigma #A2220
Calmodulin-sepharose beads GE Healthcare #17-0529-01
TEV protease Invitrogen #12575-015
Triton X-100 Sigma #T9284
CaCl2 Sigma #C2661
EGTA Sigma #E3889
LabQuake Shaker Thermolyne #59558
10. Silver Staining Reagents
Methanol Bioshop #MET302
Acetic acid Bioshop t#ACE222
Sodium-thiosulfate Sigma #S-7143
Silver nitrate Fischer Scientific #S181-100
Formaldehyde Bioshop #FOR201
Sodium carbonate Bioshop #SOC512
11. Reagents and Equipment for Protein Identification
Trypsin Gold, Mass Spectrometry Grade Promega # V5280
50 mM NH4HCO3 Bioshop #AMC555
1 mM CaCl2 Bioshop #CCL302
Acetonitrile Sigma #A998-4
Formic acid Sigma #F0507
HPLC grade water Sigma #95304
Iodoacetamide Sigma #16125
Millipore Zip-Tip Millipore # ZTC18M960
~10 cm of 3 μm Luna-C18 resin Phenomenex
Proxeon nano HPLC pump Thermo Fisher Scientific
LTQ Orbitrap Velos mass spectrometer Thermo Fisher Scientific
12. Labware
4 liter conical flasks VWR #89000-372
50 ml polypropylene falcon tubes Any Vendor
1.5 ml micro-centrifuge tubes Any Vendor
250 ml conical flaks VWR #29140-045
15 ml sterile culture tubes Thermo Scientific #366052
Cryogenic vials VWR #479-3221
-80 °C freezer Fisher Scientific #13-990-14
Speed vacuum system Thermo Scientific

Buffers and Solutions

1. 1 liter Terrific Broth (TB) media

11 g Bio-Tryptone
22 g Yeast Extract
2% Glycerol
50 ml potassium salt stock solution

2. Potassium Salt Stock Solution

1.5 M K2HPO4
0.35 M KH2PO4

3. Sonication Buffer

20 mM Tris-HCl (pH 7.9)
150 mM NaCl
0.2 mM EDTA
10% Glycerol
Before use add protease inhibitor (PI) and 0.1-0.5 mM TCEP

4. AFC buffer

30 mM Tris-HCl (pH 7.9)
150 mM NaCl
0.1% detergent
Before use add PI and 0.1-0.5 mM TCEP

5. TEV cleavage buffer

30 mM Tris-HCl (pH 7.9)
150 mM NaCl
0.2 mM EDTA
0.1% detergent
Before use add PI and 0.1-0.5 mM TCEP

6. Calmodulin binding buffer

30 mM Tris-HCl (pH 7.9)
150 mM NaCl
2 mM CaCl2
0.1% detergent
Before use add PI and 0.1-0.5 mM TCEP

7. Calmodulin wash buffer

30 mM Tris-HCl pH 7.9
150 mM NaCl
2 mM CaCl2
0.1-0.5 mM TCEP

8. Calmodulin elution buffer

30 mM Tris-HCl (pH 7.9)
100 mM NaCl
10 mM EGTA
0.1-0.5 mM TCEP

9. Developing solution (1L)

37% Formaldehyde
30 g sodium carbonate
1000 ml distilled water

10. Digestion buffer

50 mM NH4HCO3
1 mM CaCl2

11. Wetting and Equilibration solution

70% acetonitrile (ACN) in 0.1% formic acid

12. Washing solution

100% H2O in 0.1% formic acid

DOWNLOAD MATERIALS LIST

References

  1. Butland, G., et al. Interaction network containing conserved and essential protein complexes in Escherichia coli. Nature. 433, 531-537 (2005).
  2. Hu, P., Janga, S. C., Babu, M., Diaz-Mejia, J. J., Butland, G. Global functional atlas of Escherichia coli encompassing previously uncharacterized proteins. PLoS Biol. 7, e1000096 (2009).
  3. Krogan, N. J., et al. Global landscape of protein complexes in the yeast Saccharomyces cerevisiae. Nature. 440, 637-643 (2006).
  4. Mak, A. B., et al. A lentiviral functional proteomics approach identifies chromatin remodeling complexes important for the induction of pluripotency. Mol. Cell Proteomics. 9, 811-823 (2010).
  5. Polanowska, J., et al. Tandem immunoaffinity purification of protein complexes from Caenorhabditis elegans. Biotechniques. 36, 778-782 (2004).
  6. Veraksa, A., Bauer, A., Artavanis-Tsakonas, S. Analyzing protein complexes in Drosophila with tandem affinity purification-mass spectrometry. Dev. Dyn. 232, 827-834 (2005).
  7. Zeghouf, M., et al. Sequential Peptide Affinity (SPA) system for the identification of mammalian and bacterial protein complexes. J. Proteome Res. 3, 463-468 (2004).
  8. Puig, O., et al. The tandem affinity purification (TAP) method: a general procedure of protein complex purification. Methods. 24, 218-229 (2001).
  9. Rigaut, G., et al. A generic protein purification method for protein complex characterization and proteome exploration. Nat. Biotechnol. 17, 1030-1032 (1999).
  10. Yu, D., et al. An efficient recombination system for chromosome engineering in Escherichia coli. Proc. Natl. Acad. Sci. U.S.A. 97, 5978-5983 (2000).
  11. Kislinger, T., et al. PRISM, a generic large scale proteomic investigation strategy for mammals. Mol. Cell Proteomics. 2, 96-106 (2003).
  12. Vlasblom, J., et al. GenePro: a Cytoscape plug-in for advanced visualization and analysis of interaction networks. Bioinformatics. 22, 2178-219 (2006).
  13. de Berardinis, V., et al. A complete collection of single-gene deletion mutants of Acinetobacter baylyi ADP1. Mol. Syst. Biol. 4, 174 (2008).
  14. Babu, M., et al. Sequential peptide affinity purification system for the systematic isolation and identification of protein complexes from Escherichia coli. Methods Mol. Biol. 564, 373-400 (2009).
में प्रोटीन परिसरों की पहचान<em&gt; Escherichia कोलाई</em&gt; संयोजन में अग्रानुक्रम मास स्पेक्ट्रोमेट्री के साथ अनुक्रमिक पेप्टाइड संबंध शुद्धीकरण का उपयोग
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Babu, M., Kagan, O., Guo, H., Greenblatt, J., Emili, A. Identification of Protein Complexes in Escherichia coli using Sequential Peptide Affinity Purification in Combination with Tandem Mass Spectrometry. J. Vis. Exp. (69), e4057, doi:10.3791/4057 (2012).More

Babu, M., Kagan, O., Guo, H., Greenblatt, J., Emili, A. Identification of Protein Complexes in Escherichia coli using Sequential Peptide Affinity Purification in Combination with Tandem Mass Spectrometry. J. Vis. Exp. (69), e4057, doi:10.3791/4057 (2012).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter