Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Medicine

की पहचान doi: 10.3791/50156 Published: February 1, 2013

Summary

एक निष्पक्ष दृष्टिकोण का उपयोग carcinogenesis के अज्ञात ड्राइवरों की पहचान का एक तरीका वर्णित है. विधि का उपयोग करता

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. प्रजनन और ट्रांसजेनिक जानवर की उम्र

  1. अपने प्रयोग के लिए उपयुक्त ट्रांसजेनिक चूहों के उपभेदों का चयन करें. में एक सशर्त Transposase माउस, transposons की एक concatamer शरण माउस, और एक माउस वांछित कैंसर के लिए मूल की कोशिकाओं को माना जा रहा कोशिकाओं में Cre recombinase व्यक्त, एक ठेठ प्रयोग तीन ट्रांसजेनिक लाइनों का उपयोग करेंगे. यदि किया जा रहा modeled कैंसर रोगियों का एक बड़ा प्रतिशत में एक ज्ञात उत्परिवर्तन है यह शुरू में इस परिवर्तन को शामिल करने के लिए वांछनीय हो सकता है. इन "predisposing" परिवर्तन के उदाहरण सक्रिय क्रास, प्रमुख नकारात्मक TP53 या एक floxed Pten एलील शामिल हैं. एक predisposing उत्परिवर्तन में जोड़ने से मॉडल बेहतर मानव कैंसर का प्रतिनिधित्व (1.3 देखें) हो सकता है. कई स्लीपिंग ब्यूटी Transposase और transposon चूहों राष्ट्रीय कैंसर संस्थान माउस रिपोजिटरी (से उपलब्ध हैं http://mouse.ncifcrf.gov/ ).
  2. Transposons को शरण देने के लिए अंत में यदि संभव हो तो दोनों alleles के लिए homozygous चूहों प्राप्त चूहों के साथ सशर्त Transposase चूहों नस्ल. चूहों Cre recombinase व्यक्त करने के लिए अपने ट्रिपल ट्रांसजेनिक प्रयोगात्मक चूहों (2 चित्रा) उत्पन्न करने के लिए homozygous वंश नस्ल. नोट: प्राप्त करने के homozygous चूहों हमेशा संभव या आदर्श नहीं हैं. उदाहरण के लिए, homozygous p53 प्रमुख नकारात्मक चूहों बहुत अधिक मुश्किल विषमयुग्मजी चूहों की तुलना में नस्ल हैं. इसके अलावा, यह उपयोगी है करने के लिए सुनिश्चित करें कि litters मेंडेलीय आनुवांशिकी का पालन करने के लिए पुष्टि करते हैं कि प्रजनन योजना सफल है.
  3. यदि एक संवेदनशील पृष्ठभूमि का उपयोग, predisposing एलील के साथ चूहों को Transposase साथ पहली नस्ल चूहों. इसके साथ ही, नस्ल चूहों चूहों transposons ले जाने के Cre recombinase व्यक्त. यदि संभव हो तो प्रत्येक एलील के लिए homozygous चूहों बनाएँ. अंत में, पिछले दो योजनाओं से प्रजनन homozygous वंश नस्ल चौगुनी ट्रांसजेनिक प्रयोगात्मक anim उत्पन्नए एल एस.
  4. प्रायोगिक पशुओं के अलावा, चूहों के नियंत्रण साथियों उत्पन्न करते हैं. नियंत्रण समूह सामान्य रूप से प्रयोगात्मक प्रजनन से littermates है कि केवल दो तीन alleles (2 चित्रा) की विरासत के होते हैं. एक संवेदनशील पृष्ठभूमि के मामले में तीन चार alleles के बाहर सहित चूहों भी आवश्यक हो जाएगा.
  5. मॉनिटर प्रयोगात्मक और नियंत्रण चूहों के ट्यूमर के विकास और / या moribundity के लिए दैनिक. अपने संस्थागत पशु की देखभाल और पशुपालन के लिए उपयोग समिति (IACUC) आवश्यकताओं का पालन करें. इसके अलावा, यह एक उम्र में आप एक पशु बलिदान अगर यह अभी तक मरणासन्न नहीं बन गया है निर्धारित विशिष्ट है. अठारह महीने एक खास उम्र में चूहों euthanized हैं.

2. ट्रांसजेनिक पशु का पोस्टमार्टम

अभिकर्मक के नाम कंपनी सूचीपत्र संख्या
ज़रूर सील induction चैंबर ब्रेन ट्री वैज्ञानिक EZ-177
Cryovial Bioexpress C-3355-2
10% Formalin Buffered सिग्मा Aldrich HT501128-4L

तालिका 1. अभिकर्मकों की आवश्यकता है.

  1. जब एक माउस मरणासन्न है या निर्धारित जीवन काल के अंत तक पहुँच गया है, पशु euthanize अपने IACUC दिशा निर्देशों का पालन एक सीओ 2 कक्ष का उपयोग कर. आम तौर पर, एक साफ गैस चैम्बर में पशु जगह, गैस की टंकी को खोलने और नियामक को समायोजित करने के लिए कोई उच्च से 5 पाउंड प्रति वर्ग इंच पढ़ें. नाक और आंख में जलन और सीओ 2 के लिए घृणा को कम करने के लिए धीरे धीरे भरें. सुनिश्चित करें कि जानवर के दिल अब और धड़क रहा है जवाब जब आंख में छुआ नहीं.
  2. 70% इथेनॉल के साथ बलिदान माउस के स्प्रे बाहरी.
  3. प्लेस एक necropsy बोर्ड पर माउस और विदारक पिन के साथ सुरक्षित है. कैंची का उपयोगघ चिमटी माउस को खोलने के लिए और अंगों को हटा दें. निर्धारित अंग है जो एकत्र किया जाना चाहिए परियोजना निर्भर है. हालांकि, यह हमेशा प्लीहा और यकृत जमा के रूप में इन अंगों अक्सर क्यों माउस मरणासन्न था महत्वपूर्ण अंतर्दृष्टि देने की सिफारिश की है. इसके अलावा अस्थि मज्जा की संभावित विश्लेषण के लिए उरोस्थि इकट्ठा. इसके अलावा, यह हमेशा के लिए किसी भी अंग या ऊतक कि असामान्य प्रतीत होता है इकट्ठा करने के लिए फायदेमंद है.
  4. ऊतकों और ट्यूमर है कि एकत्र कर रहे हैं चार वर्गों में विभाजित किया जाना चाहिए. एक अनुभाग में 70% इथेनॉल के बाद 18 घंटे के लिए 10% formalin buffered तय हो गई है. इस अनुभाग में एच एंड ई धुंधला हो जाना और / या आईएचसी के लिए इस्तेमाल किया जा सकता है. शेष तीन खंड है, जो आकार में आम तौर पर 50 से 100 मिलीग्राम तस्वीर तरल नाइट्रोजन में जमे हुए हैं. शाही सेना डीएनए और प्रोटीन अलगाव के लिए इस्तेमाल किया जा सकता है.
  5. IACUC दिशा निर्देशों के अनुसार लोथ और शेष ऊतकों के निपटान.

3. ट्यूमर से जीनोमिक डीएनए अलग

<अभिकर्मक के strong> नाम कंपनी सूचीपत्र संख्या
प्रोटीन वर्षा समाधान क्विएज़न 158910
सेल बफर क्विएज़न 158906
Proteinase कश्मीर क्विएज़न 158920
RNase एक क्विएज़न 158924
ते बफर PROMEGA V6232

तालिका 2. अभिकर्मकों की आवश्यकता है.

  1. पतले जमी ट्यूमर (50 से 100 मिलीग्राम) नमूना एक साफ रेजर ब्लेड का उपयोग कीमा.
  2. जगह एक 1.5 मिलीलीटर microcentrifuge ट्यूब में ऊतक कीमा और सेल 5 μl proteinase कश्मीर समाधान (20 मिग्रा / मिली) युक्त बफर के 1 मिलीलीटर जोड़ें.
  3. अच्छी तरह से भंवर.
  4. एक 55 डिग्री सेल्सियस हिलनेवाला कम से कम 4 घंटा, रातोंरात के लिए 250 rpm पर सेट में सेते हैं.
  5. 1 μl RNase एक समाधान (10 मिग्रा / मिली) जोड़ें और ट्यूब 25 बार पलटना.
  6. 30 मिनट के लिए 37 डिग्री सेल्सियस पर सेते हैं.
  7. 3 मिनट के लिए बर्फ पर रखने से कमरे के तापमान को शांत करते हैं.
  8. 333 μl प्रोटीन वर्षा समाधान और सख्ती भंवर जोड़ें.
  9. +१४००० Rpm 10 मिनट पर अपकेंद्रित्र. प्रोटीन गोली चाहिए. अगर गोली बहुत छोटे भंवर, फिर से है, 5 मिनट, और फिर पुन: अपकेंद्रित्र के लिए बर्फ पर सेते हैं.
  10. एक साफ 15 मिलीलीटर अपकेंद्रित्र ट्यूब में तैरनेवाला युक्त डीएनए डालो.
  11. जोड़ें 100% isopropanol के बराबर मात्रा और धीरे inverting 50 गुना से मिश्रण.
  12. 3 मिनट के लिए 3500 rpm पर अपकेंद्रित्र.
  13. तैरनेवाला त्यागें.
  14. 70% इथेनॉल के 1 मिलीलीटर जोड़ें और ट्यूब कई बार पलटना गोली धो लो.
  15. 1.5 मिलीलीटर microcentrifuge ट्यूब इथेनॉल के साथ साथ धोया गोली स्थानांतरण.
  16. 4 डिग्री सेल्सियस पर 5 मिनट के लिए 14,000 rpm पर अपकेंद्रित्र
  17. बंद इथेनॉल डालो और शुष्क हवा (लगभग 5 से 30 मिनट) ट्यूब पलटना.
  18. Resuspend डीएनए पीEllet ते के 50 से 500 μl में डीएनए गोली के आकार पर निर्भर करता है.
  19. 37 पर वैकल्पिक ऊष्मायन ° C डीएनए resuspend.
  20. 4 डिग्री सेल्सियस, या -20 डिग्री सेल्सियस में लंबी अवधि के भंडारण के लिए स्टोर.

4. Linker मध्यस्थता पीसीआर का प्रयोग ट्यूमर से जीनोमिक डीएनए

अभिकर्मक के नाम कंपनी सूचीपत्र संख्या
BfaI न्यू इंग्लैंड Biolabs R0568S
NlaIII न्यू इंग्लैंड Biolabs R0125S
96 अच्छी तरह प्लेटें MinElute क्विएज़न 28051
QIAvac 96 वैक्यूम कई गुना क्विएज़न 19504
मल्टी microplate जिनी, 120V वैज्ञानिक इंडस्ट्रीज इंक, एसआई-4000
5x ligation बफर के साथ टी -4 डीएनए ligase Invitrogen 15224-041
BamHI न्यू इंग्लैंड Biolabs R0136S
25 मिमी dNTPs Bioexpress C-5014-200
प्लेटिनम Taq Invitrogen 10966-034
FastStart Taq डीएनए पोलीमरेज़ Roche 12032929001
Agarose PROMEGA V3121
TAE बफर PROMEGA V4271
ते बफर PROMEGA V6232
Ethidium ब्रोमाइड PROMEGA H5041

तालिका 3. अभिकर्मकों की आवश्यकता है.

Linker दृश्यों

BfaI linker + 5 GTAATACGACTCACTATAGGGCTCCGCTTAAGGGAC 3 '

Linker-5 BfaI 'Phos-TAGTCCCTTAAGCGGAG 3'NH2

"> NlaIII linker + 5'GTAATACGACTCACTATAGGGCTCCGCTTAAGGGACCATG 3 '

Linker-5 NlaIII 'Phos-GTCCCTTAAGCGGAGCC 3'

प्राइमर दृश्यों

Spl IRDR R1 1 GCTTGTGGAAGGCTACTCGAAATGTTTGACCC: प्राथमिक आगे सही पक्ष (NlaIII) पीसीआर

Spl IRDR L1 1 CTGGAATTTTCCAAGCTGTTTAAAGGCACAGTCAAC: प्राथमिक पीसीआर आगे (BfaI) की ओर छोड़ा

दोनों सही और बाईं ओर के लिए प्राथमिक पीसीआर रिवर्स: Spl link1 GTAATACGACTCACTATAGGGC 1

द्वितीयक पीसीआर आगे दाईं ओर एक Illumina barcoded माध्यमिक प्राइमर 5 'AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTNNNNNNNNNNNNaGgtgtatgtaaacttccgacttcaa (एन 12 बीपी बारकोड का प्रतिनिधित्व करते हैं, ऊपरी मामले में अनुक्रम का उदाहरण Illumina मंच के लिए आवश्यक हैं, और कम मामले में अनुक्रम transposon के लिए बाध्य होगा.)

एक Illumina barcoded secon का उदाहरण: माध्यमिक पीसीआर आगे की ओर छोड़ दियाdary प्राइमर 5'AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTNNNNNNNNNNNNaAgtgtatgtaaacttccgacttcaa (एन 12 बीपी बारकोड का प्रतिनिधित्व करते हैं, ऊपरी मामले में अनुक्रम Illumina मंच के लिए आवश्यक हैं, और कम मामले में अनुक्रम transposon के लिए बाध्य होगा.)

दोनों सही और बाईं ओर के लिए माध्यमिक पीसीआर रिवर्स: linker नेस्टेड रिवर्स प्राइमर 5 'CAAGCAGAAGACGGCATACGAGCTCTTCCGATCTAGGGCTCCGCTTAAGGGAC

  1. पानी रखना + और - की linker (100 सुक्ष्ममापी) 50 μl के साथ linker के 50 μl + (100 सुक्ष्ममापी) के मिश्रण से दोनों BfaI linkers और NlaII linkers के लिए linkers और एक 1.5 मिलीलीटर microcentrifuge ट्यूब में 2 μl NaCl (5 मीटर). 5 मिनट के लिए 95 डिग्री सेल्सियस गर्मी ब्लॉक में रखें. हीटिंग ब्लॉक बारी और धीरे धीरे कमरे के तापमान को शांत करते हैं (यह एक घंटे या उससे अधिक समय लेता है). ठंडा करने के बाद, annealed linkers एक -20 डिग्री सेल्सियस फ्रीजर में संग्रहीत किया जा सकता है जब तक की जरूरत है.
  2. ट्यूमर डीएनए के दो aliquots, प्रत्येक डीएनए की 1 ग्राम युक्त अशेष भाजक तैयार. एक अशेष भाजक बुद्धि पचा जाएगाहा प्रतिबंध एंजाइम है कि transposon "ठीक है" को समाप्त करने के लिए करीब कट जाएगा. 2 अशेष भाजक प्रतिबंध एंजाइम है कि transposon "छोड़" अंत करीब कटौती के साथ पचा जाएगा. यह हर transposon प्रविष्टि साइट amplifying की संभावना को अधिकतम करने के लिए किया जाता है.
  3. एक अशेष भाजक में ट्यूमर डीएनए डाइजेस्ट "ठीक है" पक्ष एंजाइम NlaII का उपयोग, और अन्य "छोड़" पक्ष एंजाइम BfaI का उपयोग अशेष भाजक में ट्यूमर डीएनए को पचाने: 1 एंजाइम की μl, 5 μl 10x चंचु बफर # 4, डीएनए गठबंधन ( 1) ग्राम और DDH 2 50 μl की कुल मात्रा हे. 37 में डाइजेस्ट रातोंरात डीएनए ° सी पानी स्नान या इनक्यूबेटर में.
  4. गर्मी एंजाइमों निष्क्रिय (BfaI = 80 ° C 20 मिनट के लिए, NlaIII = 65 ° C 20 मिनट के लिए).
  5. 96 MinElute अच्छी तरह से थाली में नमूने रखने से पचता नमूने साफ, निर्वात और कुओं तक के बारे में 15 मिनट के लिए कई गुना निर्वात में जगह थाली सूखी देखो.
  6. निर्वात कई गुना और 96 कागज तौलिया के साथ अच्छी तरह से थाली के दाग नीचे से थाली को दूर करने के लिए सभी liqui हटानेघ
  7. 30 μl DDH 2 हे एक अच्छी तरह से जोड़ें और 2 मिनट के लिए उच्च पर एक कक्षीय हिलनेवाला सेट पर हिला, या पिपेट और नीचे 20 से 40 गुना है.
  8. साफ 96 अच्छी तरह प्लेटें में MinElute 96 अच्छी तरह से थाली से स्थानांतरण कुओं में पूरी मात्रा (30 μl).
  9. प्रदर्शन 4.8 4.1 कदम से कदम और linkers से पचा डीएनए के साथ linker ligation प्रतिक्रियाओं. मिक्स 10 μl पचा डीएनए, 4 μl 5x ligation बफर, 5.5 μl annealed linkers (950 ग्राम / μl), 0.5 μl T4 ligase (5 यू / μl).
  10. 16 में 4 घंटे के लिए रात भर के लिए सेते डिग्री सेल्सियस
  11. गर्मी 65 डिग्री सेल्सियस पर 10 मिनट के लिए टी -4 डीएनए ligase निष्क्रिय.
  12. 4.6 MinElute 96 अच्छी तरह प्लेटें और एक वैक्यूम के रूप में 4.5 चरणों में वर्णित कई गुना का उपयोग ligation साफ.
  13. 30 μl एच 2 हे में Resuspend और एक साफ 96 अच्छी तरह से थाली हस्तांतरण.
  14. एक 2 डीएनए पाचन प्रदर्शन क्रम में शेष concatamer transposons को नष्ट करने के लिए. यह डीएनए एक दूसरी बार काटने एक एंजाइम है है कि प्लाज्मिड v कटौती का उपयोग करके हासिल की हैector डीएनए कि ट्रांसजेनिक चूहों transposon concatamer युक्त बनाने के लिए इस्तेमाल किया गया था.
  15. डाइजेस्ट डीएनए (दोनों बाएँ और दाएँ पक्ष) BamHI का उपयोग: मिक्स 4.13 कदम, 5 μl 10x चंचु # 3 बफर, 0.5 μl BamHI (20 यू / μl), 0.5 μl (BSA से 25 μl linker ligated डीएनए के 10 मिलीग्राम / एमएल ), और 19 μl DDH 2
  16. डाइजेस्ट 3-6 घंटा या 37 पर रातोंरात डिग्री सेल्सियस
  17. प्राथमिक पीसीआर प्रदर्शन और linker के लिए एक किताब के विशिष्ट transposon के लिए एक विशिष्ट प्राइमर का उपयोग. Transposon और linker क्या आप का उपयोग कर रहे हैं पर निर्भर करते हुए भिन्न हो जाएगा. प्राइमरों T2/Onc और T2/Onc2 transposons लिए काम ऊपर प्राइमर तालिका में सूचीबद्ध है.
  18. प्राथमिक पीसीआर: 5 μl 10x बफर, 2.0 μl MgCl2 (50 मिमी), 4 μl dNTPs (2.5 एनएम), 1 μl प्राइमर 1 (20 सुक्ष्ममापी), 1 μl 2 प्राइमर (20 सुक्ष्ममापी), 0.25 μl प्लेटिनम (Taq 5 यू / ) μl, 3 μl linkers साथ पचा डीएनए (राशि भिन्न हो सकते हैं), ऊपर से 50 μl DDH 2
  19. पीसीआर कार्यक्रम: 94 ° C 5 मिनट, 94 चक्र के 30 डिग्री सेल्सियस के लिए के लिए 30 सेकंड, 60 और घजैसे सी, 30 सेकंड के लिए, 72 ° 90 सेकंड के लिए सी. अंतिम 72 में विस्तार ° C 5 मिनट के लिए.
  20. पीसीआर MinElute 96 अच्छी तरह प्लेटें और एक निर्वात कई गुना ऊपर वर्णित के रूप में उपयोग करते हुए उत्पाद को साफ.
  21. 30 μl एच 2 हे में Resuspend और एक साफ 96 अच्छी तरह से थाली हस्तांतरण.
  22. 4.21 कदम से 148 μl DDH 2 हे में डीएनए के 2 μl कमजोर द्वारा 1 के एक 1:75 कमजोर पड़ने ° पीसीआर
  23. प्रदर्शन माध्यमिक पीसीआर प्राइमरों कि Illumina GAIIx के रूप में के रूप में अच्छी तरह से एक 12 आधार जोड़ी बारकोड कि हर ट्यूमर संसाधित (के इन प्राइमरों उदाहरण के लिए ऊपर प्राइमर तालिका देखें) नमूने के लिए अद्वितीय है मशीन के लिए भी आवश्यक अनुक्रम नेस्टेड संस्करणों का उपयोग कर.
  24. माध्यमिक पीसीआर: 10 MgCl2 साथ μl 10x बफर, 8 μl dNTPs (2.5 मिमी), 1 μl Illumina माध्यमिक (20 सुक्ष्ममापी) किताब, 1 μl Illumina 1 नेस्ट माध्यमिक प्राइमर (20 सुक्ष्ममापी), 0.25 μl FastStart (Taq barcoded यू 5 / μl ), प्राथमिक पीसीआर पतला 1:75 से 2 μl डीएनए, अप करने के लिए 100 μl DDH 2
  25. पीसीआर कार्यक्रम: 94 °सी, 2 मिनट के लिए, 30 सेकंड, 53 डिग्री सेल्सियस के लिए 30 45 सेकंड, 72 डिग्री सेल्सियस के लिए 90 सेकंड के लिए 94 डिग्री सेल्सियस के चक्र. अंतिम 72 में विस्तार ° C 5 मिनट के लिए.
  26. एक 1% agarose ethidium ब्रोमाइड (0.5 ग्राम / मिलीग्राम) युक्त जेल पर इस पीसीआर प्रतिक्रिया की 45 μl चलाएँ. पीसीआर ट्यूमर में कई अलग transposon सम्मिलन (3 चित्रा) के amplicons का प्रतिनिधित्व उत्पादों की एक "धब्बा" होना चाहिए.
  27. शेष पीसीआर उत्पाद के 50 μl MinElute 96 अच्छी तरह प्लेटें और ऊपर वर्णित के रूप में एक निर्वात कई गुना का उपयोग. कुओं में 50 μl DDH 2 ओ रखने और फिर vacuuming से एक समय से धो लें.
  28. 30 μl ते में Resuspend और एक साफ 96 अच्छी तरह से थाली हस्तांतरण.
  29. प्रत्येक नमूने में डीएनए की एकाग्रता का निर्धारण करते हैं. एक एकल 1.5 मिलीलीटर microfuge ट्यूब में डीएनए के बराबर मात्रा में गठबंधन. यह पुस्तकालय है कि एक Illumina HiSeq 2000 मशीन के एक सिंगल लेन में अनुक्रम होगा. यह एक Illumina चलाने के एक सिंगल लेन में कई सौ ट्यूमर अनुक्रम के लिए संभव है.
  30. प्रस्तुत करनाएकल अनुक्रमण के लिए सभी ट्यूमर से डीएनए के बराबर मात्रा युक्त ट्यूब. यह आपकी संस्था या व्यावसायिक रूप से किया जा सकता है.

5. Transposon सम्मिलन का विश्लेषण

  1. Transposon प्रविष्टि डेटा का विश्लेषण करने के लिए सॉफ्टवेयर SourceForge (के माध्यम से मुफ्त डाउनलोड के लिए उपलब्ध है http://sourceforge.net/projects/tapdancebio/ ). कार्यक्रम, TapDance बुलाया, Illumina मंच और पुस्तकालय नक्शा पाठ फाइल करने के लिए एक बारकोड से अनुक्रम फ़ाइल की आवश्यकता है.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

प्रजनन की योजना के बाद स्थापित किया गया है, प्रजनकों हर 19-21 दिनों में एक कूड़े का उत्पादन करना चाहिए. कूड़े के आकार के बीच 5 और 12 पिल्ले प्रजनकों और आनुवंशिक पृष्ठभूमि की उम्र के आधार पर अलग अलग होंगे. इसके अलावा, यकीन है कि कूड़े के जीनोटाइप पुष्टि करते हैं कि प्रजनन योजना दोनों सही और सफल है के लिए एक रास्ता के रूप में मेंडेलीय आनुवांशिकी के बाद कर सकते हैं.

प्रयोग सफल होने के लिए, प्रायोगिक पशुओं में ट्यूमर घटना काफी नियंत्रण पशुओं में ट्यूमर घटना की तुलना में अधिक से अधिक होना चाहिए. अगर कोई "predisposing" उत्परिवर्तन प्रयोग में शामिल किया गया था वहाँ नियंत्रण पशुओं में कोई ट्यूमर के लिए कुछ किया जाना चाहिए. यदि एक "predisposing" परिवर्तन के प्रयोग में शामिल किया गया था, इन पशुओं में ट्यूमर घटना ज्यादा उत्परिवर्तन और एस.बी. गतिविधि के साथ पशुओं में घटना से कम होना चाहिए.

LM-पीसीआर एक ही ट्यूमर में transposon सम्मिलन के सैकड़ों बढ़ाना चाहिए. हा चलने के बादएक 1% जेल पर माध्यमिक पीसीआर उत्पाद के वामो, वहाँ इस प्रवर्धन का प्रतिनिधित्व डीएनए के एक "धब्बा" (3 चित्रा) होना चाहिए. अगर वहाँ केवल एक या दो बैंड रहे हैं, या तो एस.बी. ट्यूमर में सक्रिय नहीं था या एक त्रुटि प्रोटोकॉल (चित्रा 4) में बनाया गया था.

Illumina GAIIx मंच की एक लेन में एक करने के लिए दो सौ ट्यूमर अनुक्रमण प्रत्येक 100 बीपी (5 चित्रा) के 30 लाख दृश्यों पर उत्पादन करना चाहिए.

तालिका 1. अभिकर्मकों धारा 2 के लिए आवश्यक हैं.

तालिका 2. अभिकर्मकों धारा 3 के लिए आवश्यक हैं.

तालिका 3. अभिकर्मकों सेक्शन 4 के लिए आवश्यक हैं.

चित्रा 1
चित्रा 1. फ्लो चार्ट कदम दिखाकरने के लिए बाहर एक आगे आनुवंशिक स्क्रीन स्लीपिंग ब्यूटी प्रणाली का उपयोग कर पहले ले., एक माउस मॉडल उत्पन्न होता है. चूहे तो जब मरणासन्न और ट्यूमर को एकत्र कर रहे हैं और अलग - थलग necropsied कर रहे हैं. ट्यूमर डीएनए और शुद्ध linker मध्यस्थता पीसीआर प्रदर्शन किया. अंत में, प्रवर्धित transposon सम्मिलन के साथ ट्यूमर डीएनए अनुक्रम और आम प्रविष्टि साइटों की पहचान की.

चित्रा 2
चित्रा 2. योजना प्रजनन करने के लिए प्रयोगात्मक काउहोट उत्पन्न Transposase (Rosa26 LSL - SB11) युक्त चूहे. Transposons (टी 2 Onc) की concatamer शरण चूहों को पार कर रहे हैं. वंश तो नामित ऊतक विशिष्ट Cre recombinase (CRE) संचालित प्रमोटर ले चूहों लिए mated रहे हैं.

चित्रा 3
चित्रा 3. प्रतिनिधिमाध्यमिक पीसीआर परिणाम की उम्मीद उत्पाद उपस्थिति 100 से लेकर 600 आधार जोड़े की तरह एक धब्बा है.

चित्रा 4
चित्रा 4. यदि LM-पीसीआर असफल होता है, डीएनए के "धब्बा" का अभाव हो जाएगा. इसके बजाय, आप देखेंगे डीएनए की निश्चित बैंड.

चित्रा 5
चित्रा 5 है कि Illumina GAIIx मंच के एक सिंगल लेन को दर्शाता एक अनुक्रमण रन से उदाहरण डेटा 100 आधार प्रत्येक जोड़े के 30 लाख दृश्यों पर उत्पादन करना चाहिए.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

स्लीपिंग ब्यूटी transposon प्रणाली का उपयोग करते हुए एक आगे आनुवंशिक स्क्रीन परिवर्तन के कारण कैंसर की पहचान के लिए एक तरीका प्रदान करता है. उपयुक्त प्रमोटर का चयन करने के लिए किसी भी predisposing परिवर्तन करने के लिए इसके अलावा में Cre recombinase नियंत्रण, एस.बी. स्क्रीन में जाना जाता है की पहचान करने और उपन्यास उम्मीदवार कैंसर जीन.

स्क्रीन बनाने के लिए चयनित चूहों पर एक एस.बी. स्क्रीन की सफलता काफी हद तक निर्भर है. Transposon के लिए, हम दो अलग अलग माउस अलग 7 गुणसूत्रों पर oncogenic transposons की concatamer ले उपभेदों का उपयोग करने की सलाह देते हैं. सावधान सोचा जब ऊतक विशेष Cre recombinase कि एस.बी. Transposase सक्रिय होगा चुनने के लिए इस्तेमाल किया जाना चाहिए. वहाँ सबूत है कि Cre एंजाइम कोशिका प्रकार है कि जा रहा modeled कैंसर की उत्पत्ति के सेल होने का संदेह है, में सक्रिय है होना चाहिए. सफल उदाहरण में में (सैनिक पथ कैंसर) Villin Cre, Albumin Cre (hepatocellular carcinom शामिल हैंएक), और सहायता Cre (लिंफोमा) 8-10.

एक सफल स्क्रीन के लिए आवश्यक चूहों की संख्या ट्यूमर अंतर्वेधन पर निर्भर करेगा. सामान्य में, और ट्यूमर और अधिक चूहों एक और अधिक मजबूत स्क्रीन में परिणाम देगा. कैंसर विलंबता में 2 गुना अंतर का पता लगाने के लिए कम से कम 60 जानवरों दोनों नियंत्रण और प्रयोगात्मक समूहों में 11 चाहिए.

इन स्क्रीन के बहुमुखी प्रकृति अन्य तकनीकों में है कि एक बीमारी की प्रकृति निर्दिष्ट करने के लिए, प्रगति का पालन कर सकते हैं, और आनुवंशिक संरचना का विश्लेषण करने के लिए संबंध में शक्तिशाली है. इस तकनीक स्क्रीन है कि सीआईएस सूची है कि नए संभावित कैंसर ड्राइविंग जीन की पहचान झुकेंगे की एक संख्या में सफल रहा है. इस जानकारी के साथ, निर्देशन अध्ययन इन उपन्यास परिवर्तन के समारोह को समझने के लिए किया जा सकता है. कुल मिलाकर, इस तकनीक का उपयोग नई दवा के उद्देश्य से चिकित्सा के अंतिम डिजाइन करने के लिए नेतृत्व करने के लिए इन विशिष्ट आनुवंशिक muta के परिणामों को समाप्त कर सकते हैंमाहौल.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

लेखकों का खुलासा करने के लिए कुछ भी नहीं है.

Acknowledgments

लेखकों के लिए मिनेसोटा विश्वविद्यालय में Branden Moriarity, डेविड Largaespada, और विन्सेन्ट Keng धन्यवाद करना चाहते हैं, और एडम Dupuy आयोवा विश्वविद्यालय में विकासशील प्रोटोकॉल ऊपर वर्णित में उनकी सहायता के लिए.

Materials

Name Company Catalog Number Comments
Sure-Seal Induction Chamber Brain Tree Scientific EZ-177
Cryovial Bioexpress C-3355-2
10% Buffered Formalin Sigma Aldrich HT501128-4L
Protein Precipitation solution Qiagen 158910
Cell lysis buffer Qiagen 158906
Proteinase K Qiagen 158920
RNase A Qiagen 158924
TE Buffer Promega V6232
BfaI New England Biolabs R0568S
NlaIII New England Biolabs R0125S
MinElute 96 well plates Qiagen 28051
QIAvac 96 Vacuum manifold Qiagen 19504
Multi-MicroPlate Genie, 120V Scientific Industries, Inc. SI-4000
T4 DNA ligase with 5x ligation Buffer Invitrogen 15224-041
BamHI New England Biolabs R0136S
25mM dNTPs Bioexpress C-5014-200
Platinum Taq Invitrogen 10966-034
FastStart Taq DNA Polymerase Roche 12032929001
Agarose Promega V3121
TAE Buffer Promega V4271
TE Buffer Promega V6232
Ethidium bromide Promega H5041

DOWNLOAD MATERIALS LIST

References

  1. Fearon, E. R., Vogelstein, B., et al. A genetic model for colorectal tumorigenesis. Cell. 61, 759-767 (1990).
  2. Wood, L. D., et al. The Genomic Landscapes of Human Breast and Colorectal Cancers. Science. 318, 1108-1113 (2007).
  3. Ivics, Z., Hackett, P. B., Plasterk, R. H., Izsvák, Z. Molecular Reconstruction of Sleeping Beauty, a Tc1-like Transposon from Fish, and Its Transposition in Human Cells. Cell. 91, 501-510 (1997).
  4. Starr, T. K., Largaespada, D. A. Cancer gene discovery using the Sleeping Beauty transposon. Cell Cycle. 4, 1744-1748 (2005).
  5. Mueller, P. R., Wold, B. In Vivo Footprinting of a Muscle Specific Enhancer by Ligation Mediated PCR. Science. 246, 780-786 (1989).
  6. Bergemann, T. L., et al. New methods for finding common insertion sites and co-occurring common insertion sites in transposon- and virus-based genetic screens. Nucleic acids research. 40, 3822-3833 (2012).
  7. Copeland, N. G., Jenkins, N. A. Harnessing transposons for cancer gene discovery. Nature Reviews Cancer. 10, 696-706 (2010).
  8. Collier, L. S., Carlson, C. M., Ravimohan, S., Dupuy, A. J., Largaespada, D. A. Cancer gene discovery in solid tumours using transposon-based somatic mutagenesis in the mouse. Nature. 436, 272-276 (2005).
  9. Starr, T. K., et al. A transposon-based genetic screen in mice identifies genes altered in colorectal cancer. Science. 323, 1747-1750 (2009).
  10. Keng, V. W., et al. A conditional transposon-based insertional mutagenesis screen for genes associated with mouse hepatocellular carcinoma. Nature. 27, 264-274 (2009).
  11. Dupuy, A. J., Akagi, K., Largaespada, D. A., Copeland, N. G., Jenkins, N. A. Mammalian mutagenesis using a highly mobile somatic Sleeping Beauty transposon system. Nature. 436, 221-226 (2005).
की पहचान<em&gt; स्लीपिंग ब्यूटी</em&gt; Linker की मध्यस्थता पीसीआर का उपयोग कर ठोस ट्यूमर में Transposon सम्मिलन
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Janik, C. L., Starr, T. K. Identification of Sleeping Beauty Transposon Insertions in Solid Tumors using Linker-mediated PCR. J. Vis. Exp. (72), e50156, doi:10.3791/50156 (2013).More

Janik, C. L., Starr, T. K. Identification of Sleeping Beauty Transposon Insertions in Solid Tumors using Linker-mediated PCR. J. Vis. Exp. (72), e50156, doi:10.3791/50156 (2013).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter