Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Medicine

Identification des doi: 10.3791/50156 Published: February 1, 2013

Summary

Procédé d'identification de la cancérogenèse conducteurs inconnus en utilisant une approche impartiale est décrit. La méthode utilise l'

Abstract

Génomiques, les analyses protéomiques, transcriptomiques, et épigénomiques de tumeurs humaines indiquent qu'il ya des milliers d'anomalies au sein de chaque génome du cancer par rapport aux tissus normaux appariés. Sur la base de ces analyses, il est évident qu'il ya beaucoup d'inconnues pilotes génétiques du cancer 1. Malheureusement, ces pilotes sont cachés dans un plus grand nombre d'anomalies particulières dans le génome qui ne contribuent pas directement à la formation de tumeurs. Un autre aspect du génome du cancer, c'est qu'il ya grande hétérogénéité génétique au sein des mêmes types de tumeurs. Chaque tumeur peut héberger des mutations différentes qui offrent un avantage sélectif pour la formation de tumeurs 2. Exécution d'une impartiale écran vers l'avant génétique chez la souris fournit les outils pour générer des tumeurs et d'analyser leur composition génétique, tout en réduisant le contexte de mutations particulières. La Belle au bois dormant (SB) transposon système est une de ces méthodes 3. Le système utilise SB portable vecteurs (transposons) qui peuvent être insérés dans le génome par l'enzyme transposase. Mutations sont limités à un type de cellule spécifique grâce à l'utilisation d'un allèle conditionnel transposase qui est activé par la recombinase Cre. Il existe de nombreuses lignées de souris qui expriment la recombinase Cre dans des tissus spécifiques. En croisant l'une de ces lignes à l'allèle transposase conditionnelle (par exemple Lox-stop-Lox-SB11), le système ASR est activé uniquement dans les cellules qui expriment la recombinase Cre. La recombinase Cre sera une cassette d'accise arrêt qui bloque l'expression de l'allèle transposase, activant ainsi mutagenèse par transposon dans le type de cellule désignée. Un écran SB est initiée par l'élevage de trois souches de souris transgéniques afin que les souris expérimentales porteurs d'un allèle conditionnel transposase, un concatémère de transposons, et un allèle spécifique du tissu recombinase Cre. Ces souris sont autorisés à l'âge jusqu'à la formation de tumeurs et ils deviennent moribonds. Les souris sont ensuiteADN autopsiés et génomique est isolé à partir des tumeurs. Ensuite, l'ADN génomique est soumis à une liaison médiée par PCR (LM-PCR) qui entraîne une amplification du locus génomiques contenant un transposon SB. LM-PCR réalisée sur une seule tumeur se traduira par des centaines de amplicons distincts représentant les centaines de loci génomiques contenant insertions de transposons dans un 4 seule tumeur. Les insertions de transposons dans toutes les tumeurs sont analysées et sites d'insertion communs (Ciss) sont identifiés à l'aide d'une méthode statistique appropriée 5. Gènes au sein de la CEI sont très susceptibles d'être des oncogènes ou des gènes suppresseurs de tumeurs, et sont considérés comme les gènes du cancer candidats. Les avantages de l'utilisation du système SB pour identifier les gènes responsables du cancer candidats sont les suivants: 1) le transposon peut être facilement localisé dans le génome parce que sa séquence est connue, 2) la transposition peuvent être adressées à presque n'importe quel type de cellule et 3) le transposon est capable de introduire à la fois le gain et la perte-de-fonction-6 mutations. Le following protocole décrit comment concevoir et d'exécuter un écran vers l'avant génétique à l'aide du système SB transposon pour identifier les gènes responsables du cancer candidats (Figure 1).

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. L'élevage et le vieillissement des animaux transgéniques

  1. Sélectionnez les souches de souris transgéniques appropriés pour votre expérience. Une expérience typique utilisera trois lignées transgéniques; une souris transposase conditionnelle, une souris hébergeant un concatémère de transposons, et une souris exprimant la recombinase Cre dans les cellules considérées comme les cellules d'origine pour le cancer désiré. Si le cancer est modélisé a une mutation connue dans un grand pourcentage des patients, il peut être souhaitable d'inclure cette mutation au début. Des exemples de ces «prédisposants» comprennent des mutations Kras activés, TP53 dominantes négatives ou un allèle Pten floxé. En ajoutant une mutation prédisposant le modèle peut mieux représenter le cancer chez l'homme (voir 1.3). Plusieurs transposase Sleeping Beauty et souris transposons sont disponibles auprès de l'Institut national du cancer du référentiel de la souris ( http://mouse.ncifcrf.gov/ ).
  2. Souris Race transposase conditionnelles avec des souris hébergeant les transposons pour finalement obtenir des souris homozygotes pour les deux allèles si possible. Race descendance homozygote chez la souris exprimant la recombinase Cre pour générer vos triples souris transgéniques expérimentales (Figure 2). Remarque: Pour obtenir des souris homozygotes sont pas toujours possibles ou idéal. Par exemple, homozygotes p53 dominantes souris négatifs sont beaucoup plus difficiles à élever que les souris hétérozygotes. En outre, il est utile de veiller à ce que les portées suivre la génétique mendélienne pour confirmer que le schéma de sélection est réussie.
  3. Si vous utilisez un prédisposait, les souris se reproduisent abord avec la transposase à des souris avec l'allèle prédisposant. Dans le même temps, les souris exprimant la recombinase Cre race à des souris portant les transposons. Créer des souris homozygotes pour chaque allèle si possible. Enfin, élever la descendance homozygote des deux précédents programmes de sélection afin de générer quadruple anim transgénique expérimentaleals.
  4. En plus des animaux de laboratoire, de générer des cohortes de contrôle de la souris. Le groupe témoin se compose normalement de même portée de l'élevage expérimental qui héritent seulement deux des trois allèles (figure 2). Dans le cas d'un prédisposait, les souris, y compris trois des quatre allèles sera également nécessaire.
  5. Surveiller les souris expérimentales et le contrôle quotidiens pour le développement de la tumeur et / ou un état moribond. Suivez votre soins aux animaux et utilisation comité (IACUC) les exigences pour l'élevage. En outre, il est courant de déterminer un âge dans lequel vous allez sacrifier un animal si elle n'est pas encore devenue moribonde. Dix-huit mois est un âge typique à laquelle les souris sont euthanasiées.

2. L'autopsie des animaux transgéniques

Nom du réactif Entreprise Numéro de catalogue
Sure-Seal InducChambre tion Arbre Scientific Brain EZ-177
Cryovial Bioexpress C-3355-2
10% tamponnée de formaldéhyde Sigma Aldrich HT501128-4L

Réactifs Tableau 1. Nécessaire.

  1. Lorsqu'une souris est moribond ou a atteint la fin de la durée de vie déterminée, euthanasier des animaux en utilisant une chambre de CO 2 suivant vos directives IACUC. En général, placer l'animal dans une chambre à gaz propre, ouvrir le réservoir de gaz et régler le régulateur de lire pas plus de 5 livres par pouce carré. Remplissez lentement pour minimiser l'irritation nasale et oculaire et l'aversion pour le CO 2. Assurez-vous que le cœur de l'animal est ne bat plus et ne répond pas quand on les touche dans les yeux.
  2. Extérieur pulvérisation de souris sacrifiées à l'éthanol 70%.
  3. Placer la souris sur une planche à l'autopsie et sécuriser avec des épingles à dissection. Utilisez des ciseaux uned une pince pour ouvrir la souris et le prélèvement d'organes. Déterminer quels sont les organes doivent être prélevés est un projet dépend. Toutefois, il est recommandé de toujours recueillir la rate et le foie que ces organes donnent souvent des indications importantes sur lesquelles la souris était moribond. Également recueillir le sternum de l'analyse du potentiel de moelle osseuse. En outre, il est toujours bénéfique pour collecter n'importe quel organe ou tissu qui semble anormale.
  4. Les tissus et les tumeurs qui sont collectées devraient être divisé en quatre sections. Une section est fixé à 10% du formol tamponné pendant 18 heures suivie d'éthanol à 70%. Cette section peut être utilisée pour la coloration H & E et / ou IHC. Les trois dernières sections, qui sont généralement de 50 à 100 mg de taille, pression sont congelés dans l'azote liquide. Ceux-ci peuvent être utilisés pour l'ADN, de l'ARN et de l'isolement des protéines.
  5. Jetez les mouchoirs carcasse restante et selon les directives du IACUC.

3. Isolement de l'ADN génomique de tumeurs

<Nom strong> du réactif Entreprise Numéro de catalogue
Solution de précipitation des protéines Qiagen 158910
Tampon de lyse cellulaire Qiagen 158906
Protéinase K Qiagen 158920
RNase A Qiagen 158924
TE Buffer Promega V6232

Réactifs Tableau 2. Nécessaire.

  1. Hacher finement l'échantillon de tumeur congelée (50 à 100 mg) en utilisant une lame de rasoir propre.
  2. Lieu hachée tissu dans un tube de 1,5 ml et ajouter 1 ml de tampon de lyse cellulaire contenant 5 pi protéinase K solution (20 mg / ml).
  3. Vortex fond.
  4. Incuber dans un shaker 55 ° C fixé à 250 tours par minute pendant au moins 4 heures, de préférence pendant la nuit.
  5. Ajouter 1 RNase Une solution (10 mg / ml) et inverser tubes 25 fois.
  6. Incuber à 37 ° C pendant 30 min.
  7. Laisser refroidir à température ambiante en plaçant sur de la glace pendant 3 min.
  8. Ajouter 333 ul de solution de précipitation des protéines et homogénéiser vigoureusement au vortex.
  9. Centrifuger à 14000 rpm 10 min. Les protéines doivent granulés. Si pellet est très faible, vortex encore, incuber sur de la glace pendant 5 min, puis re-centrifugeuse.
  10. Décanter le surnageant contenant l'ADN dans un récipient propre tube de 15 ml centrifugeuse.
  11. Ajouter un volume égal à 100% d'isopropanol et mélanger doucement par inversion 50 fois.
  12. Centrifuger à 3500 rpm pendant 3 min.
  13. Rejeter le surnageant.
  14. Ajouter 1 ml d'éthanol à 70% et inverser tube à plusieurs reprises à laver le culot.
  15. Transférer le culot lavé avec de l'éthanol à un tube de 1,5 ml.
  16. Centrifuger à 14000 rpm pendant 5 min à 4 ° C.
  17. Verser l'éthanol et inverser le tube à air sec (environ 5 à 30 minutes).
  18. Resuspendre l'ADN pEllet dans 50 à 500 ul de TE en fonction de la taille du culot d'ADN.
  19. D'incubation en option à 37 ° C pour remettre en suspension l'ADN.
  20. Conserver à 4 ° C ou -20 ° C pour le stockage à long terme.

4. Linker médiation-PCR utilisant l'ADN génomique à partir de tumeurs

Nom du réactif Entreprise Numéro de catalogue
Bfai New England Biolabs R0568S
NlalII New England Biolabs R0125S
MinElute plaques de 96 puits Qiagen 28051
QIAvac collecteur sous vide 96 Qiagen 19504
Multi-MicroPlate Genie, 120V Scientific Industries, Inc SI-4000
ADN ligase T4 avec du tampon de ligation 5x Invitrogen 15224-041
BamHI New England Biolabs R0136S
25 mM de dNTP Bioexpress C-5014-200
Taq Platinum Invitrogen 10966-034
FastStart polymérase Taq ADN Roche 12032929001
Agarose Promega V3121
TAE Buffer Promega V4271
TE Buffer Promega V6232
Le bromure d'éthidium Promega H5041

Réactifs Tableau 3. Nécessaire.

Séquences de liaison

Bfai linker + 5 'GTAATACGACTCACTATAGGGCTCCGCTTAAGGGAC 3'

Bfai linker-5 'Phos-TAGTCCCTTAAGCGGAG 3'NH2

"> Linker NlalII + 5'GTAATACGACTCACTATAGGGCTCCGCTTAAGGGACCATG 3 '

NlalII linker-5 'Phos-GTCCCTTAAGCGGAGCC 3'

Les séquences des amorces

PCR primaire avant droite (NlalII): Spl IRDR R1 1 GCTTGTGGAAGGCTACTCGAAATGTTTGACCC

PCR primaire avant côté gauche (bfai): Spl IRDR L1 1 CTGGAATTTTCCAAGCTGTTTAAAGGCACAGTCAAC

Primaire PCR inverse pour le côté droite et à gauche: Spl Link1 1 GTAATACGACTCACTATAGGGC

Côté secondaire PCR avant droite: Exemple d'une amorce secondaire Illumina code-barres 5 'AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTNNNNNNNNNNNNaGgtgtatgtaaacttccgacttcaa (les N représente le code à barres de 12 pb, la séquence en majuscules sont requises pour la plateforme Illumina, et la séquence en minuscules se lie à l'transposon.)

PCR secondaire avant côté gauche: Exemple d'une seconde Illumina code à barresapprêt dary 5'AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTNNNNNNNNNNNNaAgtgtatgtaaacttccgacttcaa (les N représentent le code à barres de 12 pb, la séquence en majuscules sont nécessaires pour la plate-forme Illumina, et la séquence en minuscules se lie à l'transposon.)

Secondaire PCR inverse pour le côté droite et à gauche: linker amorces emboîtées inverse 5 'CAAGCAGAAGACGGCATACGAGCTCTTCCGATCTAGGGCTCCGCTTAAGGGAC

  1. Recuire le + et le - linkers pour linkers bfai deux linkers et NlaII en mélangeant 50 pi de linker + (100 uM) avec 50 ul de lieur-(100 M) et ajouter 2 pi de NaCl (5 M) dans un tube de 1,5 ml. Lieu à 95 ° C pour un autre 5 minutes. Éteignez bloc de chauffage et laisser refroidir lentement à température ambiante (cela prend une heure ou plus). Après refroidissement, linkers recuits peuvent être stockés dans un congélateur à -20 ° C jusqu'à ce que nécessaire.
  2. Préparer deux aliquotes de l'ADN tumoral, chaque aliquote contenant 1 ug d'ADN. Un aliquot sera digéré espritenzyme de restriction qui coupe ha à proximité de la "bonne" fin du transposon. La seconde partie aliquote sera digéré par une enzyme de restriction qui coupe à proximité de la "gauche" fin du transposon. Ceci est fait pour maximiser les chances de amplifiant chaque site d'insertion du transposon.
  3. Digérer l'ADN tumoral dans une partie aliquote en utilisant le "droit" NlaII enzyme côté, et de digérer l'ADN tumoral dans la partie aliquote autre en utilisant la "gauche" enzyme côté bfai: mélanger 1 ul d'enzyme, 5 pl de tampon NEB 10x n ° 4, l'ADN ( 1 pg) et ddH 2 O pour un volume total de 50 ul. Digest ADN nuit à 37 ° C au bain-marie ou un incubateur.
  4. Chauffer inactiver les enzymes (bfai = 80 ° C pendant 20 min, NlalII = 65 ° C pendant 20 minutes).
  5. Nettoyez les échantillons digérés en plaçant des échantillons dans MinElute plaque de 96 puits, plaque lieu dans le collecteur sous vide et le vide pendant environ 15 min jusqu'à ce que les puits air sec.
  6. Retirer la plaque du collecteur à vide et en bas blot de plaque de 96 puits avec une serviette en papier pour enlever tout liquidationd
  7. Ajouter 30 ul ddH 2 O dans chaque puits et agiter sur un ensemble agitateur orbital à température élevée pendant 2 min, ou pipeter le haut et le bas 20 à 40 fois.
  8. Transfert volume entier dans les puits (30 pi) de MinElute plaque de 96 puits dans des plaques 96 puits propre.
  9. Effectuer des réactions de ligature linker avec l'ADN digéré de l'étape 4.8 et linkers de l'étape 4.1. Mélanger 10 ul d'ADN digéré, 4 pi de tampon de ligature 5x, 5,5 pl linkers recuit (950 pg / pl), 0,5 ul de ligase T4 (5 U / pl).
  10. Incuber pendant 4 heures ou toute la nuit à 16 ° C.
  11. Une inactivation de l'ADN ligase T4 à 65 ° C pendant 10 min.
  12. Nettoyer ligature en utilisant MinElute plaques de 96 puits et un collecteur à vide comme décrit dans les étapes de 4,5 à 4,6.
  13. Remettre en suspension dans 30 ul de H 2 O et transférer dans un propre plaque de 96 puits.
  14. Effectuer une digestion de l'ADN seconde afin de détruire restant concatémère transposons. Ce résultat est obtenu en coupant l'ADN une deuxième fois avec une enzyme qui coupe le plasmide vADN ecteur qui a été utilisé pour créer des souris transgéniques contenant le transposon concatémère.
  15. Digest ADN en utilisant BamHI (côté gauche et droit): Mélanger 25 ul de lieur-ligaturé l'ADN de l'étape 4.13, 5 pl de tampon NEB 10x n ° 3, 0,5 pi BamHI (20 U / pl), 0,5 ul de BSA (10 mg / ml ), et 19 ul ddH 2 O.
  16. Digest 3-6 heures ou toute la nuit à 37 ° C.
  17. Effectuer primaire PCR en utilisant une amorce spécifique du transposon et une amorce spécifique de la liaison. Ceux-ci varient en fonction de ce transposon et l'éditeur de liens que vous utilisez. Les amorces énumérées dans le tableau ci-dessus apprêt de travail pour la T2/Onc et T2/Onc2 transposons.
  18. PCR primaire: 5 pi de tampon 10x, 2,0 ul de MgCl2 (50 mM), 4 pl dNTP (2,5 nM), 1 pl Primer 1 (20 uM), 1 pl Primer 2 (20 uM), 0,25 Platinum Taq ul (5 U / pl), 3 pl ADN digéré avec des linkers (le montant peut varier), jusqu'à 50 pi ddH 2 O.
  19. PCR programme: 94 ° C pendant 5 min, 30 cycles de 94 ° C pendant 30 sec, 60 & dpar exemple, C pendant 30 sec, 72 ° C pendant 90 sec. Extension finale à 72 ° C pendant 5 min.
  20. Nettoyer produit de PCR utilisant MinElute plaques de 96 puits et un collecteur à vide comme décrit ci-dessus.
  21. Remettre en suspension dans 30 ul de H 2 O et transférer dans un propre plaque de 96 puits.
  22. Faire une dilution 1:75 du 1 ° PCR en diluant 2 pl d'ADN de l'étape 4.21 dans 148 ul O ddH 2
  23. Effectuer secondaire PCR en utilisant des versions imbriquées des amorces qui ont également la séquence requise pour la machine Illumina GAIIx ainsi que d'un code à barres de base 12 paire qui est unique pour chaque échantillon de la tumeur traitée (voir le tableau ci-dessus apprêt pour des exemples de ces amorces).
  24. PCR secondaire: 10 ul de tampon 10x avec MgCl2, 8 pi de dNTP (2,5 mM), 1 pl Illumina code à barres amorce secondaire (20 uM), 1 pl Nest Illumina 1 couche secondaire (20 uM), 0,25 ul FastStart Taq (5 U / pl ), 2 pl de l'ADN 1:75 PCR primaires dilués jusqu'à 100 pi ddH 2 O.
  25. PCR programme: 94 °; C pendant 2 min, 30 cycles de 94 ° C pendant 30 s, 53 ° C pendant 45 sec, 72 ° C pour 90 sec. Extension finale à 72 ° C pendant 5 min.
  26. Exécuter 45 ul de cette réaction de PCR sur un gel d'agarose 1% contenant du bromure d'éthidium (0,5 pg / ml). Il devrait y avoir un «frottis» des produits de PCR représentant des amplicons de nombreuses insertions de transposons les différentes dans la tumeur (figure 3).
  27. Nettoyer restante de 50 ul du produit de PCR utilisant MinElute plaques de 96 puits et un collecteur à vide comme décrit ci-dessus. Laver une fois en plaçant 50 pl ddH 2 O dans les puits et aspirer à nouveau.
  28. Remettre en suspension dans 30 pl de TE et transférer dans un propre plaque de 96 puits.
  29. Déterminer la concentration d'ADN dans chaque échantillon. Mélanger des quantités égales d'ADN dans un seul tube de 1,5 ml de centrifugeuse. Ce sera la bibliothèque qui est séquencé en une seule voie d'une Illumina HiSeq 2000 de la machine. Il est possible de séquencer plusieurs centaines de tumeurs sur une seule voie d'une course d'Illumina.
  30. Soumettrele tube unique contenant des quantités égales de l'ADN à partir de toutes les tumeurs pour le séquençage. Cela peut être fait par votre institution ou dans le commerce.

5. Analyse des insertions de transposons

  1. Logiciel d'analyse de données insertion d'un transposon est disponible en téléchargement gratuit via SourceForge ( http://sourceforge.net/projects/tapdancebio/ ). Le programme, appelé claquettes, nécessite le fichier de séquence à partir de la plate-forme Illumina et un code à barres fichier de bibliothèque texte de la carte.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Après le schéma de sélection a été mis en place, les éleveurs doivent produire une portée tous les 19-21 jours. La taille des portées varie entre 5 et 12 chiots, en fonction de l'âge des éleveurs et l'arrière-plan génétique. En outre, assurez-vous que le génotype de la litière suit la génétique mendélienne comme un moyen de confirmer que le schéma de sélection est à la fois correcte et réussie.

Pour que l'expérience soit un succès, l'incidence des tumeurs chez les animaux de laboratoire devrait être nettement supérieure à l'incidence des tumeurs chez les animaux témoins. Si aucun "prédisposition" mutation a été inclus dans l'expérience il devrait y avoir peu ou pas de tumeurs chez les animaux témoins. Si une "prédisposition" mutation a été inclus dans l'expérience, l'incidence des tumeurs chez ces animaux devraient être beaucoup plus faible que l'incidence chez les animaux porteurs de la mutation et de l'activité SB.

LM-PCR devrait amplifier des centaines d'insertions de transposons dans une seule tumeur. Après avoir exécuté haSi le produit de PCR secondaire sur un gel à 1%, il devrait y avoir un «frottis» de l'ADN représente cette amplification (figure 3). S'il ya seulement un ou deux groupes, soit SB n'a pas été actif dans la tumeur ou une erreur a été faite dans le protocole (Figure 4).

Séquençage 1-200 tumeurs sur une seule voie de la plate-forme Illumina GAIIx devrait produire plus de 30 millions de séquences de 100 pb chacun (figure 5).

Réactifs Tableau 1. Nécessaire pour la section 2.

Réactifs Tableau 2. Requis pour la section 3.

Réactifs Tableau 3. Nécessaires à la section 4.

Figure 1
Figure 1. Organigramme montrant les étapesà réaliser un écran avant génétique en utilisant le système de Sleeping Beauty. Tout d'abord, un modèle de souris est généré. Les souris sont ensuite autopsiés moribonde et les tumeurs sont collectées et isolé. ADN tumoral est purifié et linker médiation-PCR réalisée. Enfin, l'ADN amplifié avec insertions de transposons tumeur est séquencé et sites d'insertion communs identifiés.

Figure 2
Figure 2. Le schéma de sélection de générer cohorte expérimentale. Souris contenant la transposase (Rosa26-LSL-SB11) sont croisés à des souris hébergeant le concatémère de transposons (T2-Onc). Les descendants sont ensuite accouplés à des souris portant le promoteur tissu spécifique désigné entraînée Cre recombinase (Cre).

Figure 3
Figure 3. Représentantrésultats de PCR secondaire Le produit attendu. a une apparence semblable à frottis allant de 100 à 600 paires de bases.

Figure 4
Figure 4. Si LM-PCR est infructueuse, il y aura une absence de "dénigrement" de l'ADN. Au lieu de cela, vous pourrez voir les bandes définitives de l'ADN.

Figure 5
Données Figure 5. Exemple d'une exécution séquençage qui démontre une seule voie de la plate-forme Illumina GAIIx devrait produire plus de 30 millions de séquences de 100 paires de bases chacune.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Un écran vers l'avant génétique à l'aide de la Belle au Bois Dormant système transposon fournit une méthode pour identifier les mutations qui causent le cancer. En sélectionnant le promoteur adéquat pour contrôler la recombinase Cre en plus des mutations prédisposant, l'écran SB permettra d'identifier de nouveaux gènes connus et candidats cancer.

Le succès d'un écran SB est largement tributaire des souris sélectionnées pour créer l'écran. Pour le transposon, nous vous recommandons d'utiliser deux souches de souris différentes portant le concatémère de transposons oncogènes sur différents chromosomes 7. Une réflexion approfondie doit être utilisé lors du choix de la recombinase Cre tissu-spécifique qui va activer la transposase SB. Il devrait y avoir des preuves que l'enzyme Cre est active dans le type cellulaire qui est soupçonné d'être la cellule d'origine du cancer en cours de modélisation. Exemples réussis, citons Villin-Cre (cancer du tractus gastro-intestinal), albumine-Cre (carcinom hépatocellulairea), et de l'aide-Cre (lymphome) 8-10.

Le nombre de souris nécessaires pour un écran réussite dépendra de la pénétrance tumeur. En général, plus de tumeurs et d'autres souris se traduira par un écran plus robuste. Pour détecter une différence de 2 fois dans le cancer de latence devrait y avoir au moins 60 animaux à la fois dans les groupes témoins et expérimentaux 11.

La nature versatile de ces écrans est puissant par rapport à d'autres techniques que l'on peut préciser la nature de la maladie, de suivre la progression, et d'analyser la composition génétique. Cette technique a été couronnée de succès dans un certain nombre d'écrans qui ont donné des listes de SIC qui permettent d'identifier de nouveaux gènes potentiels de la conduite du cancer. Avec cette information, les études dirigées peuvent être effectués pour comprendre la fonction de ces nouvelles mutations. Dans l'ensemble, l'utilisation de cette technique peut conduire à la conception éventuelle de nouveaux médicaments visant à éliminer les résultats de ces mutations génétiques spécifiquestions.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Les auteurs n'ont rien à révéler.

Acknowledgments

Les auteurs tiennent à remercier Branden Moriarity, David Largaespada, et Vincent Keng à l'Université du Minnesota, et Adam Dupuy à l'Université de l'Iowa pour leur aide dans l'élaboration du protocole décrit ci-dessus.

Materials

Name Company Catalog Number Comments
Sure-Seal Induction Chamber Brain Tree Scientific EZ-177
Cryovial Bioexpress C-3355-2
10% Buffered Formalin Sigma Aldrich HT501128-4L
Protein Precipitation solution Qiagen 158910
Cell lysis buffer Qiagen 158906
Proteinase K Qiagen 158920
RNase A Qiagen 158924
TE Buffer Promega V6232
BfaI New England Biolabs R0568S
NlaIII New England Biolabs R0125S
MinElute 96 well plates Qiagen 28051
QIAvac 96 Vacuum manifold Qiagen 19504
Multi-MicroPlate Genie, 120V Scientific Industries, Inc. SI-4000
T4 DNA ligase with 5x ligation Buffer Invitrogen 15224-041
BamHI New England Biolabs R0136S
25mM dNTPs Bioexpress C-5014-200
Platinum Taq Invitrogen 10966-034
FastStart Taq DNA Polymerase Roche 12032929001
Agarose Promega V3121
TAE Buffer Promega V4271
TE Buffer Promega V6232
Ethidium bromide Promega H5041

DOWNLOAD MATERIALS LIST

References

  1. Fearon, E. R., Vogelstein, B., et al. A genetic model for colorectal tumorigenesis. Cell. 61, 759-767 (1990).
  2. Wood, L. D., et al. The Genomic Landscapes of Human Breast and Colorectal Cancers. Science. 318, 1108-1113 (2007).
  3. Ivics, Z., Hackett, P. B., Plasterk, R. H., Izsvák, Z. Molecular Reconstruction of Sleeping Beauty, a Tc1-like Transposon from Fish, and Its Transposition in Human Cells. Cell. 91, 501-510 (1997).
  4. Starr, T. K., Largaespada, D. A. Cancer gene discovery using the Sleeping Beauty transposon. Cell Cycle. 4, 1744-1748 (2005).
  5. Mueller, P. R., Wold, B. In Vivo Footprinting of a Muscle Specific Enhancer by Ligation Mediated PCR. Science. 246, 780-786 (1989).
  6. Bergemann, T. L., et al. New methods for finding common insertion sites and co-occurring common insertion sites in transposon- and virus-based genetic screens. Nucleic acids research. 40, 3822-3833 (2012).
  7. Copeland, N. G., Jenkins, N. A. Harnessing transposons for cancer gene discovery. Nature Reviews Cancer. 10, 696-706 (2010).
  8. Collier, L. S., Carlson, C. M., Ravimohan, S., Dupuy, A. J., Largaespada, D. A. Cancer gene discovery in solid tumours using transposon-based somatic mutagenesis in the mouse. Nature. 436, 272-276 (2005).
  9. Starr, T. K., et al. A transposon-based genetic screen in mice identifies genes altered in colorectal cancer. Science. 323, 1747-1750 (2009).
  10. Keng, V. W., et al. A conditional transposon-based insertional mutagenesis screen for genes associated with mouse hepatocellular carcinoma. Nature. 27, 264-274 (2009).
  11. Dupuy, A. J., Akagi, K., Largaespada, D. A., Copeland, N. G., Jenkins, N. A. Mammalian mutagenesis using a highly mobile somatic Sleeping Beauty transposon system. Nature. 436, 221-226 (2005).
Identification des<em&gt; Belle au Bois Dormant</em&gt; Insertions de transposons dans les tumeurs solides en utilisant l&#39;éditeur de liens médiée par PCR
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Janik, C. L., Starr, T. K. Identification of Sleeping Beauty Transposon Insertions in Solid Tumors using Linker-mediated PCR. J. Vis. Exp. (72), e50156, doi:10.3791/50156 (2013).More

Janik, C. L., Starr, T. K. Identification of Sleeping Beauty Transposon Insertions in Solid Tumors using Linker-mediated PCR. J. Vis. Exp. (72), e50156, doi:10.3791/50156 (2013).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter