Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Biology

सेल के विशिष्ट विश्लेषण doi: 10.3791/4214 Published: October 4, 2012

Summary

उत्पादन के लिए विधि

Protocol

1. मूलतत्त्व जनरेशन

  1. हार्वेस्ट पत्ती और एक धार के साथ 1 मिमी चौड़ी स्ट्रिप्स (1 चित्रा) में सामग्री में कटौती. 15 पत्तियों को एक एकल पत्ती से अधिक युक्त नमूने आसानी से काटने से पहले खड़ी जा सकता है.
  2. तुरंत एक 9 सेमी दौर पेट्री डिश में 20 मिलीलीटर समाधान युक्त पत्ती स्ट्रिप्स हस्तांतरण (400 मिमी mannitol, 20 मिमी एमईएस हाइड्रेट, 20 मिमी KCl, 10 मिमी 2 CACL, 2 मिमी 2 MgCl, 0.1% BSA और 2.5 मिमी β-mercaptoethanol, पीएच 5.7) सहित protoplasting (1.2% R-10 सेलूलोज़, 0.6% सेलूलोज़ रुपये और 0.4% macerozyme R-10) एंजाइमों और RNase और transcriptional inhibitors (1 × ProtectRNA और 10 ग्राम / एमएल Actinomycin डी), धीरे पत्ता स्ट्रिप्स अलग 2 × 5 मिनट के लिए घुसपैठ शून्य.
  3. जगह एक कक्षीय हिलनेवाला पर पेट्री डिश और 3-4 घंटे के लिए कमरे के तापमान मूलतत्त्व में 90 rpm के लिए निर्धारित किया है.
    1. ऊष्मायन पत्ता स्ट्रिप्स के दौरान एक दूसरे से अलग किया जाना चाहिए एक प्रयोग के द्वारा,फ्लैट चिमटी के आधा घंटा के अंतराल पर, निर्धारित किया है.
  4. एक 50 मिलीलीटर ट्यूब में एक 70 सुक्ष्ममापी सेल झरनी (फिशर साइंटिफिक) प्लेस और धीरे माध्यम से protoplasting समाधान फ़िल्टर. यह पत्ता स्ट्रिप्स, जो चलनी द्वारा बनाए रखा जाएगा जबकि मूलतत्त्वों के माध्यम से जाने के लिए अनुमति को निकाल देंगे.
  5. 4 मिलीलीटर समाधान एक और धीरे से एक ही चलनी के माध्यम से फिल्टर के साथ पत्ता स्ट्रिप्स धो लें.
  6. गोल नीचे ट्यूब में मूलतत्त्वों स्थानांतरण और 300 XG पर 5 मिनट के लिए गोली मूलतत्त्वों मूलतत्त्व समाधान अपकेंद्रित्र.
  7. धीरे से मूलतत्त्वों को परेशान करने के बिना संभव के रूप में सतह पर तैरनेवाला ज्यादा aspirate.
  8. 5 मिलीग्राम और 5 मिनट के लिए 300 XG पर समाधान अपकेंद्रित्र साथ मूलतत्त्वों धो लें. तैरनेवाला निकालें
  9. एक समाधान का एक उचित मात्रा में मूलतत्त्वों Resuspend, एक पाश्चर विंदुक या एक P1000 कट ऑफ टिप का उपयोग कर.

2. पत्ता मूलतत्त्वों की FACS

  • तुरंत छँटाई से पहले, एक (गैर कट) P1000 टिप का उपयोग करने के लिए एक साथ clumping मूलतत्त्वों से बचने मूलतत्त्वों resuspend.
  • एक छँटाई ट्यूब मूलतत्त्वों एक 50 सुक्ष्ममापी filcon फिल्टर (बी.डी. बायोसाइंसेज) के माध्यम से स्थानांतरण के रूप में उपयुक्त पतला सेल सॉर्टर की नोक clogging से बचने के. मूलतत्त्वों 20 (म्यान साई) और 21-21.5 साई (नमूना), 39.2 kHz के एक आवृत्ति के दबाव और <4000 (इन सेटिंग्स एक बी.डी. बाढ़ सेल सॉर्टर पर इष्टतम की एक घटना दर पर एक 100 सुक्ष्ममापी नोक का उपयोग कर हल कर रहे हैं (बी.डी. बायोसाइंसेज) अनुकूलन अन्य सेल छँटाई मशीनों पर इन सेटिंग्स में समायोजन) की आवश्यकता हो सकती है.
  • GFP सकारात्मक मूलतत्त्वों एक 488 एनएम argon लेजर का उपयोग और उत्पादन से ५८० / 30 bandpass (नारंगी) फिल्टर बनाम 530/40 bandpass फिल्टर (हरा) की साजिश रचने की पहचान कर रहे हैं. GFP सकारात्मक मूलतत्त्वों उच्च 530/low 580 जनसंख्या में में उच्च लोकप्रियता 580 गैर GFP 530 कम / कम 580 जनसंख्या और मृत / मूलतत्त्वों मर रहा है और मलबे में मूलतत्त्वों के साथ किया जाएगाआबादी (2 चित्रा).
    1. जब छँटाई मूलतत्त्वों आरएनए जिसमें से निकाला जाएगा, मूलतत्त्वों एक lysis बफर युक्त एक कम एजेंट के कम से कम 4 संस्करणों में (जैसे β-mercaptoethanol) सीधे क्रमबद्ध चाहिए. इसके अलावा, एक नमूना की तरह समय 20-30 मिनट, और दो से तीन किसी भी एक समय में संसाधित नमूनों की एक अधिकतम करने के लिए सीमित होना चाहिए.
    2. हल मूलतत्त्वों के दृश्य के लिए, मूलतत्त्वों समाधान की 8 कम से कम मात्रा में और बाद में centrifugation द्वारा एकत्र करने के लिए मूलतत्त्वों ध्यान केंद्रित में सीधे क्रमबद्ध चाहिए.
  • 3. प्रतिनिधि परिणाम

    इस प्रोटोकॉल Arabidopsis पत्ते, है जो प्रतिदीप्ति सक्रिय सेल छँटाई (1 चित्रा) के लिए उपयोग किया जाता है से मूलतत्त्वों को प्राप्त करने के लिए एक विधि का वर्णन है. RNase और transcriptional inhibitors की उपस्थिति में मूलतत्त्व पीढ़ी कोशिकाओं च रोकता हैरॉम एक transcriptional प्रतिक्रिया बढ़ते हैं. यह कई मर चुका है और मर मूलतत्त्वों, जो autofluorescence की एक महत्वपूर्ण स्तर को जन्म देने के परिणाम है. जब इस विधि के साथ तैयार मूलतत्त्वों छँटाई इसलिए यह बहुत आम है 580 एनएम बनाम 530 एनएम प्रतिदीप्ति छँटाई के लिए प्रयोग किया जाता के रेखांकन में कई अलग आबादी देखने. इस प्रोटोकॉल में प्रयुक्त छँटाई फाटकों के साथ मिलकर इस के उदाहरण हैं, 3 चित्र में दिखाया जाता है.

    मूलतत्त्वों एक समाधान के 8 खंडों में हल किया जा सकता है और दृश्य संवर्धन सत्यापित करने के लिए एकत्र चित्रा 2G TP382 लाइन है, जो गार्ड कोशिकाओं में GFP व्यक्त का उपयोग कर इस का एक उदाहरण से पता चलता है.

    इस विधि दोनों से पहले और बाद प्रवर्धन का उपयोग कर प्राप्त की पैदावार के उदाहरण हैं, तालिका 1 में दिखाया जाता है. प्राप्त मात्रा प्रवर्धन तालियाँ पिको डब्ल्यूटीए (500 स्नातकोत्तर 50-एनजी) सिस्टम और इसलिए s को उपयोग करने के लिए पर्याप्त हैंया तो qPCR द्वारा ubsequent विश्लेषण (चित्रा 4), अगली पीढ़ी के अनुक्रमण या माइक्रोएरे.

    चित्रा 1
    चित्रा 1 प्रयोग के लिए समग्र कार्यप्रवाह. ) 1 हार्वेस्ट एक Arabidopsis लाइन व्यक्त GFP से ब्याज के पत्ते. 2) जल्दी ~ 1 मिमी चौड़ी स्ट्रिप्स में कटौती और तुरंत protoplasting समाधान और घुसपैठ निर्वात में इन हस्तांतरण. ) 3 3-4 घंटे के लिए सेते हैं. ) 4 एक 70 सुक्ष्ममापी चलनी के माध्यम से धीरे छानना मूलतत्त्व समाधान, centrifugation द्वारा नीचे ट्यूब और गोली मूलतत्त्वों दौर हस्तांतरण. 5) तुरंत छँटाई पहले, resuspend और एक 50 सुक्ष्ममापी के माध्यम से एक छँटाई ट्यूब को हस्तांतरण मूलतत्त्वों फिल्टर. 6) के आधार पर क्रमबद्ध GFP सकारात्मक और GFP नकारात्मक व्यवहार्य मूलतत्त्वों. ) 7 मूलतत्त्वों अब या तो नेत्रहीन विश्लेषण किया जा सकता है या qPCR, अगली पीढ़ी के अनुक्रमण या माइक्रोएरे के रूप में इस तरह की तकनीक का उपयोग कर.


    चित्रा 2, KC274 KC464, और TP382 इस अध्ययन में इस्तेमाल लाइनों. ए) एक KC464 मध्यतल की ओर epidermis में GFP अभिव्यक्ति दिखा पत्ती की अनुप्रस्थ अनुभाग. बी) मूलतत्त्वों KC464 पत्तियों से निकाली गई. सी) एक KC274 vasculature में GFP अभिव्यक्ति दिखा पत्ती की अनुप्रस्थ अनुभाग. डी) मूलतत्त्वों KC274 पत्तियों से निकाली गई. ई) TP382 पत्ती गार्ड कोशिकाओं में GFP अभिव्यक्ति दिखा. एफ) मूलतत्त्वों TP382 पत्तियों से निकाली गई. पत्ता कोशिकाओं के जटिल पृष्ठभूमि में गार्ड कोशिकाओं व्यक्त, TP382 पत्तियों से प्राप्त मूलतत्त्वों के उच्च 530/low 580 की आबादी से युक्त मूलतत्त्वों GFP दिखा GFP की FACS द्वारा प्राप्त संवर्धन के उदाहरण जी). वायुसेना: Confocal माइक्रोस्कोप छवियों, जी: प्रतिदीप्ति माइक्रोस्कोप छवि. छवियों के भीतर स्केल सलाखों 50 सुक्ष्ममापी हैं.

    चित्रा 3
    चित्रा 3 ठेठ +५८० / 30 (नारंगी) एनएम बनाम 530/40 (हरा) एनएम bandpass फिल्टर (बी बाढ़ सेल सॉर्टर) से उत्पादन के FACS अधिग्रहण डॉट भूखंडों. छँटाई दिखाया फाटकों छँटाई के दौरान आम तौर पर इस्तेमाल किया उन लोगों के हैं. ए) कर्नल चार पत्ती व्युत्पन्न मूलतत्त्वों inhibitors के अभाव में protoplasted, एक कम 530/low 580 जनसंख्या दिखा डॉट साजिश. बी) wt कर्नल-4 पत्ती व्युत्पन्न मूलतत्त्वों inhibitors की उपस्थिति में protoplasted, 580 प्रतिदीप्ति में बदलाव के कारण तनाव और inhibitors द्वारा रंग दिखाने से डॉट साजिश है. KC464 KC74, और TP382 लाइनों, क्रमशः, inhibitors की उपस्थिति में protoplasted जिसमें उच्च 530/low 580 आबादी में आबादी GFP दिखाने से पत्ता व्युत्पन्न मूलतत्त्वों से सीई) डॉट भूखंडों. GFP आबादी (उच्च 530/low 580) में घटनाओं का प्रतिशत दिया. बड़ा आंकड़ा देखने के लिए यहां क्लिक करें .

    को e_content "के लिए: रखने together.within पृष्ठ ="> हमेशा " चित्रा 4
    चित्रा 4 प्रतिनिधि gated जनसंख्या भिन्न के रूप में 3 चित्र में दिखाया में GFP अभिव्यक्ति. दो replicates जैविक प्रत्येक अंश प्रकार के लिए प्राप्त किया गया, तालियाँ पिको डब्ल्यूटीए सिस्टम और qPCR GFP विशिष्ट प्राइमरों (2 तालिका) का उपयोग का उपयोग कर रहा था तो प्रदर्शन प्रवर्धित. दिखाया मूल्यों उच्चतम (लाल), (हरा) सबसे कम है और औसत रिश्तेदार मूल्यों हैं. उच्च 580 जनसंख्या इस मामले में दो में विभाजित किया गया था, कम 580 530/low और उच्च 530/low 580, जिसके लिए एक एकल जैविक दोहराने में इस्तेमाल किया गया था तो केवल एक ही मूल्य दिखाया गया है. (At3g18780) ACT2 सभी नमूनों के लिए एक मानक के रूप में इस्तेमाल किया गया था. पत्ता: पूरी पत्ती. Unsorted: unsorted मूलतत्त्वों. GFP1: उच्च 530/low 580 और Rest1: कम 580 530/low, GFP2: उच्च 530/high 580 और Rest2: कम 530/high 580, के रूप में 3 चित्रा और डालने में वर्णित है. परिणाम एक सत्यापन ओGFP क्रमबद्ध भिन्न (जैसे चित्रा 2 जी) में सेल सामग्री के च ऑप्टिकल आकलन. बड़ा आंकड़ा देखने के लिए यहां क्लिक करें .

    नमूना पत्तियों की संख्या कोशिकाओं की संख्या उपज आरएनए
    (एनजी)
    उपज आरएनए
    (प्रवर्धित; एनजी)
    पूरी पत्ती एक
    पूरी पत्ती बी
    1
    1
    -
    -
    8001
    10525
    4623 ***
    4572 ***
    Unsorted मूलतत्त्वों एक
    Unsorted मूलतत्त्वों बी
    5
    5
    -
    -
    2433
    2625
    1152 ***
    3321 ***
    GFP1 एक
    Rest1 एक
    15 6039 (0.39% *)
    +५५३८९ (६.४0% *)
    - **
    - **
    861
    489
    GFP1 बी
    Rest1 बी
    15 10,783 (0.63% *)
    57,040 (7.49% *)
    - **
    - **
    537
    420
    GFP2
    Rest2
    15 १८३३७ (1.49% *)
    62,405 (73.49% *)
    - **
    - **
    360
    411

    तालिका 1. नमूने FACS का उपयोग कर एकत्र की है और निर्धारित करने के लिए जो अंश जीना GFP व्यक्त मूलतत्त्वों निहित qPCR साथ विश्लेषण किया. इसके अलावा इस तालिका में शामिल है तालियाँ पिको डब्ल्यूटीए प्रणाली (NuGEN) के साथ पहले और बाद प्रवर्धन एनजी में कुल शाही सेना उपज है. चित्रा 4 में डालने में GFP1, GFP2 Rest1, और Rest2 भिन्न के रूप में दिखाया जाता है. * कुल सेल तरह से चलाने की कोशिकाओं का प्रतिशत अंश में कोशिकाओं की संख्या के बगल में कोष्ठक में दी गई है. इन प्रतिशत सहसंबद्ध नहीं कर रहे हैंप्रत्येक नमूने के लिए एक दूसरे रूप में FACS तरह आराम 'भागों के लिए चलाता है GFP रेस्ट एकत्र की कोशिकाओं की अधिक संख्या के कारण भागों के लिए पहले से ही रोक दिया गया. ** निर्माता प्रोटोकॉल के अनुसार 50 प्रवर्धन प्रतिक्रियाओं के लिए निवेश के रूप में इस्तेमाल किया, एनजी.

    भजन की पुस्तक अनुक्रम
    mGFP5 - ER.fw GCCTGAGGGATACGTGCAGGAGA
    mGFP5 - ER.rv TGGCGGGTCTTGAAGTTGGCT
    ACT2.fw GCCATCCAAGCTGTTCTCTC
    ACT2.rv GCCATCCAAGCTGTTCTCTC

    तालिका 2 qPCR प्राइमरों.

    Discussion

    हम एक तरीका है कि Arabidopsis मूलतत्त्व पीढ़ी और बाद सेल FACS का उपयोग कर छँटाई के लिए पत्तियों में GFP व्यक्त पौधों के उपयोग की अनुमति देता का वर्णन किया है. इस विधि पैदावार शाही सेना के लिए पर्याप्त मात्रा में प्रवर्धन और इसलिए बाद के विश्लेषण के लिए या तो qPCR या माइक्रोएरे द्वारा इस्तेमाल किया जा. क्रमबद्ध fractions अत्यधिक GFP युक्त कोशिकाओं, के रूप में qPCR (2 चित्रा) द्वारा प्रदर्शन के लिए समृद्ध है.

    रहते मूलतत्त्वों के उच्च पैदावार प्राप्त करने के लिए प्रक्रिया के प्रारंभिक चरणों के दौरान तेजी से काम करने के लिए महत्वपूर्ण है, जब तक पत्ता स्ट्रिप्स अवरोध करनेवाला युक्त मूलतत्त्व समाधान के साथ घुसपैठ शून्य कर दिया गया है. इसके अलावा, जब 1 मिमी पत्ता स्ट्रिप्स पैदा यह बहुत महत्वपूर्ण है टुकड़ा या पत्तियों के बजाय 'काट' या उन्हें मैश कटौती, के रूप में यह अत्यधिक नुकसान और इस तरह एक कम मूलतत्त्व उपज होता है.

    विधि के बीच एक महत्वपूर्ण अंतर यहाँ और अन्य publishe वर्णितRNase inhibitors और transcriptional inhibitors के विकास के तरीकों का इस्तेमाल होता है. अधिकांश तरीकों Arabidopsis जड़ों, जिसमें से मूलतत्त्वों अधिक आसानी से उत्पन्न किया जा सकता है के लिए विकसित कर रहे हैं. हालांकि, जब पत्तियों के साथ काम कर, पर्णमध्यक छोड़कर, यह मूलतत्त्व पीढ़ी के समय को बढ़ाने के लिए आवश्यक है. इसलिए यह महत्वपूर्ण है कि इन inhibitors शामिल मूलतत्त्व पीढ़ी उपचार ही (नहीं दिखाया डेटा) का एक परिणाम के रूप में जीन अभिव्यक्ति में परिवर्तन के खिलाफ की रक्षा. हालांकि, inhibitors की उपस्थिति एक प्रतिलेखन प्रतिक्रिया माउंट करने में असमर्थता के लिए जाता है, या तो स्विचन पर जीन या बंद, जो मूलतत्त्वों अधिक संवेदनशील बनाने की संभावना है के रूप में इस plasticity की एक नुकसान होता है जिसके साथ के तनावों का मुकाबला करने के लिए प्रक्रिया protoplasting.

    हम यहाँ GFP-व्यक्त Arabidopsis लाइनों की एक संख्या के साथ सफलतापूर्वक वर्णित विधि का इस्तेमाल किया है. महत्वपूर्ण बात है, हम GFP GFP व्यक्त लाइनों में या तो दृढ़ता के साथ इस विधि का इस्तेमाल किया हैनाभिक, या अधिक दुबला एक non-localized/diffuse साइटोसोलिक तरीके में ज्यादा है, के रूप में KC464 और KC274 यहां इस्तेमाल किया लाइनों के साथ मामला है. लाइनों के दोनों प्रकार के विधि के साथ संगत कर रहे हैं और उपज GFP व्यक्त मूलतत्त्वों के अत्यधिक समृद्ध भागों (2 चित्रा और 3). विधि आसानी से अन्य fluorophores अनुकूलित किया जा सकता है, हालांकि fluorophore प्रतिदीप्ति है कि जीवित कोशिकाओं का चयन करने की क्षमता बनाए रखने के क्रम में मृत / मर कोशिकाओं के autofluorescence से काफी अलग है के लिए चयनित किया जाना चाहिए.

    Disclosures

    ब्याज की कोई संघर्ष की घोषणा की.

    Acknowledgments

    सेल प्रकार और विकास मंच विशिष्ट रूपरेखा पर बुकानन - Wollaston प्रयोगशाला में काम Agron omics 6 वें यूरोपीय आयोग के फ्रेमवर्क प्रोग्राम में परियोजना (अनुदान LSHG सीटी-2006-+०३७७०४) द्वारा समर्थित है. सेल प्रकार विशिष्ट रूपरेखा पर जिफोर्ड प्रयोगशाला में काम करना एक बीबीएसआरसी नई अन्वेषक अनुदान (BB/H019502/1) द्वारा समर्थित है.

    KC274 और KC464 Arabidopsis लाइनों आर वेब (कैम्ब्रिज विश्वविद्यालय) से प्राप्त किया गया.

    Materials

    Name Company Catalog Number Comments
    Cellulase R-10 Melford C8001
    Cellulase RS Melford C8003
    Macerozyme R-10 Melford M8002
    BSA Sigma-Aldrich A3912
    ProtectRNA Sigma-Aldrich R7397
    Actinomycin D Sigma-Aldrich A1410
    70 μm cell strainer Fisher FB35181
    50 μm filcon cup-type filters BD Biosciences 340630

    DOWNLOAD MATERIALS LIST

    References

    1. Efroni, I., Eshed, Y., Lifschitz, E. Morphogenesis of Simple and Compound Leaves: A Critical Review. Plant Cell. 22, 1019-1032 (2010).
    2. Kleber, R., Kehr, J. Preparation and Quality Assessment of RNA From Cell-Specific Samples Obtained by Laser Microdissection. Methods Mol. Biol. 323, 367-377 (2006).
    3. Birnbaum, K., Shasha, D. E., Wang, J. Y., Jung, J. W., Lamberts, G. M., Galbraith, D. W., Benfey, P. N. A Gene Expression Map of the Arabidopsis root. Science. 302, 1956-1960 (2003).
    4. Warnasooriya, S. N., Montgomery, B. L. Investigating Tissue- and Organ-specific Phytochrome Responses using FACS-assisted Cell-type Specific Expression Profiling in Arabidopsis thaliana. J. Vis. Exp. (39), e1925 (2010).
    5. Beal, R. B., Henikoff, S. A Simple Method For Gene Expression and Chromatin Profiling of Individual Cell Types Within a Tissue. Dev. Cell. 18, 1030-1040 (2010).
    6. Mustroph, A., Zanetti, M. E., Jang, C. J. H., Holtan, H. E., Repetti, P. P., Galbraith, D. W., Girke, T., Bailey-Serres, J. Profiling translatomes of discrete cell populations resolves altered cellular priorities during hypoxia in Arabidopsis. PNAS. 106, 18843-18848 (2009).
    7. Brady, S. M., Orlando, D. A., Lee, J. Y., Wang, J. Y., Koch, J., Dinneny, J. R., Mace, D., Ohler, U., Benfey, P. N. Dominant Root Expression Patterns Revealed in a High-Resolution Spatiotemporal Expression Map. Science. 318, 801-806 (2007).
    8. Gifford, M. L., Dean, A., Gutierrez, R. A., Coruzzi, G. M., Birnbaum, K. D. Cell-specific nitrogen responses mediate developmental plasticity. PNAS. 105, 803-808 (2008).
    9. Dinneny, J. R., Long, T. A., Wang, J. Y., Jung, J. W., Mace, D., Pointer, S., Barron, C., Brady, S. M., Schiefelbein, J., Benfey, P. N. Cell identity mediates the response of Arabidopsis roots to abiotic stress. Science. 320, 942-945 (2008).
    10. Peterson, S. V., Johansson, A. I., Kowalczyk, M., Makoveychuk, A., Wang, J. Y., Moritz, T., Grebe, M., Benfey, P. N., Sandberg, G., Ljung, K. An Auxin Gradient and Maximum in the Arabidopsis Root Apex Shown by High-Resolution Cell-Specific Analysis of IAA Distribution and Synthesis. Plant Cell. 21, 1659-1668 (2009).
    11. Yadav, R. K., Girke, T., Pasala, S., Xie, M., Reddy, G. V. Gene expression map of the Arabidopsis shoot apical meristem stem cell niche. PNAS. 106, 4941-4946 (2009).
    12. Harkins, K. R., Jefferson, R. A., Kavanagh, T. A., Bevan, M. W., Galbraith, D. W. Expression of photosynthesis-related gene fusions is restricted by cell type in transgenic plants and in transfected protoplasts. PNAS. 87, 816-820 (1990).
    13. Yang, Y., Costa, A., Leonhardt, N., Siegel, R. S., Schroeder, J. I. Isolation of a strong Arabidopsis guard cell promoter and it's potential as a research tool. Plant Methods. 4, 6 (2008).
    14. Gardner, M. J., Baker, A. J., Assie, J. -M., Poethig, R. S., Haseloff, J. P., Webb, A. A. R. GAL4 GFP enhancer trap lines for analysis of stomatal guard cell development and gene expression. J. Exp. Bot. 60, 213-226 (2009).
    सेल के विशिष्ट विश्लेषण<em&gt; Arabidopsis</em&gt; प्रतिदीप्ति सक्रिय सेल छँटाई का उपयोग पत्ते
    Play Video
    PDF DOI DOWNLOAD MATERIALS LIST

    Cite this Article

    Grønlund, J. T., Eyres, A., Kumar, S., Buchanan-Wollaston, V., Gifford, M. L. Cell Specific Analysis of Arabidopsis Leaves Using Fluorescence Activated Cell Sorting. J. Vis. Exp. (68), e4214, doi:10.3791/4214 (2012).More

    Grønlund, J. T., Eyres, A., Kumar, S., Buchanan-Wollaston, V., Gifford, M. L. Cell Specific Analysis of Arabidopsis Leaves Using Fluorescence Activated Cell Sorting. J. Vis. Exp. (68), e4214, doi:10.3791/4214 (2012).

    Less
    Copy Citation Download Citation Reprints and Permissions
    View Video

    Get cutting-edge science videos from JoVE sent straight to your inbox every month.

    Waiting X
    simple hit counter