Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Biology

Cell konkret analyse av doi: 10.3791/4214 Published: October 4, 2012

Summary

Fremgangsmåte for fremstilling av

Abstract

Etter innvielsen av bladet primordium, er biomasse akkumulering kontrollert hovedsakelig ved celleproliferasjon og ekspansjon i bladene en. Imidlertid er Arabidopsis blad et komplekst organ som består av mange forskjellige celletyper og flere strukturer. Samtidig, inneholder voksende blad celler på ulike stadier av utvikling, med cellene lengst fra petiole være den første til å slutte utvide og gjennomgå senescence 1. Ulike celler i bladet er derfor dele, elongating eller differensiering, aktiv, stresset eller død, og / eller svare på stimuli i sub-sett av deres cellulære typen til enhver tid. Dette gjør genomisk studie av bladet utfordrende: for eksempel når analysere uttrykk data fra hele blader, signaler fra genetiske nettverk som opererer i forskjellige cellulære respons soner eller celletyper vil bli forvirret, noe som resulterer i en unøyaktig profilen blir generert.

For å møte dette, several metoder har blitt beskrevet som muliggjøre studier av celle spesifikk genekspresjon. Disse inkluderer laser-fangst mikrodisseksjon (LCM) 2 eller GFP uttrykker plantene som brukes til protoplast generasjon og påfølgende fluorescens aktivert celle sortering (FACS) 3,4, den nylig beskrevet intakt system for kjernefysisk nedbør 5 og immunoutfelling av polysomes 6.

FACS har blitt brukt for en rekke studier, inkludert viser at cellen identitet og avstand fra rotspissen hadde en signifikant effekt på uttrykk profiler av et stort antall gener 3,7. FACS av GFP linjer har også blitt brukt til å demonstrere celle-spesifikke transcriptional regulering under root nitrogen svar og lateral root utvikling 8, salt stresset 9 auxin distribusjon i roten 10 og for å skape et genuttrykk kart over Arabidopsis skyte apikale meristem 11. SelvFACS har tidligere blitt brukt til å sortere Arabidopsis blad avledet protoplaster basert på autofluorescens 12,13, har så langt bruken av FACS på Arabidopsis linjer uttrykker GFP i bladene vært svært begrenset 4. I følgende protokoll beskriver vi en fremgangsmåte for å oppnå Arabidopsis blad protoplaster som er kompatible med FACS samtidig som effekten av protoplast generasjonen regimet. Vi viser metoden med KC464 Arabidopsis linje, som uttrykker GFP i adaxial epidermis 14, KC274 linje, som uttrykker GFP i den vaskulære vev 14 og TP382 Arabidopsis linje, som uttrykker en dobbel GFP konstruere knyttet til en kjernefysisk lokalisering signal i vernetidsbryterne celler (data ikke vist, Fig. 2). Vi bruker denne metoden for å studere både celle-typespesifikk uttrykk under utvikling og stress, samt heterogene cellepopulasjoner på ulike stadier av senescence.

Protocol

1. Protoplast Generation

  1. Innhøstingen blad materiale og skjær i 1 mm brede strimler (figur 1) med et barberblad. For prøver som inneholder mer enn en enkelt blad opp til 15 blader kan enkelt stables før du skjærer.
  2. Umiddelbart overføre blad strimler i en 9 cm rund petriskål inneholdende 20 ml oppløsning A (400 mM mannitol, 20 mM MES hydrat, 20 mM KCl, 10 mM 2 CaCl, 2 mM 2 MgCl, 0,1% BSA og 2,5 mM β-merkaptoetanol, pH 5,7), inkludert protoplasting enzymer (1,2% cellulose R-10, 0,6% cellulose og 0,4% RS macerozyme R-10) og RNase og transkripsjonelle hemmere (1 × ProtectRNA og 10 ug / ml Actinomycin D); forsiktig skille bladet strimler og vakuum infiltrere i 2 x 5 min.
  3. Place petriskål på en orbital shaker satt til 90 rpm ved romtemperatur og i 3-4 timer protoplast.
    1. Under inkubasjonen bladet strimler bør skilles fra hverandre, ved bruk av etsatt av flate pinsett, på halv timers mellomrom.
  4. Plasser en 70 mikrometer celle silen (Fisher Scientific) i et 50 ml rør og forsiktig filtrere protoplasting oppløsningen gjennom. Dette vil fjerne bladet strimler, som vil bli beholdt av sikten samtidig som de protoplaster å gå gjennom.
  5. Vask bladet strimler med 4 ml oppløsning A og forsiktig filteret gjennom samme sil.
  6. Overfør protoplaster inn rundbundet rør og sentrifuger protoplast løsningen ved 300 xg i 5 minutter for å pelletere protoplaster.
  7. Forsiktig Aspirer av så mye av supernatanten som mulig uten å forstyrre protoplaster.
  8. Vask protoplaster med 5 ml oppløsning A og sentrifuger ved 300 xg i 5 minutter. Fjern supernatant
  9. Resuspender protoplaster i et egnet volum av løsning A, ved hjelp av en Pasteur-pipette eller en avkuttet P1000 tips.

2. FACS av Leaf protoplaster

  • Umiddelbart før sortering, Resuspender protoplaster ved hjelp av en (ikke-cut) P1000 tips for å unngå protoplaster klumper sammen.
  • Overføre protoplaster til sortering rør gjennom en 50 um filcon filteret (BD Biosciences) og fortynn som egnet for å unngå tilstopping av dysen av cellen sortereren. De protoplaster sorteres ved hjelp av en 100 um dyse ved et trykk på 20 psi (kappe) og 21 til 21,5 psi (prøve), en frekvens av 39,2 kHz og en hendelsesrate <4000 (disse innstillingene er optimale på en BD tilstrømningen celle sorter (BD Biosciences). Optimalisering på andre celle sortering maskiner kan trenge justeringer til disse innstillingene).
  • GFP positive protoplaster identifiseres ved hjelp av en 488 nm argon laser og plotte resultatet fra 580/30 båndpassfilter (oransje) g. 530/40 båndpassfilter (grønn). GFP positive protoplaster vil være i den høye 530/low 580 innbyggere, med ikke-GFP protoplaster i lav 530 / lav 580 innbyggere og døde / døende protoplaster og rusk i høy 580 befolkningen (fig. 2).
    1. Ved sortering protoplaster hvorfra RNA vil bli ekstrahert, bør protoplaster sorteres direkte inn minst 4 volumer av en lysebuffer inneholdende et reduksjonsmiddel (f.eks β-merkaptoetanol). I tillegg bør den slags tid av en enkelt prøve som skal begrenses til 20-30 minutter, og en maksimum 2-3 prøver som er behandlet på en gang.
    2. For visualisering av sortert protoplaster bør protoplaster sorteres direkte inn minst 8 volumer av løsning A og deretter samlet ved sentrifugering for å konsentrere protoplaster.
  • 3. Representant Resultater

    Denne protokollen beskriver en metode for å erholde protoplaster fra Arabidopsis blader, som brukes for fluorescens aktivert celle sortering (figur 1). Protoplast generasjon i nærvær av RNase og transkripsjonelle inhibitorer hindrer cellene from montere en transcriptional respons. Dette har den konsekvens av å gi opphav til mange døde og døende protoplaster, som har en betydelig grad av autofluorescens. Når sortere protoplaster forberedt med denne metoden er det derfor svært vanlig å se flere forskjellige populasjoner i grafer over de 580 nm vs 530 nm fluorescens som brukes til sortering. Eksempler på dette, sammen med sorteringen portene som brukes i denne protokollen er vist i figur 3..

    Protoplaster kan sorteres i 8 volumer av løsning A og oppsamlet for visualisering å verifisere berikelse. Fig. 2G viser et eksempel på dette ved hjelp av TP382 linje, som uttrykker GFP i vakt celler.

    Eksempler på utbytter oppnådd ved anvendelse av denne metoden, både før og etter forsterkning, er vist i tabell 1. Beløpene oppnås er tilstrekkelig for amplifikasjon ved hjelp av Ovation Pico WTA System (500 pg-50 ng) og derfor subsequent analyse av enten qPCR (figur 4), neste generasjons sekvensering eller microarray.

    Figur 1
    Figur 1. Totalt arbeidsflyt for forsøket. 1) Harvest går av interesse fra en GFP uttrykker Arabidopsis linje. 2) Raskt kuttet i ~ 1 mm brede strimler og umiddelbart overføre disse til protoplasting løsning og vakuum infiltrere. 3) Inkuber i 3-4 timer. 4) forsiktig filtrat protoplast løsning gjennom en 70 mikron sikt, overføring til rund bunn rør og pellet protoplaster ved sentrifugering. 5) Umiddelbart før sortering, resuspender protoplaster og overføring til en sortering rør gjennom en 50 mikrometer filter. 6) Sorter GFP positive og GFP negative levedyktige protoplaster. 7) protoplaster kan nå bli analysert enten visuelt eller ved hjelp av teknikker som qPCR, neste generasjons sekvensering eller microarray.


    Figur 2. De KC464, KC274 og TP382 linjer som brukes i denne studien. A) tverrsnitt av en KC464 blad viser GFP uttrykk i adaxial epidermis. B) protoplaster avledet fra KC464 blader. C) tverrsnitt av en KC274 blad viser GFP uttrykk i blodkar. D) protoplaster avledet fra KC274 blader. E) TP382 blad viser GFP uttrykk i vakt celler. F) protoplaster avledet fra TP382 blader. G) Eksempel på berikelse oppnådd ved FACS av GFP uttrykker vakt celler i kompleks bakgrunn av blad celler, viser GFP inneholder protoplaster fra høy 530/low 580 innbyggere protoplaster avledet fra TP382 blader. AF: confocal mikroskop bilder, G: Fluorescensmikroskop bilde. Skala barer i bilder er 50 mikrometer.

    Figur 3
    Figur 3. Typiske FACS oppkjøpet Prikkplott av produksjonen fra de 580/30 nm (oransje) vs 530/40 nm (grønn) båndpassfiltre (BD tilstrømningen celle sorter). Sortering portene som vises er de som vanligvis brukes under sortering. A) prikkplott Kol-4 blad avledet protoplaster, protoplasted i fravær av inhibitorer, som viser en enkelt lav 530/low 580 befolkningen. B) prikkplott fra wt Col-4 blad avledet protoplaster, protoplasted i nærvær av hemmere, viser en endring i 580 fluorescens på grunn av stress og fargestoffer av hemmere. CE) Prikkplott fra blad avledet protoplaster fra KC74, KC464 og TP382 linjer, henholdsvis protoplasted i nærvær av hemmere, viser GFP inneholder populasjoner i høy 530/low 580 bestander. Prosenter av hendelsene i GFP (høy 530/low 580) bestander er gitt. Klikk her for å se større figur .

    e_content "fo: keep-together.within-page =" always "> Figur 4
    Figur 4. GFP uttrykk i de representative gated befolkningen fraksjoner som vist i figur 3.. To biologiske replikater ble oppnådd for hver fraksjon attraksjon, forsterket ved hjelp av Ovation Pico WTA System og qPCR hjelp GFP-spesifikke primere (tabell 2) ble deretter utført. Verdiene som vises er den høyeste (rød), lavest (grønn) og gjennomsnittlig relative verdier. Den høye 580 befolkningen var i dette tilfellet delt i to, lav 530/low 580 og høy 530/low 580, hvor en enkelt biologisk replikat ble brukt slik at bare den ene verdi vises. ACT2 (At3g18780) ble brukt som en standard for alle prøvene. Leaf: Hele blad. Usorterte: Usorterte protoplaster. GFP1: høy 530/low 580 og REST1: lav 580 530/low, GFP2: høy 530/high 580 og REST2: lav 580 530/high, som beskrevet i figur 3 og innsatsen. Resultatene er en verifikasjon of optiske vurderinger av GFP celleinnhold i de sorterte fraksjoner (f.eks Figur 2G). Klikk her for å se større figur .

    Eksempel Antall blader Antall celler RNA avkastning
    (Ng)
    RNA avkastning
    (Forsterket; ng)
    Hele blad A
    Hele blad B
    1
    1
    -
    -
    8001
    10525
    4623 ***
    4572 ***
    Usorterte protoplaster A
    Usortert protoplaster B
    5
    5
    -
    -
    2433
    2625
    1152 ***
    3321 ***
    GFP1 A
    REST1 A
    15 6039 (0.39% *)
    55389 (6.40% *)
    - **
    - **
    861
    489
    GFP1 B
    REST1 B
    15 10783 (0,63% *)
    57040 (7.49% *)
    - **
    - **
    537
    420
    GFP2
    REST2
    15 18337 (1,49% *)
    62405 (73.49% *)
    - **
    - **
    360
    411

    Tabell 1. Prøver tatt ved hjelp av FACS og analysert med qPCR for å avgjøre hvilken fraksjon inneholdt levende GFP-uttrykker protoplaster. Også inkludert i denne tabellen er det totale RNA utbytte i ng før og etter forsterkning med Ovation Pico WTA System (Nugen). GFP1, GFP2, REST1 og REST2 fraksjoner som vist i innskuddet i figur 4. * Prosentandelen av celler i den totale celle sorter løp er gitt i parentes ved siden av antall celler i fraksjonen. Disse prosentsatsene er ikke korrelert tilhverandre for hver prøve som FACS slags løper for "resten" fraksjoner ble stoppet tidligere enn for GFP fraksjoner grunn mye større antall Rest celler samlet. ** 50 ng brukt som input for forsterkning reaksjoner, som per produsentens protokoll.

    Primer Sekvens
    mGFP5-ER.fw GCCTGAGGGATACGTGCAGGAGA
    mGFP5-ER.rv TGGCGGGTCTTGAAGTTGGCT
    ACT2.fw GCCATCCAAGCTGTTCTCTC
    ACT2.rv GCCATCCAAGCTGTTCTCTC

    Tabell 2. QPCR primere.

    Discussion

    Vi har beskrevet en fremgangsmåte som tillater bruk av Arabidopsis planter uttrykker GFP i bladene for protoplast generasjon og påfølgende celle sortering hjelp FACS. Denne metode gir tilstrekkelige mengder av RNA som skal benyttes til forsterkning og derfor påfølgende analyse ved enten qPCR eller microarray. Fraksjonene sorterte høyanriket for GFP-holdige celler, som demonstrert av qPCR (figur 2).

    For å oppnå høye utbytter av levende protoplaster er det avgjørende å arbeide raskt i løpet av de første trinnene i fremgangsmåten, før bladet strimler har vært vakuum infiltrert med inhibitor-holdige protoplast løsning. I tillegg, når genererer 1 mm blad strimler det er svært viktig å skjære eller kutte bladene heller enn "chop" eller mos dem, da dette fører til unødig skade og dermed en lavere protoplast yield.

    En kritisk forskjell mellom fremgangsmåten beskrevet her og andre published metoder er bruk av RNase hemmere og transkripsjonelle inhibitorer. De fleste metodene er utviklet for Arabidopsis ordrøtter som protoplaster kan genereres lettere. Imidlertid, når det arbeides med blader, excepting mesophyll, er det nødvendig å øke protoplast generasjonstid. Derfor er det viktig å inkludere disse hemmere for å beskytte mot endringer i genekspresjon som følge av protoplast generasjonen behandlingen selv (data ikke vist). Imidlertid fører tilstedeværelse av hemmere av en manglende evne til å montere en transkripsjon respons, enten ved å bytte gener på eller av, noe som trolig vil gjøre protoplaster mer sårbare som dette fører til et tap av plastisitet med å motvirke stress av protoplasting prosedyre.

    Vi har brukt metoden beskrevet her lykkes med en rekke GFP-uttrykkende Arabidopsis linjer. Viktigere, har vi brukt denne metoden med GFP linjer uttrykker GFP enten sterktkjernen, eller mye svakere i en non-localized/diffuse cytosoliske måte, slik tilfellet er med de KC464 og KC274 linjer som brukes her. Begge typer linjer er kompatible med fremgangsmåten og gi høyanriket fraksjoner av GFP-uttrykkende protoplaster (figur 2 og 3). Metoden kan lett tilpasses andre fluoroforer, selv fluoroforen velges for fluorescens som er vesentlig forskjellig fra den autofluorescens av døde / døende celler for å bevare muligheten for å velge levende celler.

    Disclosures

    Ingen interessekonflikter erklært.

    Acknowledgments

    Arbeidet i Buchanan-Wollaston lab på celle-type og utviklingsstadiet bestemt profilering støttes av Agron-omics prosjektet (tilskudd # LSHG-CT-2006-037704) i 6 th Framework progamme av EU-kommisjonen. Arbeidet i Gifford lab på celle-type spesifikke profilering er støttet av en BBSRC New Investigator Grant (BB/H019502/1).

    De KC274 og KC464 Arabidopsis linjene ble hentet fra AAR Webb (University of Cambridge).

    Materials

    Name Company Catalog Number Comments
    Cellulase R-10 Melford C8001
    Cellulase RS Melford C8003
    Macerozyme R-10 Melford M8002
    BSA Sigma-Aldrich A3912
    ProtectRNA Sigma-Aldrich R7397
    Actinomycin D Sigma-Aldrich A1410
    70 μm cell strainer Fisher FB35181
    50 μm filcon cup-type filters BD Biosciences 340630

    DOWNLOAD MATERIALS LIST

    References

    1. Efroni, I., Eshed, Y., Lifschitz, E. Morphogenesis of Simple and Compound Leaves: A Critical Review. Plant Cell. 22, 1019-1032 (2010).
    2. Kleber, R., Kehr, J. Preparation and Quality Assessment of RNA From Cell-Specific Samples Obtained by Laser Microdissection. Methods Mol. Biol. 323, 367-377 (2006).
    3. Birnbaum, K., Shasha, D. E., Wang, J. Y., Jung, J. W., Lamberts, G. M., Galbraith, D. W., Benfey, P. N. A Gene Expression Map of the Arabidopsis root. Science. 302, 1956-1960 (2003).
    4. Warnasooriya, S. N., Montgomery, B. L. Investigating Tissue- and Organ-specific Phytochrome Responses using FACS-assisted Cell-type Specific Expression Profiling in Arabidopsis thaliana. J. Vis. Exp. (39), e1925 (2010).
    5. Beal, R. B., Henikoff, S. A Simple Method For Gene Expression and Chromatin Profiling of Individual Cell Types Within a Tissue. Dev. Cell. 18, 1030-1040 (2010).
    6. Mustroph, A., Zanetti, M. E., Jang, C. J. H., Holtan, H. E., Repetti, P. P., Galbraith, D. W., Girke, T., Bailey-Serres, J. Profiling translatomes of discrete cell populations resolves altered cellular priorities during hypoxia in Arabidopsis. PNAS. 106, 18843-18848 (2009).
    7. Brady, S. M., Orlando, D. A., Lee, J. Y., Wang, J. Y., Koch, J., Dinneny, J. R., Mace, D., Ohler, U., Benfey, P. N. Dominant Root Expression Patterns Revealed in a High-Resolution Spatiotemporal Expression Map. Science. 318, 801-806 (2007).
    8. Gifford, M. L., Dean, A., Gutierrez, R. A., Coruzzi, G. M., Birnbaum, K. D. Cell-specific nitrogen responses mediate developmental plasticity. PNAS. 105, 803-808 (2008).
    9. Dinneny, J. R., Long, T. A., Wang, J. Y., Jung, J. W., Mace, D., Pointer, S., Barron, C., Brady, S. M., Schiefelbein, J., Benfey, P. N. Cell identity mediates the response of Arabidopsis roots to abiotic stress. Science. 320, 942-945 (2008).
    10. Peterson, S. V., Johansson, A. I., Kowalczyk, M., Makoveychuk, A., Wang, J. Y., Moritz, T., Grebe, M., Benfey, P. N., Sandberg, G., Ljung, K. An Auxin Gradient and Maximum in the Arabidopsis Root Apex Shown by High-Resolution Cell-Specific Analysis of IAA Distribution and Synthesis. Plant Cell. 21, 1659-1668 (2009).
    11. Yadav, R. K., Girke, T., Pasala, S., Xie, M., Reddy, G. V. Gene expression map of the Arabidopsis shoot apical meristem stem cell niche. PNAS. 106, 4941-4946 (2009).
    12. Harkins, K. R., Jefferson, R. A., Kavanagh, T. A., Bevan, M. W., Galbraith, D. W. Expression of photosynthesis-related gene fusions is restricted by cell type in transgenic plants and in transfected protoplasts. PNAS. 87, 816-820 (1990).
    13. Yang, Y., Costa, A., Leonhardt, N., Siegel, R. S., Schroeder, J. I. Isolation of a strong Arabidopsis guard cell promoter and it's potential as a research tool. Plant Methods. 4, 6 (2008).
    14. Gardner, M. J., Baker, A. J., Assie, J. -M., Poethig, R. S., Haseloff, J. P., Webb, A. A. R. GAL4 GFP enhancer trap lines for analysis of stomatal guard cell development and gene expression. J. Exp. Bot. 60, 213-226 (2009).
    Cell konkret analyse av<em&gt; Arabidopsis</em&gt; Leaves med fluorescens Aktivert Cell Sortering
    Play Video
    PDF DOI DOWNLOAD MATERIALS LIST

    Cite this Article

    Grønlund, J. T., Eyres, A., Kumar, S., Buchanan-Wollaston, V., Gifford, M. L. Cell Specific Analysis of Arabidopsis Leaves Using Fluorescence Activated Cell Sorting. J. Vis. Exp. (68), e4214, doi:10.3791/4214 (2012).More

    Grønlund, J. T., Eyres, A., Kumar, S., Buchanan-Wollaston, V., Gifford, M. L. Cell Specific Analysis of Arabidopsis Leaves Using Fluorescence Activated Cell Sorting. J. Vis. Exp. (68), e4214, doi:10.3791/4214 (2012).

    Less
    Copy Citation Download Citation Reprints and Permissions
    View Video

    Get cutting-edge science videos from JoVE sent straight to your inbox every month.

    Waiting X
    simple hit counter