Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Medicine

Identifikation af doi: 10.3791/50156 Published: February 1, 2013

Summary

En fremgangsmåde til identifikation af ukendte førere af carcinogenese under anvendelse af en objektiv metode er beskrevet. Fremgangsmåden anvender

Abstract

Genomiske, proteom, transkriptomisk, og epigenomic analyser af humane tumorer tyder på, at der er tusindvis af anomalier inden for hver kræft genom sammenlignet med matchede normalt væv. Baseret på disse analyser er det klart, at der er mange uopdagede genetiske førere af kræft 1. Desværre er disse chauffører er skjult i et langt større antal passagerer anomalier i genomet, som ikke bidrager direkte til tumordannelse. Et andet aspekt af kræft genomet er, at der er betydelig genetisk heterogenitet inden lignende tumortyper. Hver tumor kan harbor forskellige mutationer, der giver en selektiv fordel for tumordannelse 2. Udførelse af en uvildig fremad genetisk skærm i mus giver værktøjer til at generere tumorer og analysere deres genetiske sammensætning og samtidig reducere baggrund af passager mutationer. The Sleeping Beauty (SB) transposon-systemet er en sådan metode 3. SB system anvender mobile vectors (transposoner), der kan indsættes i hele genomet af transposasen enzym. Mutationer er begrænset til en specifik celletype ved anvendelse af en betinget transposase allel, der aktiveres af Cre-rekombinase. Mange muselinjer findes der udtrykker Cre-rekombinase i specifikke væv. Ved at krydse en af disse linjer til den betingede transposase allel (f.eks Lox-stop-Lox-SB11), er SB-systemet aktiveres kun i celler, som udtrykker Cre rekombinase. The Cre-rekombinase vil fjerner et stop-kassette, der blokerer ekspression af transposasen allel, derved aktivere transposon-mutagenese i det angivne celletype. En SB skærmen initieres ved avl tre stammer af transgene mus, således at de eksperimentelle mus bærer en betinget transposase allel, en concatamer af transposoner, og en vævsspecifik Cre-rekombinase allel. Disse mus får lov at ældes, indtil tumorer form og de bliver døende. Musene er dernæstobduceret og genomisk DNA isoleret fra tumorer. Dernæst genomiske DNA underkastet linker-medieret-PCR (LM-PCR), der resulterer i amplifikation af genomiske loci, der indeholder en SB transposon. LM-PCR udføres på en enkelt tumor vil resultere i hundredvis af forskellige amplikoner der repræsenterer hundrede genomiske loci, der indeholder transposon-insertioner i en enkelt tumor 4. Transposonet indrykninger i alle tumorer analyseres og fælles indsættelse sites (CISS) er identificeret ved hjælp af en passende statistisk metode 5. Gener i CIS er meget sandsynligt, at onkogener eller tumorsuppressorgener, og betragtes kandidat kræftgener. Fordelene ved at anvende SB system til at identificere kandidat-cancer-gener er: 1) transposonet kan let findes i genomet, fordi dets sekvens er kendt, 2) omsætning kan rettes til næsten enhver celletype og 3) transposonet kan indførelse af såvel gain-og tab af funktion mutationer 6. The following protokol beskriver, hvordan at udtænke og udføre en fremadrettet genetisk skærmen ved hjælp af SB transposon system til at identificere kandidat kræft gener (figur 1).

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. Avl og Aging af transgene dyr

  1. Vælg de stammer af transgene mus der passer til dit eksperiment. Et typisk forsøg vil bruge tre transgene linier, en betinget transposase mus, en mus huser et concatamer af transposoner, og en mus udtrykker Cre-rekombinase i cellerne menes at være celler af oprindelsen for den ønskede cancer. Hvis kræften, der modelleres har en kendt mutation i en stor procentdel af patienter kan det være ønskeligt at indbefatte denne mutation i starten. Eksempler på disse "disponerende" mutationer omfatter aktiverede Kras, dominerende negative TP53 eller en floxet PTEN allel. Ved at tilføje i en disponerende mutation modellen kan bedre repræsentere human cancer (se 1.3). Flere Sleeping Beauty transposasen og transposonsekvenser mus er tilgængelige fra National Cancer Institute Mouse Repository ( http://mouse.ncifcrf.gov/ ).
  2. Race betingede transposase mus med mus, der huser de transposoner i sidste ende opnå mus homozygote for begge alleler hvis det er muligt. Racen homozygot afkom til mus, der udtrykker Cre-rekombinase at generere dine triple transgene eksperimentelle mus (figur 2). Bemærk: Opnåelse af homozygote mus er ikke altid muligt eller ideal. For eksempel er homozygote p53 dominerende negative mus meget vanskeligere at opdrætte end heterozygote mus. Endvidere er det nyttigt at sikre sig, at kuld følger Mendelsk genetik at bekræfte, at avlen ordningen er vellykket.
  3. Hvis du bruger en prædisponeret baggrund. Første race mus med transposasen til mus med prædisponerende allelen Samtidig race mus, der udtrykker Cre-rekombinase til mus, der bærer transposoner. Skaber homozygote mus for hver allel, hvis muligt. Endelig avle den homozygot afkom fra de foregående to avlsprogrammer at generere firdoble transgen eksperimentel animals.
  4. Foruden de forsøgsdyr, generere kontrol kuld af mus. Kontrolgruppen består normalt af kuld fra den eksperimentelle opdræt, der kun arver to af de tre alleler (Figur 2). I tilfælde af en disponeret baggrund, vil mus herunder tre ud af de fire alleler også være nødvendigt.
  5. Overvåge eksperimentelle og kontrol musene dagligt for tumorudvikling og / eller moribundity. Følg din institutionel dyrepleje og brug Udvalg (IACUC) krav til dyrehold. Det er også typisk at bestemme en alder, hvor du vil ofre et dyr, hvis den endnu ikke er blevet døende. Atten måneder er en typisk alder, hvor mus aflivet.

2. Obduktion af transgene dyr

Navn på reagenset Firma Katalognummer
Sure-Seal induktivtion Chamber Brain Tree Scientific EZ-177
Cryovialet Bioexpress C-3355-2
10% pufret formalin Sigma Aldrich HT501128-4L

Tabel 1. Reagenser påkrævet.

  1. Når en mus er døende eller har nået enden af det bestemt levetid, aflive dyret under anvendelse af en CO2 kammeret efter dine IACUC retningslinjer. Generelt dyret i en ren gaskammer, åbne gas tank og justere regulatoren at læse ikke er højere end 5 pounds per square inch. Fyld langsomt for at minimere nasal og okular irritation og aversion mod CO2. Sørg for, at dyrets hjerte ikke længere slå og reagerer ikke, når rørt i øjet.
  2. Spray udvendigt aflivet mus med 70% ethanol.
  3. Placer musen på en obduktion bord og fastgør med dissekere stifter. Brug saks end pincet til at åbne musen og fjerner organer. Afgøre, hvilke organer bør indsamles, er projektet afhængig. Imidlertid anbefales altid at indsamle milt og lever som disse organer giver ofte vigtig indsigt i, hvorfor musen var moribund. Også indsamle brystbenet for den potentielle analyse af knoglemarv. Desuden er det altid fordelagtigt at indsamle organ eller væv, der forekommer unormalt.
  4. Væv og tumorer, der indsamles skulle opdeles i fire sektioner. Én sektion er fikseret i 10% pufret formalin i 18 timer efterfulgt af 70% ethanol. Dette afsnit kan anvendes til H & E-farvning og / eller IHC. De resterende tre sektioner, der generelt er 50 til 100 mg i størrelse, er lynfrosset i flydende nitrogen. Disse kan anvendes til DNA, RNA og protein isolation.
  5. Bortskaf karkassen og den resterende væv i henhold til IACUC retningslinjer.

3. Isolering Genomisk DNA fra tumorer

<strong> Navn på reagenset Firma Katalognummer
Protein Precipitation opløsning Qiagen 158.910
Cellelyse-puffer Qiagen 158.906
Proteinase K Qiagen 158.920
RNase A Qiagen 158.924
TE Buffer Promega V6232

Tabel 2. Reagenser påkrævet.

  1. Fint hakke den frosne tumorprøven (50-100 mg) under anvendelse af en rent barberblad.
  2. Sted hakket væv i et 1,5 ml mikrocentrifugerør, og der tilsættes 1 ml af cellelyse-buffer indeholdende 5 pi proteinase K opløsning (20 mg / ml).
  3. Vortex grundigt.
  4. Inkuber i en 55 ° C rysteapparat indstillet til 250 omdrejninger i mindst 4 timer, fortrinsvis natten over.
  5. Tilsæt 1 pi RNase En opløsning (10 mg / ml) og vend rør 25 gange.
  6. Inkuber ved 37 ° C i 30 minutter.
  7. Afkøles til stuetemperatur ved at placere på is i 3 min.
  8. Tilføj 333 ul Protein Nedbør løsning og vortex kraftigt.
  9. Centrifuger ved 14.000 rpm 10 min. Proteiner bør pellet. Hvis pellet er meget lille, vortex igen, inkuberes på is i 5 minutter, og derefter re-centrifuge.
  10. Hæld supernatanten indeholdende DNA til et rent 15 ml centrifugerør.
  11. Tilsættes samme rumfang 100% isopropanol, og der blandes ved forsigtigt at vende 50 gange.
  12. Der centrifugeres ved 3.500 rpm i 3 minutter.
  13. Supernatanten kasseres.
  14. Der tilsættes 1 ml 70% ethanol og vend rør adskillige gange for at vaske pelleten.
  15. Overfør den vaskede pellet sammen med ethanol til et 1,5 ml mikrocentrifugerør.
  16. Centrifuger ved 14.000 rpm i 5 minutter ved 4 ° C.
  17. Hæld ethanol og vendes røret lufttørre (ca. 5-30 minutter).
  18. Resuspender DNA pellet i 50 til 500 pi TE afhængigt af størrelsen af ​​DNA-pelleten.
  19. Valgfri inkubering ved 37 ° C for at resuspendere DNA.
  20. Opbevares ved 4 ° C eller -20 ° C til langtidsopbevaring.

4. Linker Mediated-PCR under anvendelse af genomisk DNA fra tumorer

Navn på reagenset Firma Katalognummer
BfaI New England Biolabs R0568S
NlaIII New England Biolabs R0125S
MinElute plader med 96 brønde Qiagen 28.051
QIAvac 96 vakuummanifold Qiagen 19.504
Multi-Microplate Genie, 120V Scientific Industries, Inc. SI-4000
T4 DNA-ligase med 5x ligeringsbuffer Invitrogen 15224-041
BamHI New England Biolabs R0136S
25 mM dNTP'er Bioexpress C-5014-200
Platinum Taq Invitrogen 10966-034
FastStart Taq DNA Polymerase Roche 12032929001
Agarose Promega V3121
TAE buffer Promega V4271
TE Buffer Promega V6232
Ethidiumbromid Promega H5041

Tabel 3. Reagenser påkrævet.

Linkersekvenser

BfaI linker + 5 'GTAATACGACTCACTATAGGGCTCCGCTTAAGGGAC 3'

BfaI linker-5 'Phos-TAGTCCCTTAAGCGGAG 3'NH2

"> NlaIII linker + 5'GTAATACGACTCACTATAGGGCTCCGCTTAAGGGACCATG 3'

NlaIII linker-5 'Phos-GTCCCTTAAGCGGAGCC 3'

Primersekvenser

Primær PCR frem på højre side (NlaIII): Spl IRDR R1 1 GCTTGTGGAAGGCTACTCGAAATGTTTGACCC

Primær PCR fremad venstre side (BfaI): Spl IRDR L1 1 CTGGAATTTTCCAAGCTGTTTAAAGGCACAGTCAAC

Primær PCR omvendt for både højre og venstre side: Spl Link1 1 GTAATACGACTCACTATAGGGC

Sekundære PCR frem højre side: Eksempel på Illumina barcoded sekundær primer 5'AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTNNNNNNNNNNNNaGgtgtatgtaaacttccgacttcaa (N s repræsenterer 12 bp stregkode, sekvensen med store bogstaver er nødvendige for Illumina platform, og sekvensen med små bogstaver vil binde til transposonet.)

Sekundær PCR fremad venstre side: Eksempel på en Illumina stregkodede seconDary primer 5'AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTNNNNNNNNNNNNaAgtgtatgtaaacttccgacttcaa (N s repræsenterer 12 bp stregkode, sekvensen med store bogstaver er nødvendige for Illumina platform, og sekvensen med små bogstaver vil binde til transposonet.)

Sekundær PCR omvendt for både højre og venstre side: linker nestede reverse primer 5 'CAAGCAGAAGACGGCATACGAGCTCTTCCGATCTAGGGCTCCGCTTAAGGGAC

  1. Anneale + og - linkere til både BfaI linkere og NlaII linkere ved at blande 50 pi af linker + (100 uM) med 50 ul linker-(100 uM), og der tilsættes 2 pi NaCl (5 M) i et 1,5 ml mikrocentrifugerør. Sted i 95 ° C varmeblok i 5 min. Slukke varmeblok og lad afkøles langsomt til stuetemperatur (det tager en time eller mere). Efter afkøling kan annealede linkere opbevares i en -20 ° C fryser indtil brug.
  2. Tilberedes to alikvoter af tumor-DNA, hver alikvot indeholdende 1 pg DNA. En alikvot vil blive fordøjet witha restriktionsenzym, der skærer tæt på den "rigtige" ende af transposonet. Den anden portion vil blive fordøjet med et restriktionsenzym, der skærer tæt til "venstre" ende af transposonet. Dette gøres for at maksimere chancerne for amplifikation hvert transposon insertion site.
  3. Fordøje det tumor-DNA i en portion med "rigtige" side enzym NlaII, og fordøje den tumor-DNA i den anden portion med "venstre" side enzym BfaI: kombinere 1 ml af enzym, 5 pi 10x NEB Buffer # 4, DNA ( 1 ug) og ddH 2 O til et samlet volumen på 50 ul. Digest DNA natten over ved 37 ° C i vandbad eller inkubator.
  4. Varme inaktivere enzymer (BfaI = 80 ° C i 20 minutter, NlaIII = 65 ° C i 20 minutter).
  5. Rens fordøjede prøver ved at placere prøver i MinElute plade med 96 brønde, den anbringes i vakuummanifold og vakuum i omkring 15 min, indtil brønde se tørt.
  6. Fjern pladen fra vakuummanifold og blot bunden af ​​pladen med 96 brønde med papirserviet for at fjerne alle Liquid
  7. Tilsæt 30 gl ddH 2 O til hver brønd og rystes på et rysteapparat indstillet på høj i 2 minutter, eller pipetteres op og ned 20 til 40 gange.
  8. Overfør hele mængden i brønde (30 gl) fra MinElute plade med 96 brønde i rene 96-brønds plader.
  9. Udføre linker ligeringsreaktioner med fordøjet DNA fra trin 4.8 og linkere fra trin 4.1. Bland 10 gl fordøjet DNA, 4 pi 5x ligeringsbuffer, 5,5 ul annealede linkere (950 pg / pl), 0,5 ul T4 ligase (5 U / pl).
  10. Der inkuberes i 4 timer til natten over ved 16 ° C.
  11. Varme inaktivering af T4 DNA-ligase ved 65 ° C i 10 minutter.
  12. Rense ligering med MinElute plader med 96 brønde og en vakuummanifold som beskrevet i trin fra 4,5 til 4,6.
  13. Resuspender i 30 ul H2O og overføres til en ren plade med 96 brønde.
  14. Udføre en anden DNA-fordøjelse for at destruere resterende concatamer transposoner. Dette opnås ved at skære DNA'et endnu en gang ved hjælp af et enzym, som skærer plasmidet vEctor DNA, som blev anvendt til at skabe transgene mus indeholdende transposonet concatamer.
  15. Digest DNA under anvendelse af BamHI (både venstre og højre side): Mix 25 ul linker-ligerede DNA fra trin 4,13, 5 ul 10 x NEB buffer nr. 3, 0,5 pi BamHI (20 U / pl), 0,5 pi BSA (10 mg / ml ), og 19 pi ddH 2 O.
  16. Digest 3-6 timer eller natten over ved 37 ° C.
  17. Udføre primære PCR under anvendelse af en primer specifik for transposonet og en primer specifik for linkeren. Disse vil variere afhængigt af hvilke transposonet og linker du bruger. Primerne er anført i primeren tabellen ovenfor arbejde for T2/Onc og T2/Onc2 transposoner.
  18. Primær PCR: 5 pi 10 x puffer, 2,0 pi MgCI2 (50 mM), 4 ul dNTP'er (2,5 nM), 1 pi Primer 1 (20 pM), 1 pi Primer 2 (20 pM), 0,25 pi Platinum Taq (5 U / pi), 3 pi Fordøjet DNA med linkere (mængde kan variere), op til 50 ul ddH 2 O.
  19. PCR program: 94 ° C i 5 minutter, 30 cykler ved 94 ° C i 30 sek, 60 & df. eks C i 30 sek, 72 ° C i 90 sek. Endelig forlængelse ved 72 ° C i 5 min.
  20. Rense PCR-produkt med MinElute plader med 96 brønde og en vakuummanifold som beskrevet ovenfor.
  21. Resuspender i 30 ul H2O og overføres til en ren plade med 96 brønde.
  22. Lav en 1:75 fortynding af 1 ° PCR ved at fortynde 2 pl DNA fra trin 4,21 til 148 pi ddH 2 O
  23. Udføre sekundær PCR under anvendelse af indlejrede versioner af primerne, der også har den ønskede sekvens for Illumina GAIIx maskinen samt en 12 basepar stregkode, der er entydig for hver tumorprøve behandles (se primer ovenstående tabel for eksempler på disse primere).
  24. Sekundære PCR: 10 pi 10X buffer med MgCI2, 8 pi dNTPs (2,5 mM), 1 pi Illumina stregkodede sekundær primer (20 uM), 1 pi Illumina Nest en sekundær primer (20 uM), 0,25 ul FastStart Taq (5 U / | ), 2 pi DNA fra primære PCR fortyndede 1:75, op til 100 pi ddH 2 O.
  25. PCR Program: 94 °; C i 2 min, 30 cyklusser af 94 ° C i 30 sek, 53 ° C for 45 sec, 72 ° C i 90 sek. Endelig forlængelse ved 72 ° C i 5 min.
  26. Kør 45 pi af denne PCR-reaktion på en 1% agarosegel indeholdende ethidiumbromid (0,5 ug / ml). Der bør være et "smear" af PCR-produkter, der repræsenterer amplikoner af de mange forskellige transposon-insertioner i tumoren (Figur 3).
  27. Rense resterende 50 ul PCR-produkt under anvendelse MinElute plader med 96 brønde og en vakuummanifold som beskrevet ovenfor. Vask en gang ved at placere 50 ul ddH 2 O i brøndene og støvsugning igen.
  28. Resuspender i 30 ul TE og overføres til en ren plade med 96 brønde.
  29. Bestemme koncentrationen af ​​DNA i hver prøve. Kombiner lige store mængder af DNA i en enkelt 1,5 ml mikrofugerør. Dette vil være bibliotek, som er sekventeret i en enkelt bane af et Illumina HiSeq 2000-maskine. Det er muligt at sekventere flere hundrede tumorer i en enkelt bane af et Illumina løb.
  30. Indsenddet indre rør indeholdende lige store mængder DNA fra alle tumorer til sekventering. Dette kan gøres ved din institution eller kommercielt.

5. Analyse af transposon indsættelser

  1. Software til analyse af transposon indsættelse data er tilgængelig til gratis download via SourceForge ( http://sourceforge.net/projects/tapdancebio/ ). Programmet, kaldet TapDance kræver sekvensen fil fra Illumina platform og en stregkode til bibliotek kort tekstfil.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Efter avl ordningen er blevet etableret, skal avlere producerer et kuld hver 19-21 dage. Kuldstørrelse vil variere mellem 5 og 12 unger, afhængigt af alder opdrættere og den genetiske baggrund. Hertil kommer, sørge for, at genotypen af ​​kuldet følger Mendelsk genetik som en måde at bekræfte, at den ynglende ordningen er både korrekt og vellykket.

For at eksperimentet kan blive en succes, bør tumorforekomst i forsøgsdyrene være væsentligt større end tumorforekomst i kontroldyrene. Hvis der ikke "prædisponerende" mutation blev inkluderet i forsøget bør der være få eller ingen tumorer i kontroldyrene. Hvis et "prædisponerende" mutation blev inkluderet i forsøget, bør tumorforekomst i disse dyr er meget lavere end forekomsten hos dyr med mutationen og SB-aktivitet.

LM-PCR skulle amplificere hundredvis af transposon-insertioner i en enkelt tumor. Efter at have kørt haHvis den sekundære PCR-produktet på en 1% gel, bør der være en "smear" af DNA repræsenterer denne amplifikation (figur 3). Hvis der kun er en eller to bands, var enten SB ikke aktiv i tumor eller en fejl i protokollen (Figur 4).

Sekventering 1-200 tumorer i en enkelt bane af Illumina GAIIx platformen skal producere mere end 30 millioner sekvenser af 100 bp hver (figur 5).

Tabel 1. Reagenser kræves for sektion 2.

Tabel 2. Reagenser kræves for afsnit 3.

Tabel 3. Reagenser kræves for afsnit 4.

Figur 1
Figur 1. Rutediagram, der viser trineneat foretage en fremad genetisk skærmen ved hjælp af Torneroses systemet. først en musemodel genereret. Mus derefter obduceres, døende og tumorer opsamles og isoleret. Tumor-DNA oprenses og linker-medieret-PCR udført. Endelig forstærkes tumor-DNA med transposon-insertioner sekventeret og fælles indsættelse sites identificeret.

Figur 2
Figur 2. Avl ordning til at generere eksperimentelle kohorte. Mus indeholder transposasen (Rosa26-LSL-SB11) krydses til mus huser concatamer af transposoner (T2-Onc). Afkommet skal derefter parret med mus, der bærer den udpegede vævsspecifik promotor drevet Cre-rekombinase (Cre).

Figur 3
Figur 3. RepræsentantResultaterne af sekundær PCR. Det forventede produkt har en smear udseende området fra 100 til 600 basepar.

Figur 4
Figur 4. Hvis LM-PCR er mislykket, vil der være et fravær af "smear" af DNA. I stedet vil du se en endelig DNA-bånd.

Figur 5
Figur 5. Eksempel data fra en sekventering løb, der viser en enkelt bane af Illumina GAIIx platform skal producere over 30 millioner sekvenser af 100 basepar hver.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

En forreste genetisk skærmen ved hjælp af Tornerose transposon system giver en fremgangsmåde til identifikation af mutationer, der forårsager cancer. Ved at vælge passende promotor til at styre Cre-rekombinase ud over de prædisponerende mutationer vil SB skærmen identificerer kendte og hidtil ukendte kandidat kræftgener.

Succesen af ​​en SB skærmen er meget afhængig af de mus udvalgt til at skabe skærmen. For transposon, anbefaler vi at bruge to forskellige musestammer bærer concatamer af onkogene transposoner på forskellige kromosomer 7. Omhyggelig tanke skal bruges, når du vælger den vævsspecifikke Cre rekombinase, der vil aktivere SB transposasen. Det skal kunne påvises, at Cre enzym er aktivt i celletypen, der mistænkes for at være cellen stammer fra cancer, der modelleres. Vellykkede eksempler omfatter villin-Cre (GI-kanalen kræft), Albumin-Cre (hepatocellulært carcinoma), og Aid-Cre (lymfom). 8-10

Antallet af mus, der kræves for en vellykket skærm vil afhænge af den tumor penetrans. Generelt vil flere tumorer og flere mus resulterer i en mere robust skærm. At detektere en 2-fold forskel i cancer latenstid der bør være mindst 60 dyr i både kontrol-og forsøgsgrupper. 11

Den alsidige karakter af disse skærme er stærk i forhold til andre teknikker, at man kan angive arten af ​​sygdommen, følge udviklingen, og analysere den genetiske sammensætning. Denne teknik har været en succes i en række skærme, der har udløst SNG lister, der identificerer nye potentielle cancer kørsel gener. Med denne information kan rettede undersøgelser udføres for at forstå funktionen af ​​disse hidtil ukendte mutationer. Samlet set kan anvendelsen af ​​denne teknik føre til en eventuel design af nye lægemidler rettet terapier for at eliminere resultaterne af disse specifikke genetiske mutationer.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Forfatterne har intet at afsløre.

Acknowledgments

Forfatterne vil gerne takke Branden Moriarity, David Largaespada, og Vincent Keng ved University of Minnesota, og Adam Dupuy ved University of Iowa for deres assistance i udviklingen af ​​protokollen beskrevet ovenfor.

Materials

Name Company Catalog Number Comments
Sure-Seal Induction Chamber Brain Tree Scientific EZ-177
Cryovial Bioexpress C-3355-2
10% Buffered Formalin Sigma Aldrich HT501128-4L
Protein Precipitation solution Qiagen 158910
Cell lysis buffer Qiagen 158906
Proteinase K Qiagen 158920
RNase A Qiagen 158924
TE Buffer Promega V6232
BfaI New England Biolabs R0568S
NlaIII New England Biolabs R0125S
MinElute 96 well plates Qiagen 28051
QIAvac 96 Vacuum manifold Qiagen 19504
Multi-MicroPlate Genie, 120V Scientific Industries, Inc. SI-4000
T4 DNA ligase with 5x ligation Buffer Invitrogen 15224-041
BamHI New England Biolabs R0136S
25mM dNTPs Bioexpress C-5014-200
Platinum Taq Invitrogen 10966-034
FastStart Taq DNA Polymerase Roche 12032929001
Agarose Promega V3121
TAE Buffer Promega V4271
TE Buffer Promega V6232
Ethidium bromide Promega H5041

DOWNLOAD MATERIALS LIST

References

  1. Fearon, E. R., Vogelstein, B., et al. A genetic model for colorectal tumorigenesis. Cell. 61, 759-767 (1990).
  2. Wood, L. D., et al. The Genomic Landscapes of Human Breast and Colorectal Cancers. Science. 318, 1108-1113 (2007).
  3. Ivics, Z., Hackett, P. B., Plasterk, R. H., Izsvák, Z. Molecular Reconstruction of Sleeping Beauty, a Tc1-like Transposon from Fish, and Its Transposition in Human Cells. Cell. 91, 501-510 (1997).
  4. Starr, T. K., Largaespada, D. A. Cancer gene discovery using the Sleeping Beauty transposon. Cell Cycle. 4, 1744-1748 (2005).
  5. Mueller, P. R., Wold, B. In Vivo Footprinting of a Muscle Specific Enhancer by Ligation Mediated PCR. Science. 246, 780-786 (1989).
  6. Bergemann, T. L., et al. New methods for finding common insertion sites and co-occurring common insertion sites in transposon- and virus-based genetic screens. Nucleic acids research. 40, 3822-3833 (2012).
  7. Copeland, N. G., Jenkins, N. A. Harnessing transposons for cancer gene discovery. Nature Reviews Cancer. 10, 696-706 (2010).
  8. Collier, L. S., Carlson, C. M., Ravimohan, S., Dupuy, A. J., Largaespada, D. A. Cancer gene discovery in solid tumours using transposon-based somatic mutagenesis in the mouse. Nature. 436, 272-276 (2005).
  9. Starr, T. K., et al. A transposon-based genetic screen in mice identifies genes altered in colorectal cancer. Science. 323, 1747-1750 (2009).
  10. Keng, V. W., et al. A conditional transposon-based insertional mutagenesis screen for genes associated with mouse hepatocellular carcinoma. Nature. 27, 264-274 (2009).
  11. Dupuy, A. J., Akagi, K., Largaespada, D. A., Copeland, N. G., Jenkins, N. A. Mammalian mutagenesis using a highly mobile somatic Sleeping Beauty transposon system. Nature. 436, 221-226 (2005).
Identifikation af<em&gt; Tornerose</em&gt; Transposon Insertioner i solide tumorer med Linker-medieret PCR
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Janik, C. L., Starr, T. K. Identification of Sleeping Beauty Transposon Insertions in Solid Tumors using Linker-mediated PCR. J. Vis. Exp. (72), e50156, doi:10.3791/50156 (2013).More

Janik, C. L., Starr, T. K. Identification of Sleeping Beauty Transposon Insertions in Solid Tumors using Linker-mediated PCR. J. Vis. Exp. (72), e50156, doi:10.3791/50156 (2013).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter