Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Medicine

Identificazione dei doi: 10.3791/50156 Published: February 1, 2013

Summary

Un metodo di identificazione conducenti sconosciuti di carcinogenesi utilizzando un approccio imparziale è descritto. Il metodo utilizza l'

Abstract

Genomiche, analisi proteomica, trascrittomica e epigenomic di tumori umani indicano che ci sono migliaia di anomalie all'interno di ogni genoma del cancro rispetto al corrispondente tessuto normale. Sulla base di queste analisi è evidente che ci sono molti piloti sconosciute genetiche del cancro 1. Purtroppo questi driver sono nascoste all'interno di un numero molto maggiore di passeggeri anomalie nel genoma che non contribuiscono direttamente alla formazione del tumore. Un altro aspetto del genoma del cancro è che vi è una notevole eterogeneità genetica all'interno simili tipi di tumore. Ogni tumore può ospitare differenti mutazioni che forniscono un vantaggio selettivo per la formazione del tumore 2. Esecuzione di un imparziale schermo in avanti genetica nei topi fornisce gli strumenti per generare tumori e analizzare la loro composizione genetica, riducendo lo sfondo di mutazioni passeggeri. La bella addormentata (SB) trasposoni sistema è uno di questi metodi 3. Il sistema utilizza Mobile V SBettori (trasposoni) che possono essere inseriti nel genoma dall'enzima trasposasi. Mutazioni sono limitati a un tipo specifico di cellula attraverso l'uso di un allele trasposasi condizionale che viene attivato da ricombinasi Cre. Esistono molte linee di topi che esprimono ricombinasi Cre in tessuti specifici. Attraversando una di queste linee per l'allele trasposasi condizionale (ad es Lox-stop-Lox-SB11), il sistema SB si attiva solo nelle cellule che esprimono Cre ricombinasi. La ricombinasi Cre sarà accise una cassetta di arresto che blocca l'espressione dell'allele trasposasi, attivando così mutagenesi trasposone nel tipo di cellula designato. Uno schermo SB è avviata da allevando tre ceppi di topi transgenici in modo che i topi sperimentali portano un allele condizionale trasposasi, un concatamer dei trasposoni, e un tessuto-specifico allele ricombinasi Cre. Questi topi sono lasciati maturare fino a formare tumori e diventano moribondo. I topi sono poiDNA genomico necroscopia ed è isolato dai tumori. Successivamente, il DNA genomico è sottoposto a linker-mediata-PCR (LM-PCR) che si traduce in amplificazione di loci genomici contenenti un trasposone SB. LM-PCR eseguita su un singolo tumore provocherà centinaia di ampliconi distinti rappresentano le centinaia di loci genomici contenenti inserzioni di trasposoni in un 4 singolo tumore. Le inserzioni di trasposoni in tutti i tumori vengono analizzati e siti di inserzione comuni (Ciss) sono identificati con un adeguato metodo statistico 5. I geni all'interno del CIS sono altamente probabile che sia oncogeni o geni oncosoppressori, e sono considerati i geni del cancro candidati. I vantaggi di usare il sistema SB per identificare geni tumorali candidati sono: 1) il trasposone può essere facilmente collocato nel genoma perché la sua sequenza è nota, 2) trasposizione può essere diretto a qualsiasi tipo di cellula e 3) il trasposone è in grado di sia l'introduzione di guadagno e perdita-di-funzione mutazioni 6. Il following protocollo descrive il modo di concepire ed eseguire una schermata in avanti genetica utilizzando il sistema SB trasposoni per identificare i geni del cancro candidati (Figura 1).

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. Allevamento e invecchiamento di animali transgenici

  1. Selezionare i ceppi di topi transgenici appropriate per l'esperimento. Un esperimento tipico utilizza tre linee transgeniche, un topo trasposasi condizionale, un mouse ospitare un concatamer di trasposoni, e un mouse esprimere ricombinasi Cre nelle cellule ritiene siano le cellule di origine per il cancro desiderato. Se il tumore viene modellata ha una mutazione nota in una grande percentuale di pazienti può essere desiderabile includere questa mutazione all'inizio. Esempi di questi "predisponenti" mutazioni includono Kras attivati, TP53 dominanti negativi o un allele Pten floxed. Con l'aggiunta di una mutazione che predispone il modello può rappresentare meglio il cancro umano (cfr. 1.3). Diversi trasposasi Bella Addormentata e topi trasposoni sono disponibili presso il National Cancer Institute del mouse Repository ( http://mouse.ncifcrf.gov/ ).
  2. Razza topi trasposasi condizionale per i topi che ospitano i trasposoni per ottenere alla fine i topi omozigoti per entrambi gli alleli, se possibile. Razza prole omozigote per topi che esprimono Cre ricombinasi per generare le triple topi transgenici sperimentali (Figura 2). Nota: Ottenere topi omozigoti non sono sempre possibili o ideale. Ad esempio, i topi omozigoti p53 dominanti negativi sono molto più difficili da allevare rispetto ai topi eterozigoti. Inoltre, è utile fare in modo che cucciolate seguire genetica mendeliana per confermare che il sistema di allevamento è riuscita.
  3. Se si utilizza uno sfondo predisposto, i topi con la prima razza trasposasi a topi con l'allele predisponente. Allo stesso tempo, i topi di razza esprimono Cre ricombinasi ai topi che trasportano i trasposoni. Creare topi omozigoti per ciascun allele se possibile. Infine, allevare la prole omozigote dai precedenti due regimi di allevamento per generare quadruple anim transgenico sperimentaleSLA.
  4. Oltre agli animali da esperimento, generare coorti di topi di controllo. Il gruppo di controllo normalmente consiste di littermates dal allevamento sperimentale che ereditano solo due dei tre alleli (Figura 2). Nel caso di uno sfondo predisposto, topi compresi tre dei quattro alleli sarà anche necessario.
  5. Monitorare topi sperimentali e di controllo giornalieri per lo sviluppo del tumore e / o agonia. Segui la tua assistenza istituzionale degli animali e uso delle commissioni (IACUC) i requisiti per la zootecnia. Inoltre, è tipico di determinare un'epoca in cui si sacrifica un animale se non è ancora diventata moribonda. Diciotto mesi è un età tipica in cui sono eutanasia topi.

2. Necroscopico di animali transgenici

Nome del reagente Azienda Numero di catalogo
Sure-Seal Induczione della Camera Cervello Albero scientifico EZ-177
Provetta Microbank ™ Bioexpress C-3355-2
10% formalina tamponata Sigma Aldrich HT501128-4L

Reagenti Tabella 1. Richiesta.

  1. Quando il mouse è moribondo o ha raggiunto la fine del ciclo di vita determinato, eutanasia animale con un CO 2 camera dopo le vostre linee guida IACUC. In generale, posizionare l'animale in una camera a gas pulito, aprire il serbatoio del gas e regolare il regolatore di leggere non superiore a 5 libbre per pollice quadrato. Riempire lentamente per ridurre al minimo l'irritazione nasale e oculare e l'avversione a CO 2. Assicurarsi che il cuore dell'animale non è più battere e non risponde quando viene toccato negli occhi.
  2. Esterno Spruzzi di topo sacrificato con il 70% di etanolo.
  3. Posizionare il mouse su un bordo l'autopsia e fissare con perni dissezione. Usare le forbici und pinzette per aprire il mouse e rimuovere gli organi. Determinare quali organi devono essere raccolti è il progetto dipendente. Tuttavia, si raccomanda di raccogliere sempre la milza e il fegato come questi organi danno spesso informazioni importanti sul perché il mouse era moribonda. Anche raccogliere lo sterno per l'analisi potenziale di midollo osseo. Inoltre, è sempre utile per raccogliere qualsiasi organo o tessuto che appare anomalo.
  4. I tessuti e tumori che vengono raccolti dovrebbe essere diviso in quattro sezioni. Una sezione è fissato in formalina tamponata al 10% per 18 ore seguito da 70% di etanolo. Questa sezione può essere utilizzata per H & E colorazione e / o IHC. I rimanenti tre sezioni, che sono generalmente 50 a 100 mg di dimensione, sono congelati in azoto liquido. Questi possono essere utilizzati per DNA, RNA e proteine ​​isolamento.
  5. Smaltire i tessuti della carcassa e rimanenti secondo le linee guida IACUC.

3. Isolamento del DNA genomico da tumori

<> Nome forte del reagente Azienda Numero di catalogo
Proteine ​​Precipitazioni soluzione Qiagen 158910
Tampone di lisi cellulare Qiagen 158906
Proteinasi K Qiagen 158920
RNasi A Qiagen 158924
TE Buffer Promega V6232

Reagenti Tabella 2. Richiesta.

  1. Tritare finemente il campione congelato tumorale (da 50 a 100 mg) usando una lama di rasoio pulito.
  2. Posto tritata tessuto in una provetta da 1,5 ml microcentrifuga e aggiungere 1 ml di tampone di lisi cellulare contenente 5 microlitri soluzione proteinasi K (20 mg / ml).
  3. Vortex accuratamente.
  4. Incubare a 55 ° C un agitatore fissato a 250 rpm per almeno 4 ore, preferibilmente durante la notte.
  5. Aggiungere 1 ml RNasi A soluzione (10 mg / ml) e capovolgere tubo 25 volte.
  6. Incubare a 37 ° C per 30 min.
  7. Raffreddare a temperatura ambiente, ponendo in ghiaccio per 3 min.
  8. Aggiungere 333 microlitri soluzione di precipitazione delle proteine ​​e agitare vigorosamente.
  9. Centrifugare a 14.000 rpm 10 min. Le proteine ​​dovrebbero pellet. Se pellet è molto piccola, vortice di nuovo, incubare su ghiaccio per 5 min, e quindi ri-centrifuga.
  10. Decantare il surnatante contenente il DNA in una provetta pulita da 15 ml per centrifuga.
  11. Aggiungere ugual volume di isopropanolo% 100 e mescolare delicatamente capovolgendo 50 volte.
  12. Centrifugare a 3500 rpm per 3 min.
  13. Gettare il surnatante.
  14. Aggiungere 1 ml di etanolo 70% e invertire tubo più volte per lavare il pellet.
  15. Trasferire il pellet lavato con l'etanolo in una provetta da 1,5 ml.
  16. Centrifugare a 14.000 rpm per 5 min a 4 ° C.
  17. Versare etanolo e invertire tubo di aria secca (circa 5 a 30 minuti).
  18. Risospendere DNA pEllet in 50-500 microlitri di TE a seconda delle dimensioni del DNA pellet.
  19. Incubazione opzionale a 37 ° C per risospendere il DNA.
  20. Conservare a 4 ° C o -20 ° C per una conservazione a lungo termine.

4. Linker Mediated-PCR DNA genomico Utilizzo da tumori

Nome del reagente Azienda Numero di catalogo
Bfai New England Biolabs R0568S
NlaIII New England Biolabs R0125S
MinElute piastre a 96 pozzetti Qiagen 28051
QIAvac 96 collettore sottovuoto Qiagen 19504
Multi-Genie per micropiastre, 120V Scientific Industries, Inc. SI-4000
DNA ligasi T4 con il tampone di legatura 5x Invitrogen 15224-041
BamHI New England Biolabs R0136S
DNTP 25 mM Bioexpress C-5014-200
Platinum Taq Invitrogen 10966-034
FastStart Taq DNA Polymerase Roche 12032929001
Agarosio Promega V3121
TAE buffer Promega V4271
TE Buffer Promega V6232
Etidio bromuro Promega H5041

Reagenti Tabella 3. Richiesto.

Sequenze del linker

Bfai linker + 5 'GTAATACGACTCACTATAGGGCTCCGCTTAAGGGAC 3'

Bfai linker-5 'Phos-TAGTCCCTTAAGCGGAG 3'NH2

"> Linker NlaIII 5'GTAATACGACTCACTATAGGGCTCCGCTTAAGGGACCATG + 3 '

NlaIII linker-5 'Phos-GTCCCTTAAGCGGAGCC 3'

Primer Sequenze

Primaria PCR in avanti a destra (NlaIII): Spl IRDR R1 1 GCTTGTGGAAGGCTACTCGAAATGTTTGACCC

Primaria PCR in avanti lato sinistro (bfai): Spl IRDR L1 1 CTGGAATTTTCCAAGCTGTTTAAAGGCACAGTCAAC

Primaria inversa PCR per il lato destro e sinistro: Spl Link1 1 GTAATACGACTCACTATAGGGC

Lato secondario PCR destro avanti: Esempio di un codice a barre Illumina fondo secondario 5 'AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTNNNNNNNNNNNNaGgtgtatgtaaacttccgacttcaa (Il N rappresentano il 12 bp codice a barre, la sequenza in maiuscolo sono necessari per la piattaforma Illumina, e la sequenza in minuscolo si legherà al trasposone.)

Secondaria PCR in avanti lato sinistro: Esempio di una seconda Illumina codice a barredary fondo 5'AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTNNNNNNNNNNNNaAgtgtatgtaaacttccgacttcaa (Il N rappresentano il 12 bp codice a barre, la sequenza in maiuscolo sono necessari per la piattaforma Illumina, e la sequenza in minuscolo si legherà al trasposone.)

Secondaria inversa PCR per il lato destro e sinistro: linker innesco nidificato inverso 5 'CAAGCAGAAGACGGCATACGAGCTCTTCCGATCTAGGGCTCCGCTTAAGGGAC

  1. Anneal + e - linkers per entrambe linkers bfai e linker NlaII mescolando 50 pl di linker + (100 pM) con 50 pl di linker-(100 mM) e aggiungere 2 microlitri di NaCl (5 M) in una provetta da 1,5 ml. Posto a 95 ° blocco termico C per 5 min. Disattivare blocco riscaldante e lasciare raffreddare lentamente a temperatura ambiente (questo richiede un'ora o più). Dopo raffreddamento, linkers ricotti possono essere conservati in un congelatore -20 ° C fino al momento dell'uso.
  2. Preparare due aliquote di DNA tumorale, ciascuna aliquota contenente 1 ug di DNA. Una aliquota sarà digerito spiritoha enzima di restrizione che taglierà vicino alla fine "diritto" del trasposone. La seconda aliquota viene digerito con un enzima di restrizione che taglia vicino alla fine "sinistra" del trasposone. Questo viene fatto per massimizzare le possibilità di amplificare ogni sito di inserzione di trasposoni.
  3. Digerire il DNA tumorale in un'aliquota utilizzando l'enzima "giusto" NlaII lato, e digerire il DNA tumorale nella parte aliquota prelevata altro utilizzando il lato "sinistro" enzima bfai: unire 1 microlitri di enzima, 5 microlitri di buffer NEB 10x # 4, DNA ( 1 pg) e DDH 2 O ad un volume totale di 50 microlitri. Digest DNA notte a 37 ° C a bagnomaria o incubatore.
  4. Riscaldare inattivare enzimi (bfai = 80 ° C per 20 min, NlaIII = 65 ° C per 20 min).
  5. Pulire i campioni digeriti ponendo i campioni in MinElute piastra a 96 pozzetti, piastra posto nel collettore a vuoto e vuoto per circa 15 minuti fino a quando i pozzi aspetto secco.
  6. Rimuovere la piastra di collettore a vuoto e fondo macchia di piastra a 96 pozzetti con carta assorbente per togliere tutti liquidazioned
  7. Aggiungere 30 microlitri DDH 2 O a ciascun pozzetto e agitare su un agitatore orbitale impostato su alto per 2 minuti, o pipettare su e giù 20 a 40 volte.
  8. Trasferimento intero volume in pozzi (30 microlitri) da MinElute piastra a 96 pozzetti in piastre da 96 pozzetti puliti.
  9. Eseguire reazioni di ligazione del linker con il DNA digerito dal punto 4.8 e leganti a partire dal punto 4.1. Mix 10 microlitri di DNA digerito, 4 microlitri di buffer legatura 5x, 5.5 linker ul ricotto (950 mg / pl), 0,5 microlitri ligasi T4 (5 U / mL).
  10. Incubare per 4 ore a tutta la notte a 16 ° C.
  11. Inattivare a caldo la DNA ligasi T4 a 65 ° C per 10 min.
  12. Pulire legatura con MinElute piastre da 96 pozzetti e un collettore sottovuoto come descritto nei passaggi 4,5-4,6.
  13. Risospendere in 30 microlitri H 2 O e trasferimento in un ambiente pulito piastra a 96 pozzetti.
  14. Eseguire una seconda digestione del DNA, al fine di distruggere le rimanenti concatamer trasposoni. Ciò è ottenuto tagliando il DNA una seconda volta usando un enzima che taglia il plasmide vettore DNA che è stato utilizzato per creare i topi transgenici contenenti il ​​concatamer trasposone.
  15. Digest utilizzando DNA BamHI (lato destro e sinistro): Mix 25 pl di linker-DNA ligato dal passo 4,13, 5 microlitri di buffer NEB 10x # 3, 0,5 microlitri BamHI (20 U / pl), 0,5 microlitri BSA (10 mg / ml ), e 19 microlitri DDH 2 O.
  16. Digest 3-6 ore o per una notte a 37 ° C.
  17. Effettuare primaria PCR usando un primer specifico per il trasposone e un primer specifico per il linker. Questi variano a seconda di ciò trasposone e linker in uso. I primer elencati nella tabella sopra innesco di lavoro per l'T2/Onc e T2/Onc2 trasposoni.
  18. PCR primaria: 5 microlitri di buffer 10x, 2,0 microlitri MgCl2 (50 mM), 4 pl dNTP (2,5 nM), 1 pl Primer 1 (20 pM), 1 pl Primer 2 (20 pM), 0,25 microlitri Platinum Taq (5 U / pl), 3 microlitri di DNA digerito con linkers (importo può variare), fino a 50 pl DDH 2 O.
  19. Programma di PCR: 94 ° C per 5 min, 30 cicli di 94 ° C per 30 sec, 60 & deg; C per 30 sec, 72 ° C per 90 sec. Estensione finale a 72 ° C per 5 min.
  20. Ripulire prodotto PCR utilizzando MinElute 96 pozzetti e un collettore di vuoto, come descritto sopra.
  21. Risospendere in 30 microlitri H 2 O e trasferimento in un ambiente pulito piastra a 96 pozzetti.
  22. Fai una diluizione 1:75 del 1 ° PCR diluendo 2 microlitri di DNA dal passaggio 4,21 in 148 microlitri DDH 2 O
  23. Effettuare secondaria PCR annidate usando versioni dei primer che hanno anche la sequenza richiesta per la macchina Illumina GAIIx così come un codice a barre 12 paia di basi che è unico per ciascun campione di tumore trattati (vedi tabella fondo sopra per esempi di questi primer).
  24. Secondaria PCR: 10 microlitri di buffer 10x con MgCl2, 8 dNTPs ul (2,5 mm), 1 Illumina microlitri codice a barre fondo secondario (20 mM), 1 Nest Illumina pl 1 Primer secondaria (20 mM), 0,25 microlitri FastStart Taq (5 U / mL ), 2 microlitri di DNA da PCR 1:75 primari diluiti, fino a 100 pl DDH 2 O.
  25. PCR Programma: 94 °; C per 2 min, 30 cicli di 94 ° C per 30 sec, 53 ° C per 45 sec, 72 ° C per 90 sec. Estensione finale a 72 ° C per 5 min.
  26. Eseguire 45 pl di questa reazione PCR su un gel di agarosio 1% contenente etidio bromuro (0,5 mcg / ml). Ci dovrebbe essere una "macchia" di prodotti che rappresentano PCR amplificati delle alte inserzioni di trasposoni diversi nel tumore (Figura 3).
  27. Pulire restante 50 pl di prodotto di PCR utilizzando MinElute 96 pozzetti e un collettore di vuoto come descritto sopra. Lavare una volta mettendo 50 microlitri DDH 2 O nei pozzetti e aspirare di nuovo.
  28. Risospendere in 30 microlitri TE e trasferimento in un ambiente pulito piastra a 96 pozzetti.
  29. Determinare la concentrazione di DNA in ciascun campione. Combina la stessa quantità di DNA in una singola provetta da microcentrifuga 1,5 ml. Questa sarà la libreria che è in sequenza in una sola corsia di un Illumina HiSeq 2000 macchina. È possibile sequenziare diverse centinaia tumori in una singola corsia di corsa Illumina.
  30. Presentarel'unico tubo contenente la stessa quantità di DNA da tutti i tumori per sequenziamento. Questo può essere fatto con l'istituto o per finalità commerciali.

5. Analisi di inserimenti trasposone

  1. Software per l'analisi dei trasposoni inserimento dei dati è disponibile per il download gratuito attraverso SourceForge ( http://sourceforge.net/projects/tapdancebio/ ). Il programma, chiamato TapDance, richiede il file di sequenza dalla piattaforma Illumina e un codice a barre in un file di testo la mappa della libreria.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Dopo che il sistema di allevamento è stata stabilita, gli allevatori devono produrre una cucciolata ogni 19-21 giorni. Dimensione cucciolata variano tra 5 e 12 cuccioli, a seconda dell'età degli allevatori e il background genetico. Inoltre, assicurarsi che il genotipo della cucciolata segue la genetica mendeliana come un modo per confermare che il sistema di allevamento è sia corretto e di successo.

Per l'esperimento abbia successo, dell'incidenza di tumori negli animali da esperimento dovrebbero essere significativamente maggiore di incidenza di tumori negli animali di controllo. Se nessuna mutazione "predisponenti" è stata inclusa nel test ci dovrebbero essere pochi o nessun tumori negli animali di controllo. Se una mutazione "predisponente" è stata inclusa nel test, tumori in questi animali deve essere molto inferiore rispetto all'incidenza di animali con la mutazione e l'attività SB.

LM-PCR dovrebbe amplificare centinaia di inserzioni di trasposoni in un singolo tumore. Dopo l'esecuzione haSe il prodotto secondario PCR su un gel di 1%, ci dovrebbe essere un "smear" di DNA che rappresenta questa amplificazione (Figura 3). Se ci sono solo una o due bande, o SB non era attiva nel tumore o stato fatto un errore nel protocollo (Figura 4).

Sequencing 1-200 tumori in una sola corsia della piattaforma Illumina GAIIx dovrebbe produrre oltre 30 milioni di sequenze di 100 bp ciascuno (Figura 5).

Reagenti Tabella 1. Richiesto per la sezione 2.

Reagenti Tabella 2. Necessario per la sezione 3.

Reagenti Tabella 3. Richiesto per la sezione 4.

Figura 1
Figura 1. Diagramma che mostra le fasieffettuare una schermata avanti genetica utilizzando il sistema Sleeping Beauty. Innanzitutto, un modello di topo viene generato. I topi sono poi sottoposti a necroscopia moribondi e tumori sono raccolti e isolati. DNA tumorale viene purificato e linker-mediata PCR eseguita. Infine, amplificato DNA tumorale con inserzioni di trasposoni è sequenziato e siti di inserzione comuni individuati.

Figura 2
Figura 2. Allevamento schema per generare coorte sperimentale. Topi contenenti il trasposasi (Rosa26-LSL-SB11) sono attraversate a topi covando l'concatamer dei trasposoni (T2-Onc). La prole sono poi accoppiati a topi portatori del promotore tessuto specifico designato guidato Cre ricombinasi (Cre).

Figura 3
Figura 3. Rappresentanterisultati di PCR secondaria. Il prodotto atteso ha uno striscio aspetto variabile da 100 a 600 paia di basi.

Figura 4
Figura 4. Se LM-PCR ha successo, ci sarà un assenza del "smear" di DNA. Al contrario, si vedrà fasce definitive di DNA.

Figura 5
Figura 5. Dati di esempio di una corsa di sequenziamento che dimostra una sola corsia della piattaforma Illumina GAIIx dovrebbe produrre oltre 30 milioni di sequenze di 100 paia di basi ciascuno.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Viene visualizzata una schermata in avanti genetica utilizzando il sistema di Sleeping Beauty trasposone fornisce un metodo per identificare le mutazioni che causano il cancro. Selezionando il promotore appropriato controllare ricombinasi Cre in aggiunta a qualsiasi mutazioni predisponenti, lo schermo SB identificherà noti e nuovi geni del cancro candidati.

Il successo di uno schermo SB dipende in larga misura i topi selezionati per creare lo schermo. Per il trasposone, si consiglia di utilizzare due diversi ceppi di topi che portano il concatamer dei trasposoni oncogeni su cromosomi diversi 7. Pensiero attento dovrebbe essere usato quando si sceglie il tessuto-specifica ricombinasi Cre che attiverà il trasposasi SB. Occorre dimostrare che l'enzima Cre è attivo nel tipo cellulare che è sospettato di essere cellula di origine del tumore da modellare. Esempi di successo includono Villin-Cre (tratto gastrointestinale cancro), Albumina-Cre (carcinom epatocellularea), e l'aiuto-Cre (linfoma). 8-10

Il numero di topi richiesti per una schermata successo dipende dalla penetranza tumore. In generale, più tumori e più topi si tradurrà in una schermata più robusto. Per rilevare un 2-fold differenza nel cancro latenza ci dovrebbe essere almeno 60 animali sia gruppi di controllo e sperimentali. 11

La natura versatile di questi schermi è potente rispetto ad altre tecniche che si può specificare la natura della malattia, seguire la progressione, e analizzare la composizione genetica. Questa tecnica ha avuto successo in un numero di schermi che hanno dato liste CSI che identificano nuovi potenziali geni di guida del cancro. Con questa informazione, studi directed può essere eseguita per comprendere la funzione di queste mutazioni. Nel complesso, l'uso di questa tecnica può portare alla progettazione eventuale di nuove terapie mirate per eliminare i risultati di queste mutazioni genetiche specifichezioni.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Gli autori non hanno nulla da rivelare.

Acknowledgments

Gli autori desiderano ringraziare Moriarity Branden, David Largaespada, e Vincent Keng presso l'Università del Minnesota, e Adam Dupuy presso la University of Iowa per la loro assistenza nello sviluppo del protocollo sopra descritto.

Materials

Name Company Catalog Number Comments
Sure-Seal Induction Chamber Brain Tree Scientific EZ-177
Cryovial Bioexpress C-3355-2
10% Buffered Formalin Sigma Aldrich HT501128-4L
Protein Precipitation solution Qiagen 158910
Cell lysis buffer Qiagen 158906
Proteinase K Qiagen 158920
RNase A Qiagen 158924
TE Buffer Promega V6232
BfaI New England Biolabs R0568S
NlaIII New England Biolabs R0125S
MinElute 96 well plates Qiagen 28051
QIAvac 96 Vacuum manifold Qiagen 19504
Multi-MicroPlate Genie, 120V Scientific Industries, Inc. SI-4000
T4 DNA ligase with 5x ligation Buffer Invitrogen 15224-041
BamHI New England Biolabs R0136S
25mM dNTPs Bioexpress C-5014-200
Platinum Taq Invitrogen 10966-034
FastStart Taq DNA Polymerase Roche 12032929001
Agarose Promega V3121
TAE Buffer Promega V4271
TE Buffer Promega V6232
Ethidium bromide Promega H5041

DOWNLOAD MATERIALS LIST

References

  1. Fearon, E. R., Vogelstein, B., et al. A genetic model for colorectal tumorigenesis. Cell. 61, 759-767 (1990).
  2. Wood, L. D., et al. The Genomic Landscapes of Human Breast and Colorectal Cancers. Science. 318, 1108-1113 (2007).
  3. Ivics, Z., Hackett, P. B., Plasterk, R. H., Izsvák, Z. Molecular Reconstruction of Sleeping Beauty, a Tc1-like Transposon from Fish, and Its Transposition in Human Cells. Cell. 91, 501-510 (1997).
  4. Starr, T. K., Largaespada, D. A. Cancer gene discovery using the Sleeping Beauty transposon. Cell Cycle. 4, 1744-1748 (2005).
  5. Mueller, P. R., Wold, B. In Vivo Footprinting of a Muscle Specific Enhancer by Ligation Mediated PCR. Science. 246, 780-786 (1989).
  6. Bergemann, T. L., et al. New methods for finding common insertion sites and co-occurring common insertion sites in transposon- and virus-based genetic screens. Nucleic acids research. 40, 3822-3833 (2012).
  7. Copeland, N. G., Jenkins, N. A. Harnessing transposons for cancer gene discovery. Nature Reviews Cancer. 10, 696-706 (2010).
  8. Collier, L. S., Carlson, C. M., Ravimohan, S., Dupuy, A. J., Largaespada, D. A. Cancer gene discovery in solid tumours using transposon-based somatic mutagenesis in the mouse. Nature. 436, 272-276 (2005).
  9. Starr, T. K., et al. A transposon-based genetic screen in mice identifies genes altered in colorectal cancer. Science. 323, 1747-1750 (2009).
  10. Keng, V. W., et al. A conditional transposon-based insertional mutagenesis screen for genes associated with mouse hepatocellular carcinoma. Nature. 27, 264-274 (2009).
  11. Dupuy, A. J., Akagi, K., Largaespada, D. A., Copeland, N. G., Jenkins, N. A. Mammalian mutagenesis using a highly mobile somatic Sleeping Beauty transposon system. Nature. 436, 221-226 (2005).
Identificazione dei<em&gt; Bella Addormentata</em&gt; Inserimenti trasposone nei tumori solidi utilizzando Linker-mediata PCR
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Janik, C. L., Starr, T. K. Identification of Sleeping Beauty Transposon Insertions in Solid Tumors using Linker-mediated PCR. J. Vis. Exp. (72), e50156, doi:10.3791/50156 (2013).More

Janik, C. L., Starr, T. K. Identification of Sleeping Beauty Transposon Insertions in Solid Tumors using Linker-mediated PCR. J. Vis. Exp. (72), e50156, doi:10.3791/50156 (2013).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter