Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Medicine

Identificação de doi: 10.3791/50156 Published: February 1, 2013

Summary

Um método de identificação de condutores desconhecidos da carcinogénese, utilizando uma abordagem imparcial é descrito. O método utiliza o

Abstract

Genômica, proteômica análises, transcriptomic, e epigenômico de tumores humanos indicam que existem milhares de anomalias dentro de cada genoma do câncer em comparação com o tecido normal combinado. Com base nessas análises, é evidente que há muitos condutores não descobertas genéticas do câncer 1. Infelizmente esses drivers estão escondidos dentro de um número muito maior de anomalias de passageiros no genoma que não contribuem diretamente para a formação de tumor. Outro aspecto do genoma do cancro é que existe uma grande heterogeneidade genética considerável dentro semelhantes tipos de tumores. Cada tumor pode abrigar mutações diferentes que proporcionam uma vantagem seletiva para a formação do tumor 2. Realizando uma tela para a frente imparcial genética em ratos fornece as ferramentas para gerar tumores e analisar sua composição genética, além de reduzir o fundo de mutações de passageiros. The Sleeping Beauty (SB) sistema transposon é um tal método 3. O sistema utiliza o SB móvel vectors (transposons) que pode ser inserido por todo o genoma da enzima transposase. As mutações são limitados a um tipo de célula específico através da utilização de um alelo de transposase condicional que é activado pela recombinase Cre. Existem muitas linhas de ratinhos que expressa recombinase Cre em tecidos específicos. Ao cruzar uma dessas linhas para o alelo transposase condicional (por exemplo, pára--Lox Lox-SB11), o sistema de SB é activado apenas nas células que expressam Cre recombinase. A recombinase Cre vontade extirpar uma cassete de batente, que bloqueia a expressão do alelo de transposase, activando assim a mutagénese transposon dentro do tipo de célula designada. Uma tela de SB é iniciada por meio de cruzamento três estirpes de ratinhos transgénicos de modo a que os ratinhos experimentais portadores de um alelo transposase condicional, um concatamer de transposões, e um tecido específico de alelo recombinase Cre. Estes ratos são autorizados a idade até se formarem tumores e tornam-se moribundos. Os ratos são entãoDNA genómico necropsiados e é isolado a partir de tumores. Em seguida, o ADN genómico é submetido a linker mediada-PCR (LM-PCR), que resulta em amplificação de loci genómicos contendo um transposon SB. LM-PCR realizada sobre um único tumor vai resultar em centenas de amplicons distintas, representando as centenas de loci genómicos contendo inserções de transposões em um único tumor 4. As inserções de transposões, em todos os tumores são analisados ​​e locais de inserção comuns (CIS) são identificadas usando um método estatístico adequado 5. Genes dentro da CEI são altamente susceptíveis de ser oncogenes ou genes supressores de tumores, e são considerados genes de cancro candidatas. As vantagens de utilizar o sistema de SB para identificar genes candidatos cancerosas são: 1) o transposão pode ser facilmente localizado no genoma, porque a sua sequência é conhecida, 2) a transposição pode ser dirigido para quase qualquer tipo de célula e 3) o transposon seja capaz de introdução simultânea de ganho e perda de função-mutações 6. O following protocolo descreve a forma de conceber e realizar uma tela para a frente utilizando a genética SB sistema transposon para identificar genes candidatos cancro (Figura 1).

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. Reprodução e Envelhecimento de Animais Transgênicos

  1. Selecione as linhagens de camundongos transgênicos adequadas para a sua experiência. Uma experiência típica vai usar três linhas transgénicas, um rato transposase condicional, um rato portador de um dos transposões concatamer, e um rato expressando recombinase Cre nas células crê serem as células de origem para o cancro desejado. Se o cancro a ser modelada tem uma mutação conhecida num grande percentagem dos pacientes, pode ser desejável incluir essa mutação no início. Exemplos desses "predisponentes" mutações incluem Kras ativados, dominantes TP53 negativas ou um alelo Pten floxed. Ao adicionar em uma mutação predisponente o modelo pode representar melhor o câncer humano (ver 1.3). Transposase Beleza vários ratos de dormir e de transposons estão disponíveis no Instituto Nacional de Câncer Rato Repository ( http://mouse.ncifcrf.gov/ ).
  2. Camundongos da raça condicionais transposase com ratos, contendo os transposons para, eventualmente, obter camundongos homozigotos para ambos os alelos se possível. Breed descendência homozigótica para ratinhos que expressam Cre recombinase para gerar os seus triplos transgénicos ratinhos experimentais (figura 2). Nota: Obtenção de camundongos homozigotos nem sempre é possível ou ideal. Por exemplo, p53 homozigotos dominantes negativos ratos são muito mais difíceis de produzir do que os ratos heterozigotos. Além disso, é útil para assegurar que ninhadas seguir genética mendeliana para confirmar que o sistema de criação de animais é bem sucedido.
  3. Se usar um fundo predispostos, os ratos da raça primeiro com a transposase de camundongos com o alelo de predisposição. Simultaneamente, os ratos da raça expressando a recombinase Cre ratinhos que transportam os transposons. Criar ratos homozigotos para cada alelo, se possível. Finalmente, produzir a prole homozigótica dos últimos dois esquemas de melhoramento para gerar quadruplicar anim experimental transgênicoals.
  4. Além dos animais experimentais, gerar coortes de controlo de ratos. O grupo de controlo é normalmente constituída por ninhada do que apenas a reprodução experimental herdam dois dos três alelos (Figura 2). No caso de um fundo predispostos, incluindo ratos, três dos quatro alelos será também necessário.
  5. Monitorar ratinhos experimentais e de controlo por dia durante o desenvolvimento do tumor e / ou moribundity. Siga o seu cuidado com os animais institucional e de uso da comissão (IACUC) requisitos para a criação de animais. Além disso, é típico para determinar uma idade em que você vai sacrificar um animal, se ele ainda não se tornou moribundo. Dezoito meses é uma idade típica em que os ratos são sacrificados.

2. Necropsia de Animais Transgênicos

Nome do reagente Companhia Número de catálogo
Sure-Seal InducCâmara ção Cérebro Árvore Científico EZ-177
Criotubo Bioexpress C-3355-2
Formol tamponado 10% Sigma Aldrich HT501128-4L

Reagentes Tabela 1. Necessário.

  1. Quando um rato está moribundo ou atingiu o fim da vida útil determinado, eutanásia animal, usando uma câmara de 2 CO seguindo suas diretrizes IACUC. Geralmente, colocar o animal em uma câmara de gás limpo, abrir o tanque de gás e ajustar o regulador de ler não superior a 5 libras por polegada quadrada. Encher lentamente para minimizar a irritação nasal e ocular e aversão ao CO 2. Certifique-se de que o coração do animal já não é bater e não responde quando tocado no olho.
  2. Pulverização exterior de rato sacrificados com etanol a 70%.
  3. Lugar do mouse em uma placa de necropsia e prenda com alfinetes de dissecação. Use a tesoura umd pinças para abrir o mouse e remover órgãos. Determinar que os órgãos devem ser coletados é o projeto dependente. No entanto, recomenda-se sempre coletar o baço e do fígado, como esses órgãos muitas vezes, dar uma visão importante porque o mouse estava moribunda. Também recolher o esterno para a análise de potencial de medula óssea. Além disso, é sempre vantajoso para recolher qualquer órgão ou tecido que aparece anormal.
  4. Tecidos e tumores que são coletados deve ser dividido em quatro seções. Uma secção é fixado em formalina tamponada a 10% durante 18 horas seguido de 70% de etanol. Esta secção pode ser usada para coloração de H & E e / ou IHC. Os restantes três secções, as quais são geralmente 50 a 100 mg de tamanho, são de encaixe congelados em azoto líquido. Estes podem ser usados ​​para DNA, RNA e isolada de proteínas.
  5. Dispor de tecidos da carcaça e restante de acordo com as diretrizes IACUC.

3. Isolar o ADN genómico a partir de tumores

<> Nome forte do reagente Companhia Número de catálogo
Solução Protein Precipitation Qiagen 158910
Tampão de lise celular Qiagen 158906
Proteinase K Qiagen 158920
RNase A Qiagen 158924
Tampão TE Promega V6232

Reagentes Tabela 2. Necessário.

  1. Finamente tritura a amostra de tumor congeladas (50 a 100 mg), utilizando uma lâmina de barbear limpa.
  2. Colocar o tecido triturado em um tubo de microcentrífuga de 1,5 ml e adicionar 1 ml de tampão de lise de células, contendo 5 ul de solução de proteinase K (20 mg / ml).
  3. Vortex completamente.
  4. Incubar em 55 ° C Agitador ajustado a 250 rpm durante pelo menos 4 horas, de preferência durante a noite.
  5. Adicionar 1 ml de RNase A solução (10 mg / ml) e inverter o tubo 25 vezes.
  6. Incubar a 37 ° C durante 30 min.
  7. Arrefecer até à temperatura ambiente, colocando em gelo durante 3 min.
  8. Adicionar 333 ul solução de precipitação de proteínas e vortex vigorosamente.
  9. Centrifugar a 14.000 rpm 10 min. As proteínas devem pellet. Se é muito pequeno pellet de vórtice, de novo, incubadas em gelo durante 5 min, e em seguida, re-centrífuga.
  10. Decantar o sobrenadante contendo ADN num tubo limpo de centrífuga de 15 ml.
  11. Adicionar um volume igual de isopropanol a 100% e misturar suavemente por inversão 50 vezes.
  12. Centrifugar a 3500 rpm durante 3 min.
  13. Elimine o sobrenadante.
  14. Adicionar 1 ml de etanol a 70% e inverter tubo várias vezes para lavar o sedimento.
  15. Transferir o sedimento lavado juntamente com o etanol, para um tubo de microcentrífuga de 1,5 ml.
  16. Centrifugar a 14.000 rpm durante 5 min a 4 ° C.
  17. Verter o etanol e inverter o tubo de ar seco (cerca de 5 a 30 min).
  18. Ressuspender DNA pEllet em 50 a 500 ul de TE, dependendo do tamanho do DNA de ressuspensão.
  19. Incubação opcional a 37 ° C para voltar a suspender o DNA.
  20. Armazenar a 4 ° C, ou -20 ° C para armazenamento a longo prazo.

4. Linker Mediada por PCR usando DNA genômico de Tumores

Nome do reagente Companhia Número de catálogo
BfaI New England Biolabs R0568S
NlaIII New England Biolabs R0125S
MinElute placas de 96 poços Qiagen 28051
QIAvac colector de vácuo 96 Qiagen 19504
Multi-microplaca Genie, 120V Scientific Industries, Inc. SI-4000
DNA-ligase de T4 com tampão de ligação 5x Invitrogen 15224-041
BamHI New England Biolabs R0136S
25 mM de dNTPs Bioexpress C-5014-200
Taq Platinum Invitrogen 10966-034
FastStart DNA polimerase Taq Roche 12032929001
Agarose Promega V3121
Tampão TAE Promega V4271
Tampão TE Promega V6232
O brometo de etídio Promega H5041

Reagentes Tabela 3. Necessário.

Seqüências Linker

BfaI linker + 5 'GTAATACGACTCACTATAGGGCTCCGCTTAAGGGAC 3'

BfaI vinculador-5 'Phos-TAGTCCCTTAAGCGGAG 3'NH2

"> Linker NlaIII + 5'GTAATACGACTCACTATAGGGCTCCGCTTAAGGGACCATG 3 '

NlaIII linker-5 '-Phos GTCCCTTAAGCGGAGCC 3'

Seqüências de primers

Primária PCR frente lado direito (NlaIII): Spl IRDR R1 1 GCTTGTGGAAGGCTACTCGAAATGTTTGACCC

Primária PCR frente do lado esquerdo (BfaI): Spl IRDR L1 1 CTGGAATTTTCCAAGCTGTTTAAAGGCACAGTCAAC

Reversa PCR primário para o lado direita e esquerda: SPL Link1 um GTAATACGACTCACTATAGGGC

PCR secundário lateral direito para a frente: Exemplo de um iniciador de código de barras Illumina secundário 5 'AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTNNNNNNNNNNNNaGgtgtatgtaaacttccgacttcaa (A de N representa o código de barras 12 bp, a sequência em letras maiúsculas são necessários para a plataforma Illumina, e a sequência em letras minúsculas se ligará ao transposão.)

PCR secundário frente do lado esquerdo: Exemplo de um código de barras secon Illuminainiciador dary 5'AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTNNNNNNNNNNNNaAgtgtatgtaaacttccgacttcaa (A de N representa o código de barras 12 bp, a sequência em letras maiúsculas são necessários para a plataforma Illumina, e a sequência em letras minúsculas se ligará ao transposão.)

Reversa PCR secundário para o lado direita e esquerda: primer aninhada vinculador reverso 5 'CAAGCAGAAGACGGCATACGAGCTCTTCCGATCTAGGGCTCCGCTTAAGGGAC

  1. Hibridar a + e - ligantes para ambos os ligantes e linkers BfaI NlaII pela mistura de 50 ul de linker + (100 uM) com 50 ul de linker (100 uM) e adicionar 2 ul de NaCl (5 M), num tubo de microcentrífuga de 1,5 ml. Lugar no bloco de aquecimento de 95 ° C durante 5 min. Desligue o bloco de aquecimento e deixar arrefecer lentamente até à temperatura ambiente (isto demora uma hora ou mais). Após o arrefecimento, os ligantes recozido pode ser armazenado num congelador a -20 ° C até ser necessário.
  2. Preparar duas alíquotas do ADN do tumor, cada um contendo alíquotas de 1 ug de DNA. Uma alíquota será digerido witha enzima de restrição que vai cortar perto do fim "direito" do transposon. A segunda alíquota será digerido com uma enzima de restrição que corta perto da extremidade "esquerda" do transposão. Isto é feito para maximizar as chances de ampliar cada local de inserção do transposon.
  3. Digerir o ADN do tumor em uma alíquota usando o "direito" NlaII enzima lado, e digerir o ADN do tumor no outro alíquota usando o "lado esquerdo" do lado enzima BfaI: combinar 1 ul de enzima, 5 ul de tampão NEB 10x # 4, DNA ( 1 ug) e DDQ 2 O para um volume total de 50 ul. Digest de ADN durante a noite a 37 ° C em banho-maria ou incubadora.
  4. Aquecer inactivar enzimas (BfaI = 80 ° C, durante 20 min, NlaIII = 65 ° C durante 20 min).
  5. Limpar as amostras digeridas colocando as amostras em placas de 96 poços MinElute, colocar a placa no distribuidor de vácuo e de vácuo durante cerca de 15 min até poços aparência seca.
  6. Retire a placa do colector de vácuo e inferior blot de placa de 96 poços com uma toalha de papel para remover todo o liquid
  7. Adicionar 30 ul de DDH 2 O a cada poço e agitar num agitador orbital em conjunto elevado durante 2 minutos, ou pipetar para cima e para baixo, 20 a 40 vezes.
  8. Transferir volume total em poços (30 ul) de MinElute placa de 96 poços em placas de 96 poços limpos.
  9. Realizar reacções de ligação com ligantes de ADN digerido a partir do passo 4.8 e ligantes a partir do passo 4.1. Misturar 10 uL de ADN digerido, 4 uL de tampão de ligação 5x, 5,5 ul de linkers recozido (950 ug / ul), 0,5 ul de ligase de T4 (5 U / uL).
  10. Incubar durante 4 horas a durante a noite a 16 ° C.
  11. Aquecer inactivar a ligase de ADN de T4 a 65 ° C durante 10 min.
  12. Limpar ligadura MinElute usando placas de 96 poços e um colector de vácuo, tal como descrito nos passos 4,5-4,6.
  13. Ressuspender em 30 ul de H2O e transferir para uma placa de 96 limpa bem.
  14. Realizar uma digestão do DNA segundo para destruir restante transposons concatamer. Isto é conseguido cortando o DNA de uma segunda vez usando uma enzima que corta o plasmídeo vector de ADN que foi usado para criar os ratinhos transgénicos que contêm o concatamer transposon.
  15. Digest de DNA usando BamHI (lado esquerdo e direito): Mistura de 25 ul de DNA linker-ligado a partir do passo 4.13, 5 uL de tampão NEB 10x # 3, 0,5 ul BamHI (20 U / ul), 0,5 ul de BSA (10 mg / ml ), e 19 ul de DDH 2 O.
  16. Digest 3-6 horas ou durante a noite a 37 ° C.
  17. Realizar PCR primário, utilizando um iniciador específico para o transposão específico e um iniciador para o linker. Estes irão variar dependendo do que transposon e vinculador você está usando. Os iniciadores indicados na tabela acima iniciador de trabalho para o T2/Onc e T2/Onc2 transposons.
  18. Primário PCR: 5 ul de tampão 10x, 2,0 ul de MgCl2 (50 mM), 4 uL dNTPs (2,5 nM), 1 ul de iniciador 1 (20 uM), 1 ul de iniciador 2 (20 mM), 0,25 ul de Platinum Taq (5 U / ul), 3 uL de ADN digerido com ligantes (quantidade pode variar), até 50 ul DDH 2 O.
  19. Programa de PCR: 94 ° C por 5 min, 30 ciclos de 94 ° C durante 30 seg, 60 & dpor exemplo, C durante 30 seg, 72 ° C durante 90 seg. Extensão final a 72 ° C durante 5 min.
  20. Limpar PCR MinElute produto utilizando placas de 96 poços e um colector de vácuo, tal como descrito acima.
  21. Ressuspender em 30 ul de H2O e transferir para uma placa de 96 limpa bem.
  22. Fazer uma diluição 1:75 do 1 ° PCR por diluição de 2 ul de DNA a partir do passo 4,21 em 148 uL DDH 2 O
  23. Realizar PCR secundária utilizando versões aninhados dos iniciadores que têm também a sequência necessária para a máquina GAIIx Illumina, bem como um código de barras 12 pares de bases que é único para cada amostra de tumor transformadas (ver tabela de primer acima para exemplos desses iniciadores).
  24. Secundário PCR: 10 ul de tampão 10x com MgCl2, 8 uL dNTP (2,5 mM), 1 ul de código de barras Illumina iniciador secundário (20 uM), 1 ul Nest Illumina um iniciador secundário (20 uM), 0,25 ul FastStart Taq (5 U / uL ), 2 uL de ADN a partir de 1:75 primários de PCR diluído, até 100 ul DDH 2 O.
  25. Programa de PCR: 94 °; C durante 2 min, 30 ciclos de 94 ° C durante 30 segundos, 53 ° C durante 45 seg, 72 ° C durante 90 seg. Extensão final a 72 ° C durante 5 min.
  26. 45 ul de executar esta reacção de PCR num gel de agarose a 1% contendo brometo de etídio (0,5 ug / ml). Deve haver uma "mancha" de produtos de PCR que representam amplicons das inserções de transposões muitos diferentes no tumor (Figura 3).
  27. Limpar restante 50 ul de produto de PCR MinElute usando placas de 96 poços e um colector de vácuo, tal como descrito acima. Lavar uma vez colocando 50 ul DDH 2 O nos poços e aspirar de novo.
  28. Ressuspender em 30 ul de TE e transferido para uma placa de 96 limpa bem.
  29. Determinar a concentração de ADN em cada amostra. Combinar iguais quantidades de DNA de um único tubo de microcentrífuga de 1,5 ml. Este será o da biblioteca que é sequenciado em uma única pista de um Illumina HiSeq 2000 máquina. É possível sequência de várias centenas de tumores em uma única pista de uma execução de Illumina.
  30. Submetero único tubo que contém quantidades iguais de DNA de todos os tumores de sequenciação. Isto pode ser feito pela sua instituição ou comercialmente.

5. Análise de inserções de transposões

  1. Software para análise de transposon inserção de dados está disponível para download gratuito através do SourceForge ( http://sourceforge.net/projects/tapdancebio/ ). O programa, chamado TapDance, requer o arquivo de seqüência a partir da plataforma Illumina e um código de barras para biblioteca de arquivo de texto mapa.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Após o regime de reprodução tiver sido estabelecida, os criadores devem produzir uma ninhada a cada 19-21 dias. Tamanho da ninhada pode variar entre 5 e 12 filhotes, dependendo da idade dos reprodutores e a base genética. Além disso, certifique-se de que o genótipo da ninhada segue genética mendeliana como uma forma para confirmar que o sistema de criação de animais é tanto correcta e bem sucedida.

Para a experiência de ser bem sucedido, a incidência do tumor nos animais experimentais deve ser significativamente maior do que a incidência de tumores em animais de controlo. Se não "predisposição" mutação foi incluído na experiência deverá haver poucos ou nenhuns tumores nos animais de controlo. Se uma "predisposição" mutação foi incluído na experiência, a incidência de tumores nesses animais deve ser muito menor do que a incidência nos animais com a mutação e actividade SB.

LM-PCR deve amplificar centenas de inserções dos transposões em um único tumor. Depois de correr haSe o produto de PCR derivado de um gel de 1%, não deve haver uma "mancha" de DNA representando esta amplificação (Figura 3). Se houver apenas uma ou duas bandas, ou SB não foi activo no tumor ou um erro foi feita no protocolo (Figura 4).

A sequenciação 1-200 tumores em uma única pista de plataforma GAIIx Illumina deve produzir mais de 30 milhões de sequências de 100 pb cada (Figura 5).

Reagentes Tabela 1. Necessário para seção 2.

Reagentes Tabela 2. Necessário para a seção 3.

Reagentes Tabela 3. Necessário para a secção 4.

Figura 1
Figura 1. Fluxograma mostrando os passospara levar a cabo uma tela para a frente utilizando o sistema genético Sleeping Beauty. Primeiro, um modelo de rato é gerado. Os ratos são então autopsiados quando moribundos e os tumores são recolhidas e isoladas. ADN do tumor é purificado e linker mediada por PCR realizada. Finalmente, o ADN amplificado tumor com inserções de transposões é sequenciada e locais de inserção comuns identificados.

Figura 2
Figura 2. Criação de sistema de gerar coorte experimental. Ratos contendo a transposase (Rosa26-LSL-SB11) são cruzados com ratos portadores da concatamer de transposons (T2-Onc). Os filhotes são, então, acoplado a camundongos portadores do promotor tecido específico designado impulsionado Cre Recombinase (CRE).

Figura 3
Figura 3. Representanteresultados de PCR secundária. O produto esperado tem um esfregaço aparência variando de 100 a 600 pares de bases.

Figura 4
Figura 4. Se LM-PCR é mal sucedido, não haverá uma ausência de "smear" de DNA. Em vez disso, você vai ver bandas definitivos de DNA.

Figura 5
Dados Figura 5. Exemplo de uma execução seqüenciamento que demonstra uma única pista da plataforma GAIIx Illumina deve produzir mais de 30 milhões de seqüências de 100 pares de base cada.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Uma tela para a frente genética utilizando o sistema Sleeping Beauty transposon fornece um método para identificar mutações que causam câncer. Ao seleccionar o promotor adequado para controlar a recombinase Cre para além de quaisquer mutações de predisposição, a tela SB identificará conhecidos e novos genes de cancro candidatas.

O sucesso de uma tela de SB é largamente dependente dos ratos seleccionados para criar a tela. Para o transposon, recomendamos o uso de duas diferentes linhagens de camundongos portadores do concatamer de transposons oncogênicos em cromossomos diferentes 7. O pensamento cuidadoso deve ser usado quando a escolha do tecido específico Recombinase Cre que vai ativar a transposase SB. Não deve haver evidência de que a enzima Cre está activo no tipo de célula que é suspeito de ser a célula de origem do cancro a ser modelado. Exemplos bem sucedidos incluem Villin-Cre (TGI câncer), Albumina-Cre (carcinom hepatocelulara), e ajuda-Cre (linfoma). 8-10

O número de ratinhos necessários para uma tela de sucesso dependerá do penetrância tumor. Em geral, os tumores mais e ratos mais vai resultar em uma tela mais robusta. Para detectar uma diferença de 2 vezes na latência do cancro, deve ser de pelo menos 60 animais no grupo de controlo e os grupos experimentais a 11.

A natureza versátil dessas telas é poderoso em relação a outras técnicas, em que se pode especificar a natureza da doença, siga a progressão, e analisar a composição genética. Esta técnica tem sido bem sucedido em um número de telas que geraram listas da CEI que identificam novos genes de condução potenciais de câncer. Com esta informação, os estudos dirigidos podem ser realizados para compreender a função destas novas mutações. Em geral, a utilização desta técnica pode conduzir à concepção eventual de novas terapias com drogas destinadas a eliminar os resultados destes muta genética específicações.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Os autores não têm nada a revelar.

Acknowledgments

Os autores gostariam de agradecer Branden Moriarity, David Largaespada, e Vincent Keng da Universidade de Minnesota, e Adam Dupuy da Universidade de Iowa para a sua assistência no desenvolvimento do protocolo descrito acima.

Materials

Name Company Catalog Number Comments
Sure-Seal Induction Chamber Brain Tree Scientific EZ-177
Cryovial Bioexpress C-3355-2
10% Buffered Formalin Sigma Aldrich HT501128-4L
Protein Precipitation solution Qiagen 158910
Cell lysis buffer Qiagen 158906
Proteinase K Qiagen 158920
RNase A Qiagen 158924
TE Buffer Promega V6232
BfaI New England Biolabs R0568S
NlaIII New England Biolabs R0125S
MinElute 96 well plates Qiagen 28051
QIAvac 96 Vacuum manifold Qiagen 19504
Multi-MicroPlate Genie, 120V Scientific Industries, Inc. SI-4000
T4 DNA ligase with 5x ligation Buffer Invitrogen 15224-041
BamHI New England Biolabs R0136S
25mM dNTPs Bioexpress C-5014-200
Platinum Taq Invitrogen 10966-034
FastStart Taq DNA Polymerase Roche 12032929001
Agarose Promega V3121
TAE Buffer Promega V4271
TE Buffer Promega V6232
Ethidium bromide Promega H5041

DOWNLOAD MATERIALS LIST

References

  1. Fearon, E. R., Vogelstein, B., et al. A genetic model for colorectal tumorigenesis. Cell. 61, 759-767 (1990).
  2. Wood, L. D., et al. The Genomic Landscapes of Human Breast and Colorectal Cancers. Science. 318, 1108-1113 (2007).
  3. Ivics, Z., Hackett, P. B., Plasterk, R. H., Izsvák, Z. Molecular Reconstruction of Sleeping Beauty, a Tc1-like Transposon from Fish, and Its Transposition in Human Cells. Cell. 91, 501-510 (1997).
  4. Starr, T. K., Largaespada, D. A. Cancer gene discovery using the Sleeping Beauty transposon. Cell Cycle. 4, 1744-1748 (2005).
  5. Mueller, P. R., Wold, B. In Vivo Footprinting of a Muscle Specific Enhancer by Ligation Mediated PCR. Science. 246, 780-786 (1989).
  6. Bergemann, T. L., et al. New methods for finding common insertion sites and co-occurring common insertion sites in transposon- and virus-based genetic screens. Nucleic acids research. 40, 3822-3833 (2012).
  7. Copeland, N. G., Jenkins, N. A. Harnessing transposons for cancer gene discovery. Nature Reviews Cancer. 10, 696-706 (2010).
  8. Collier, L. S., Carlson, C. M., Ravimohan, S., Dupuy, A. J., Largaespada, D. A. Cancer gene discovery in solid tumours using transposon-based somatic mutagenesis in the mouse. Nature. 436, 272-276 (2005).
  9. Starr, T. K., et al. A transposon-based genetic screen in mice identifies genes altered in colorectal cancer. Science. 323, 1747-1750 (2009).
  10. Keng, V. W., et al. A conditional transposon-based insertional mutagenesis screen for genes associated with mouse hepatocellular carcinoma. Nature. 27, 264-274 (2009).
  11. Dupuy, A. J., Akagi, K., Largaespada, D. A., Copeland, N. G., Jenkins, N. A. Mammalian mutagenesis using a highly mobile somatic Sleeping Beauty transposon system. Nature. 436, 221-226 (2005).
Identificação de<em&gt; A Bela Adormecida</em&gt; Inserções de transposões em tumores sólidos utilizando Linker mediada por PCR
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Janik, C. L., Starr, T. K. Identification of Sleeping Beauty Transposon Insertions in Solid Tumors using Linker-mediated PCR. J. Vis. Exp. (72), e50156, doi:10.3791/50156 (2013).More

Janik, C. L., Starr, T. K. Identification of Sleeping Beauty Transposon Insertions in Solid Tumors using Linker-mediated PCR. J. Vis. Exp. (72), e50156, doi:10.3791/50156 (2013).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter