Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Biology

Analyse cellulaire spécifique de doi: 10.3791/4214 Published: October 4, 2012

Summary

Procédé de fabrication d'

Abstract

Après le début de l'ébauche de feuille, l'accumulation de la biomasse est commandé principalement par la prolifération des cellules et de l'expansion dans les feuilles 1. Toutefois, la feuille d'Arabidopsis est un organe complexe composé de plusieurs types cellulaires différents et plusieurs structures. Dans le même temps, la feuille de plus en plus contient des cellules à différents stades de développement, les cellules les plus éloignées du pétiole Soyez le premier à arrêter l'expansion et se soumettre à la sénescence 1. Les différentes cellules dans la feuille sont donc diviser, élongation ou de différenciation; actif, stressés ou morts, et / ou répondre à des stimuli dans les sous-ensembles de leur type cellulaire à un moment donné. Cela rend l'étude génomique de la contestation feuille: par exemple lors de l'analyse des données d'expression de feuilles entières, des signaux de réseaux génétiques qui opèrent dans des zones distinctes de réponse cellulaire ou des types cellulaires seront confondus, résultant en un profil inexactes généré.

Pour résoudre ce problème, slusieurs méthodes ont été décrites qui permettent les études d'expression génique de cellules spécifiques. Il s'agit notamment de capture microdissection laser (LCM) 2 ou les plantes exprimant la GFP utilisées pour la production de protoplastes et après le tri cellulaire par fluorescence (FACS) 3,4, le système a récemment décrit l'état intact de précipitation nucléaire 5 et 6 immunoprécipitation de polysomes.

FACS a été utilisé avec succès pour un certain nombre d'études, notamment en montrant que l'identité de la cellule et la distance de l'extrémité de la racine a eu un effet significatif sur les profils d'expression d'un grand nombre de gènes 3,7. FACS de lignes GFP ont également été utilisées pour démontrer spécifique des cellules régulation transcriptionnelle lors des interventions d'azote racines et le développement des racines latérales 8, 9 Répartition sel de stress auxine dans la racine 10 et de créer une carte d'expression génique du méristème apical Arabidopsis 11. Bien queFACS a déjà été utilisée pour trier les protoplastes de feuilles d'Arabidopsis dérivés fondés sur autofluorescence 12,13, jusqu'à l'utilisation de FACS sur des lignes d'Arabidopsis exprimant la GFP dans les feuilles a été très limitée 4. Dans le protocole suivant, nous décrivons une méthode pour obtenir des protoplastes de feuilles d'Arabidopsis qui sont compatibles avec FACS, tout en minimisant l'impact du régime de production de protoplastes. Nous démontrons la méthode utilisant la ligne KC464 Arabidopsis, qui expriment la GFP dans l'épiderme ventral 14, la ligne KC274, qui expriment la GFP dans le tissu vasculaire 14 et la ligne Arabidopsis TP382, qui expriment la GFP construction en double lié à un signal de localisation nucléaire les cellules de garde (données non présentées, figure 2). Nous sommes en train d'utiliser cette méthode pour étudier à la fois l'expression spécifique au type cellulaire au cours du développement et le stress, ainsi que des populations de cellules hétérogènes à différents stades de la sénescence.

Protocol

1. Génération de protoplastes

  1. Matériel foliaire Récolte et les couper en lanières 1 mm de large (figure 1) avec une lame de rasoir. Pour les échantillons contenant plus d'une seule feuille jusqu'à 15 feuilles peuvent être facilement empilés avant de couper.
  2. Transférer immédiatement les bandes de feuilles dans une boîte de Petri de 9 cm rond contenant 20 ml de solution A (400 mM de mannitol, 20 mM de MES hydrate, 20 mM KCl, CaCl2 10 mM, MgCl2 2 mM, BSA 0,1% et 2,5 mM de β-mercaptoéthanol, pH 5,7) y compris les enzymes protoplastes (1,2% de cellulose R-10, la cellulose 0,6% et 0,4% RS macerozyme R-10) et de RNase et d'inhibiteurs de la transcription (1 × ProtectRNA et 10 pg / ml d'actinomycine D); séparer délicatement les feuilles et bandes aspirateur infiltrer pour 2 x 5 min.
  3. Lieu boîte de Pétri sur un agitateur orbital réglé à 90 tours par minute à la température ambiante et de protoplastes pour 3-4 heures.
    1. Au cours de l'incubation, les bandes de feuille doivent être séparés les uns des autres, par utilisation d'unjeu de pinces plates, les demi-heures.
  4. Placez un 70 um tamis cellulaire (Fisher Scientific) dans un tube de 50 ml et doucement filtrer la solution à travers protoplastes. Cela permettra d'éliminer les bandes de feuilles, qui seront retenues par le tamis tout en permettant aux protoplastes à passer.
  5. Laver les barrettes de feuilles avec 4 ml de solution A et doucement à travers le tamis de filtre même.
  6. Transférez les protoplastes dans des tubes à fond rond et centrifuger la solution de protoplastes à 300 xg pendant 5 min à pellets les protoplastes.
  7. Aspirer le maximum de surnageant sans déranger les protoplastes.
  8. Laver les protoplastes avec 5 ml de solution A et centrifuger à 300 xg pendant 5 min. Retirer le surnageant
  9. Remettre en suspension les protoplastes dans un volume approprié de la solution A, à l'aide d'une pipette Pasteur ou une pointe P1000 coupure.

2. FACS de protoplastes foliaires

  • Immédiatement avant le triage, remettre en suspension les protoplastes en utilisant une liste (non coupé) P1000 pointe pour éviter les protoplastes s'agglomérer.
  • Transférer des protoplastes à un tube de tri à travers un filtre 50 um Filcon (BD Biosciences) et le cas échéant diluer pour éviter le colmatage de la buse de la trieuse de cellules. Les protoplastes sont triés à l'aide d'une buse de 100 um à une pression de 20 psi (gaine) et de 21 à 21,5 psi (échantillon), une fréquence de 39,2 kHz et un taux d'événements de <4000 (ces paramètres sont optimales sur un trieur de cellules BD Afflux (BD Biosciences). Optimisation sur d'autres machines de tri de cellules devrez peut-être ajuster ces paramètres).
  • Protoplastes GFP positives sont identifiées à l'aide d'un laser argon à 488 nm et le tracé de la sortie du passe-bande 580/30 de filtre (orange) par rapport au filtre 530/40 passe-bande (vert). Protoplastes GFP-positives sera dans la grande 530/low 580 de la population, avec les non-GFP protoplastes dans le bas 530/580 à faible population et de morts qui meurent / protoplastes et les débris de la grande population 580ment (Figure 2).
    1. Lors du tri des protoplastes à partir de l'ARN qui seront extraites, protoplastes doivent être triés directement dans au moins 4 volumes d'un tampon de lyse contenant un agent réducteur (par exemple β-mercaptoéthanol). En outre, le temps de tri d'un échantillon unique devrait être limitée à 20-30 min, et un maximum de deux à trois échantillons traités à un moment donné.
    2. Pour la visualisation des protoplastes triés, les protoplastes doivent être triés directement dans au moins 8 volumes de la solution A, puis recueillies par centrifugation pour concentrer les protoplastes.
  • 3. Les résultats représentatifs

    Ce protocole décrit un procédé d'obtention de protoplastes de feuilles d'Arabidopsis, qui sont utilisés pour le tri de cellules activé par fluorescence (figure 1). Génération de protoplastes en présence de RNase et d'inhibiteurs de la transcription empêche le f cellulesrom montage d'une réponse transcriptionnelle. Cela ne veut avoir pour conséquence de donner lieu à de nombreuses protoplastes morts et mourants, qui ont un niveau élevé d'auto-fluorescence. Lors du tri des protoplastes préparés avec cette méthode, il est donc très fréquent de voir plusieurs populations distinctes dans les graphes des 580 nm contre 530 nm fluorescence utilisés pour le tri. Des exemples de ce qui, avec les portes de tri utilisés dans ce protocole sont présentés dans la figure 3.

    Les protoplastes peuvent être classés en 8 volumes de la solution A et recueilli pour la visualisation de vérifier l'enrichissement. Figure 2G montre un exemple de cette utilisation de la ligne TP382, qui exprime la GFP dans les cellules de garde.

    Exemples de rendements obtenus en utilisant cette méthode, à la fois avant et après amplification, sont présentés dans le tableau 1. Les montants obtenus sont suffisants pour l'amplification en utilisant le système Ovation Pico WTA (500 pg-50 ng) et donc subsequent analyse par qPCR soit (figure 4), le séquençage de prochaine génération ou puces à ADN.

    Figure 1
    Figure 1. Flux de travail globale de l'expérience. 1) Récolte des feuilles de l'intérêt d'une ligne exprimant la GFP Arabidopsis. 2) rapidement coupé en ~ 1 mm larges bandes et transférer immédiatement dans la solution de ces protoplastes et le vide s'infiltrer. 3) Incuber pendant 3-4 heures. 4) doucement filtrat protoplastes solution à travers un tamis 70 pm, transfert à arrondir les tubes à fond et les protoplastes par centrifugation. 5) Immédiatement avant le triage, remettre les protoplastes et le transfert d'un tube de tri à travers un filtre 50 um. 6) Trier GFP positives et négatives GFP protoplastes viables. 7) Les protoplastes peuvent maintenant être analysées visuellement ou en utilisant des techniques telles que qPCR, séquençage de nouvelle génération ou puces à ADN.


    Figure 2. Les lignes KC464, KC274 et TP382 utilisées dans cette étude. A) Coupe transversale d'une feuille KC464 montrant l'expression de la GFP dans l'épiderme ventral. B) Les protoplastes provenant de feuilles KC464. C) Coupe transversale d'une feuille KC274 montrant l'expression de la GFP dans le système vasculaire. D) Les protoplastes issus de KC274 feuilles. E) feuille TP382 montrant l'expression de la GFP dans les cellules de garde. F) provenant de protoplastes TP382 feuilles. G) Exemple de l'enrichissement obtenu par FACS de la GFP exprimant des cellules de garde à l'arrière-plan complexe de cellules de la feuille, montrant GFP contenant des protoplastes de la 530/low 580 de population de protoplastes issus de TP382 feuilles. AF: les images microscope confocal; G: image Microscope à fluorescence. Barres d'échelle dans les images sont de 50 um.

    Figure 3
    Figure 3. Typiques parcelles FACS points d'acquisition de la sortie de la 580/30 nm (orange) vs 530/40 nm (vert) filtres passe-bande (trieur de cellules BD Influx). Les portes de tri indiquées sont celles généralement utilisées pendant le tri. A) en points de protoplastes Col-4 feuilles dérivés, protoplasted en l'absence d'inhibiteurs, montrant une seule 530/low bas 580 habitants. B) en points de poids Col-4 feuilles de protoplastes dérivés, protoplasted en présence d'inhibiteurs, montrant un changement de la fluorescence 580 à cause du stress et la coloration par les inhibiteurs. CE) Dot parcelles de feuilles protoplastes dérivés à partir des lignes KC74, KC464 et TP382, respectivement, protoplasted en présence d'inhibiteurs de la GFP, montrant contenant populations dans le haut 530/low 580 populations. Les pourcentages des événements dans les GFP (haute 530/low 580) les populations sont donnés. Cliquez ici pour agrandir la figure .

    e_content "fo: keep-together.within pages =" always "> Figure 4
    Figure 4. Expression de la GFP dans les fractions représentatives de la population dépendants comme le montre la figure 3. Deux biologique reproduit ont été obtenus pour chaque type de fraction, amplifié en utilisant le système Ovation Pico WTA et qPCR utilisant des amorces spécifiques de la GFP (tableau 2) a été effectuée. Les valeurs indiquées sont les plus élevées (rouge), le plus bas (vert) et la moyenne des valeurs relatives. La population était élevée 580 dans ce cas divisée en deux, une faible 530/low 580 et haute 530/low 580, dont une réplique biologique unique a été utilisé afin que la seule valeur est indiquée. ACT2 (At3g18780) a été utilisé comme un standard pour tous les échantillons. Feuille: Feuilles entières. Unsorted: protoplastes non triés. GFP1: haute 530/low 580 et REST1: faible 530/low 580, GFP2: 530/high haute 580 et REST2: faible 530/high 580, tel que décrit à la figure 3 et l'insert. Les résultats sont un o vérificationf évaluations optiques du contenu de la cellule GFP dans les fractions triées (2G figure, par exemple). Cliquez ici pour agrandir la figure .

    Échantillon Nombre de feuilles Nombre de cellules ARN rendement
    (Ng)
    ARN rendement
    (Amplifié; ng)
    Une feuille entière
    B Feuilles entières
    1
    1
    -
    -
    8001
    10525
    4623 ***
    4572 ***
    Un protoplastes Unsorted
    Unsorted B protoplastes
    5
    5
    -
    -
    2433
    2625
    1152 ***
    3321 ***
    Un GFP1
    Un REST1
    15 6039 (0.39% *)
    55389 (6.40% *)
    - **
    - **
    861
    489
    GFP1 B
    REST1 B
    15 10.783 (0.63% *)
    57 040 (7,49% *)
    - **
    - **
    537
    420
    GFP2
    Rest2
    15 18337 (1.49% *)
    62 405 (73,49% *)
    - **
    - **
    360
    411

    Les échantillons Tableau 1. Recueillies à l'aide FACS et analysées par qPCR afin de déterminer quelle fraction contenait vivantes exprimant GFP-protoplastes. Sont également inclus dans ce tableau est le rendement d'ARN total en ng avant et après amplification avec le système Ovation Pico WTA (NuGen). Fractions GFP1, GFP2, REST1 REST2 et sont indiquées dans l'insert de la figure 4. * Le pourcentage de cellules de la course de tri cellulaire total est donné entre parenthèses à côté du nombre de cellules dans la fraction. Ces pourcentages ne sont pas corrélées àl'autre pour chaque échantillon, le type FACS fonctionne pour les fractions «repos» ont été arrêtés plus tôt que pour les fractions GFP en raison du nombre beaucoup plus élevé de cellules de repos collectées. ** 50 ng utilisé comme entrée pour les réactions d'amplification, selon le protocole du fabricant.

    Apprêt Séquence
    mGFP5-ER.fw GCCTGAGGGATACGTGCAGGAGA
    mGFP5-ER.rv TGGCGGGTCTTGAAGTTGGCT
    ACT2.fw GCCATCCAAGCTGTTCTCTC
    ACT2.rv GCCATCCAAGCTGTTCTCTC

    Tableau 2. Amorces qPCR.

    Discussion

    Nous avons décrit une méthode qui permet l'utilisation de plantes d'Arabidopsis exprimant la GFP dans les feuilles pour la production de protoplastes et tri cellulaire ultérieure à l'aide FACS. Cette méthode donne des quantités suffisantes d'ARN à être utilisées pour l'amplification et l'analyse subséquente par conséquent supporte qPCR ou puce à ADN. Les fractions triées sont hautement enrichi pour la GFP contenant des cellules, tel que démontré par qPCR (Figure 2).

    Pour obtenir des rendements élevés de protoplastes vivants, il est essentiel de travailler rapidement au cours des premières étapes de la procédure, jusqu'à ce que les bandes de feuilles ont été infiltrées sous vide avec la solution de protoplastes contenant l'inhibiteur. En outre, lors de la génération bandes de 1 mm feuilles, il est très important de trancher ou couper les feuilles plutôt que «chop» ou écrasez-les, car cela conduit à des dommages excessifs et donc un rendement inférieur de protoplastes.

    Une différence cruciale entre la méthode décrite ici et publishe autreméthodes d est l'utilisation d'inhibiteurs de RNase et d'inhibiteurs de la transcription. La plupart des méthodes sont développées pour les racines d'Arabidopsis, dont protoplastes peuvent être générées plus facilement. Toutefois, lorsque vous travaillez avec des feuilles, à l'exception du mésophylle, il est nécessaire d'augmenter le temps de génération de protoplastes. Par conséquent, il est important d'inclure ces inhibiteurs pour protéger contre les variations de l'expression des gènes à la suite du traitement génération de protoplastes lui-même (données non présentées). Cependant, la présence des inhibiteurs conduit à une incapacité à monter une réponse transcription, soit par commutation des gènes ON ou OFF, ce qui est susceptible de rendre les protoplastes plus vulnérables car cela conduit à une perte de plasticité permet de contrer le stress de la protoplastes procédure.

    Nous avons utilisé la méthode décrite ici avec succès un certain nombre de lignes exprimant la GFP Arabidopsis. Surtout, nous avons utilisé cette méthode avec des lignes GFP exprimant la GFP soit fortementle noyau, ou beaucoup plus faiblement de manière non-localized/diffuse cytosolique, comme c'est le cas avec les KC464 KC274 et lignes utilisées ici. Les deux types de lignes sont compatibles avec la méthode et le rendement des fractions hautement enrichi de GFP exprimant protoplastes (Figure 2 et 3). La méthode pourrait être facilement adaptée à d'autres fluorophores, bien que le fluorophore doit être sélectionné pour que la fluorescence est significativement différente de l'autofluorescence des cellules mortes / meurt afin de préserver la possibilité de sélectionner les cellules vivantes.

    Disclosures

    Aucun conflit d'intérêt déclaré.

    Acknowledgments

    Travailler dans le laboratoire Buchanan-Wollaston sur le profilage stade des cellules de type et de développement spécifique est prise en charge par le projet AGRON-OMICS (subvention n LSHG-CT-2006-037704) dans le cadre Progamme 6 ème de la Commission européenne. Travailler dans le laboratoire Gifford sur un type de cellule spécifique profilage est soutenu par une subvention de nouveau chercheur BBSRC (BB/H019502/1).

    Les KC274 KC464 et les lignes d'Arabidopsis ont été obtenus à partir de l'AAR Webb (Université de Cambridge).

    Materials

    Name Company Catalog Number Comments
    Cellulase R-10 Melford C8001
    Cellulase RS Melford C8003
    Macerozyme R-10 Melford M8002
    BSA Sigma-Aldrich A3912
    ProtectRNA Sigma-Aldrich R7397
    Actinomycin D Sigma-Aldrich A1410
    70 μm cell strainer Fisher FB35181
    50 μm filcon cup-type filters BD Biosciences 340630

    DOWNLOAD MATERIALS LIST

    References

    1. Efroni, I., Eshed, Y., Lifschitz, E. Morphogenesis of Simple and Compound Leaves: A Critical Review. Plant Cell. 22, 1019-1032 (2010).
    2. Kleber, R., Kehr, J. Preparation and Quality Assessment of RNA From Cell-Specific Samples Obtained by Laser Microdissection. Methods Mol. Biol. 323, 367-377 (2006).
    3. Birnbaum, K., Shasha, D. E., Wang, J. Y., Jung, J. W., Lamberts, G. M., Galbraith, D. W., Benfey, P. N. A Gene Expression Map of the Arabidopsis root. Science. 302, 1956-1960 (2003).
    4. Warnasooriya, S. N., Montgomery, B. L. Investigating Tissue- and Organ-specific Phytochrome Responses using FACS-assisted Cell-type Specific Expression Profiling in Arabidopsis thaliana. J. Vis. Exp. (39), e1925 (2010).
    5. Beal, R. B., Henikoff, S. A Simple Method For Gene Expression and Chromatin Profiling of Individual Cell Types Within a Tissue. Dev. Cell. 18, 1030-1040 (2010).
    6. Mustroph, A., Zanetti, M. E., Jang, C. J. H., Holtan, H. E., Repetti, P. P., Galbraith, D. W., Girke, T., Bailey-Serres, J. Profiling translatomes of discrete cell populations resolves altered cellular priorities during hypoxia in Arabidopsis. PNAS. 106, 18843-18848 (2009).
    7. Brady, S. M., Orlando, D. A., Lee, J. Y., Wang, J. Y., Koch, J., Dinneny, J. R., Mace, D., Ohler, U., Benfey, P. N. Dominant Root Expression Patterns Revealed in a High-Resolution Spatiotemporal Expression Map. Science. 318, 801-806 (2007).
    8. Gifford, M. L., Dean, A., Gutierrez, R. A., Coruzzi, G. M., Birnbaum, K. D. Cell-specific nitrogen responses mediate developmental plasticity. PNAS. 105, 803-808 (2008).
    9. Dinneny, J. R., Long, T. A., Wang, J. Y., Jung, J. W., Mace, D., Pointer, S., Barron, C., Brady, S. M., Schiefelbein, J., Benfey, P. N. Cell identity mediates the response of Arabidopsis roots to abiotic stress. Science. 320, 942-945 (2008).
    10. Peterson, S. V., Johansson, A. I., Kowalczyk, M., Makoveychuk, A., Wang, J. Y., Moritz, T., Grebe, M., Benfey, P. N., Sandberg, G., Ljung, K. An Auxin Gradient and Maximum in the Arabidopsis Root Apex Shown by High-Resolution Cell-Specific Analysis of IAA Distribution and Synthesis. Plant Cell. 21, 1659-1668 (2009).
    11. Yadav, R. K., Girke, T., Pasala, S., Xie, M., Reddy, G. V. Gene expression map of the Arabidopsis shoot apical meristem stem cell niche. PNAS. 106, 4941-4946 (2009).
    12. Harkins, K. R., Jefferson, R. A., Kavanagh, T. A., Bevan, M. W., Galbraith, D. W. Expression of photosynthesis-related gene fusions is restricted by cell type in transgenic plants and in transfected protoplasts. PNAS. 87, 816-820 (1990).
    13. Yang, Y., Costa, A., Leonhardt, N., Siegel, R. S., Schroeder, J. I. Isolation of a strong Arabidopsis guard cell promoter and it's potential as a research tool. Plant Methods. 4, 6 (2008).
    14. Gardner, M. J., Baker, A. J., Assie, J. -M., Poethig, R. S., Haseloff, J. P., Webb, A. A. R. GAL4 GFP enhancer trap lines for analysis of stomatal guard cell development and gene expression. J. Exp. Bot. 60, 213-226 (2009).
    Analyse cellulaire spécifique de<em&gt; Arabidopsis</em&gt; Feuilles en utilisant la fluorescence par tri cellulaire activé
    Play Video
    PDF DOI DOWNLOAD MATERIALS LIST

    Cite this Article

    Grønlund, J. T., Eyres, A., Kumar, S., Buchanan-Wollaston, V., Gifford, M. L. Cell Specific Analysis of Arabidopsis Leaves Using Fluorescence Activated Cell Sorting. J. Vis. Exp. (68), e4214, doi:10.3791/4214 (2012).More

    Grønlund, J. T., Eyres, A., Kumar, S., Buchanan-Wollaston, V., Gifford, M. L. Cell Specific Analysis of Arabidopsis Leaves Using Fluorescence Activated Cell Sorting. J. Vis. Exp. (68), e4214, doi:10.3791/4214 (2012).

    Less
    Copy Citation Download Citation Reprints and Permissions
    View Video

    Get cutting-edge science videos from JoVE sent straight to your inbox every month.

    Waiting X
    simple hit counter