Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Medicine

의 식별 doi: 10.3791/50156 Published: February 1, 2013

Summary

편견 접근법을 사용하여 발암의 알 수없는 드라이버를 식별하는 방법이 설명되어 있습니다. 방법은 사용

Abstract

인간 종양의 게놈, proteomic transcriptomic, 그리고 epigenomic 분석은 일치하는 정상 조직에 비해 각 암 게놈 내에서 이상 수천이 있다는 것을 나타냅니다. 이러한 분석을 바탕으로 암은 하나의 많은 알려지지 않은 유전자 드라이버가 있다는 것을 분명하다. 불행하게도 이러한 드라이버는 직접 종양 형성에 기여하지 않는 게놈의 여객 이상의 훨씬 더 큰 숫자 안에 숨겨져 있습니다. 암 게놈의 또 다른 측면은 비슷 종양 유형에서 상당한 유전 이질성이 있다는 것입니다. 각 종양은 종양 형성 2 선택적 이점을 제공합니다 다른 변이를 가지고 있고, 할 수 있습니다. 여객 변이의 배경을 줄이면서 쥐 편견 앞으로 유전 화면을 수행하면, 종양을 생성하고 자신의 유전자 구성을 분석 할 수있는 도구를 제공합니다. 슬리핑 뷰티 (SB) transposon 시스템은 하나의 방법 3. SB 시스템은 모바일 v를 활용transposase 효소에 의해 게놈 전체에 삽입 할 수 ectors (transposons). 변이는 Cre Recombinase에 의해 활성화되는 조건 transposase의 allele의 사용을 통해 특정 세포 유형으로 제한됩니다. 대부분의 마우스 라인은 특정 조직에서 해당 표현 Cre의 Recombinase을 존재합니다. 조건부 transposase의 allele (예 : 훈제 연어 스톱 - 훈제 연어 - SB11)에 다음 줄 중 하나를 횡단함으로써, SB 시스템은 명시 적 Cre Recombinase 세포에서 활성화됩니다. Cre Recombinase은 소비세 정지 카세트를 의지 해당하므로 지정된 셀 유형에서 transposon의 mutagenesis를 활성화 transposase allele의 블록 식. 실험 쥐가 조건부 transposase의 allele, transposons의 concatamer 및 조직 별 Cre의 Recombinase의 allele을 가지고 있도록 SB 화면이 유전자 변형 생쥐의 세 변종을 사육에 의해 시작됩니다. 이 마우스는 종양 양식까지 연령에 허용들이 죽어가는이 될 수 있습니다. 마우스 했군요necropsied 및 게놈 DNA는 종양으로부터 격리되어 있습니다. 다음으로, 게놈 DNA는 링커로 인한-PCR을 받게 (LM-PCR)는 SB transposon을 포함하는 게놈 loci의 증폭의 결과.입니다 LM-PCR은 단일 종양의 4 transposon의 삽입을 포함하는 게놈 loci의 수백을 대표하는 고유 amplicons 수백하게됩니다 단일 종양을 수행했습니다. 모든 종양의 transposon의 삽입 분석하고 일반적인 삽입 사이트 (CISs)는 적절한 통계 방법 5를 사용하여 식별됩니다. CIS 내에서 유전자 oncogenes 또는 종양 억제 유전자가 될 가능성이 매우 높다고 있으며, 후보 암 유전자로 간주됩니다. 후보 암 유전자를 식별 할 수 SB 시스템을 사용의 장점은 다음과 같습니다의 순서는, 2 알려져 있기 때문에 1) transposon은 쉽게 전위는 거의 모든 세포 유형으로 이동하고 3) transposon이 가능하다 할 수 있습니다) 게놈에 위치 될 수있다 소개 모두 이득과 손실 기능 돌연변이 6. followiNG 프로토콜은 후보 암 유전자 (그림 1)을 식별하기 위해 SB transposon 시스템을 사용하여 앞으로 유전자 화면을 고안하고 실행하는 방법에 대해 설명합니다.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. 사육 및 트렌스 제닉 동물의 고령화

  1. 실험에 적합한 유전자 변형 생쥐의 변종을 선택합니다. 원하는 암 기원의 세포 것으로 세포에 Cre Recombinase을 표현 조건부 transposase 마우스, transposons의 concatamer을 품고 마우스 및 마우스, 전형적인 실험은 세 유전자 변형 라인을 사용합니다. 모델링되는 암 환자의 큰 비율에 알려진 돌연변이가있는 경우는 시작에서이 변이를 포함하는 것이 바람직 할 수 있습니다. 이 "predisposing"변이의 예는 다음과 활성화 Kras, 지배적 인 부정적 Tp53 또는 floxed Pten의 allele가 포함되어 있습니다. predisposing 돌연변이에 추가하여 모델은 더 나은 (1.3 참조) 인간의 암을 의미합니다. 여러 슬리핑 뷰티 transposase와 transposon 마우스는 국립 암 연구소 마우스 저장소 (에서하실 수 있습니다 http://mouse.ncifcrf.gov/ ).
  2. 결국 가능한 경우 두 대립 유전자에 대한 homozygous 마우스를 얻기 위해 transposons을 품고 쥐 번식 조건 transposase 마우스. 귀하의 트리플 유전자 변형 실험 쥐 (그림 2)을 생성 할 수 Cre Recombinase을 표현 마우스로 품종 homozygous 자손합니다. 참고 : 취득 homozygous 마우스는 항상 가능하거나 이상적인 없습니다. 예를 들어, homozygous p53의 지배 부정적인 마우스는 훨씬 더 어려운 heterozygous 마우스보다 번식하려고합니다. 또한, litters이 번식 제도가 성공적으로 확인 Mendelian 유전학을 준수하는지 확인하기 위해 도움이 될 것입니다.
  3. 취약한 배경을 사용하는 경우, predisposing allele있는 마우스에 transposase있는 첫번째 품종 마우스. 동시에 번식 마우스는 transposons을 가진 마우스에 Cre Recombinase을 표현. 각 allele 가능한 경우에 대한 homozygous 쥐를 만듭니다. 마지막으로, 쿼드 러플 유전자 변형 실험의 anim를 생성하는 과거 2 번식 제도에서 homozygous 자손을 번식ALS.
  4. 실험 동물뿐만 아니라, 마우스 제어 동료를 생성합니다. 제어 그룹은 일반적으로 만 세 대립 유전자 (그림 2) 중 두 가지를 상속 실험 사육에서 littermates로 구성되어 있습니다. 취약한 배경의 경우, 네 개의 대립 유전자 중에 세 등의 마우스도 필요합니다.
  5. 종양 개발 및 / 또는 moribundity에 대한 일일 실험 및 제어 쥐를 모니터링 할 수 있습니다. 귀하의 기관 동물 관리 및 동물 축산의 사용위원회 (IACUC) 요구 사항을 따르십시오. 또한, 그것은 아직 죽어가는가되지 않은 경우 동물을 희생되는에 나이를 결정하는 것이 일반적입니다. 18 개월 쥐가 euthanized 할 것인지 전형적인 연령은 16 세입니다.

2. 트렌스 제닉 동물의 검시

시약의 이름 회사 카탈로그 번호
그래 - 인감 Induc기 회의소 브레인 트리 과학 EZ-177
Cryovial Bioexpress C-3355-2
10 % 포르말린 버퍼 시그마 알드리치 HT501128-4L

표 1. 시약이 필요합니다.

  1. 마우스 죽어가는거나 결정 수명의 끝을 도달하면 IACUC 지침에 따라 CO 2 챔버를 사용하여 동물을 안락사시켜야. 일반적으로, 깨끗한 가스 챔버에 동물을 배치 가스 탱크를 열고 평방 인치 당 더 높은 5 이상 파운드를 읽어 조절기를 조정합니다. CO 2 코와 눈 자극 혐오감을 최소화하기 위해 천천히 입력하십시오. 동물의 심장이 더 이상 뛰고되지 않으며 눈에 접촉 할 때 응답하지 않는지 확인하십시오.
  2. 70 %의 에탄올과 희생 마우스 스프레이 외관.
  3. 장소 검시 보드에서 마우스 및 해부 핀으로 고정. 가위에게를 사용하여D 핀셋 마우스를 열고 장기를 제거합니다. 수집해야하는 장기 결정하는 것은 프로젝트에 따라 달라지게된다. 그러나, 이러한 기관은 종종 마우스가 죽어가는 이유에 중요한 통찰력을 제공으로 항상 비장과 간을 수집하는 것이 좋습니다. 또한 골수의 잠재력 분석을위한 흉골를 수집합니다. 또한, 항상 이상 나타나는 장기 나 조직을 수집 도움이됩니다.
  4. 수집 조직 및 종양은 4 개의 섹션으로 구분해야합니다. 10 % 70 % 에탄올 다음 18 시간에 포르말린 버퍼에 하나의 섹션이 고정됩니다. 이 섹션은 H & E 염색 및 / 또는 IHC 사용할 수 있습니다. 일반적으로 크기가 50-100 밀리그램있는 나머지 세 부분은, 액화 질소에 냉동 스냅 있습니다. 이러한 DNA, RNA 및 단백질 분리에 사용할 수 있습니다.
  5. IACUC 가이드 라인에 따라 시체와 나머지 조직을 폐기합니다.

3. 종양의 게놈 DNA를 분리

<시약의 STRONG> 이름 회사 카탈로그 번호
단백질 강수량 솔루션 Qiagen 158910
세포 용해 버퍼 Qiagen 158906
Proteinase K Qiagen 158920
RNase Qiagen 158924
TE 버퍼 Promega V6232

표 2. 시약이 필요합니다.

  1. 잘게 깨끗한 면도날을 사용하여 냉동 종양 샘플을 (50-100 MG) 이기다.
  2. 장소 1.5 ML의 microcentrifuge 튜브에 조직을 다진 5 μl Proteinase K 솔루션 (20 MG / ML)가 포함 된 셀 용해 버퍼 1 ML를 추가합니다.
  3. 철저하게 와동.
  4. ° C 흔드는는 바람직 하루 아침에 적어도 4 시간, 250 rpm으로 설정 한 55 품다.
  5. 1 μl RNase 솔루션을 (10 MG / ML) 추가 및 튜브 25 배를 반전.
  6. 30 분에 37 ° C에서 알을 품다.
  7. 3 분에 얼음에 배치하여 실내 온도에 차가운.
  8. 333 μl 단백질 강수량 솔루션과 강력하게 소용돌이를 추가합니다.
  9. 14,000 rpm에서 10 분에서 원심 분리기. 단백질은 펠릿해야. 펠렛 다시 아주 작은, 소용돌이 인 경우 5 분 후 다시 원심 분리기에 얼음에 품다.
  10. 깨끗한 15 ML의 원심 분리기 튜브로 표면에 뜨는 포함하는 DNA를 넣어.
  11. 백퍼센트 이소프로판올의 동등한 볼륨을 추가하고 부드럽게 반전 50 회에 섞는다.
  12. 3 분에 3,500 rpm으로 원심 분리기.
  13. 표면에 뜨는 폐기하십시오.
  14. 70 % 에탄올 1 ML을 추가하고 펠릿을 씻어 튜브를 여러 번 반전.
  15. 1.5 ML의 microcentrifuge 관에 에탄올과 함께 한물 펠릿을 전송합니다.
  16. 4 ° C.에 5 분에 14,000 rpm으로 원심 분리기
  17. 에탄올을 넣어, 공기 건조 (약 5-30 분)에 튜브를 반전.
  18. Resuspend DNA Pellet는 TE의 50-500 μl에 DNA 펠렛의 크기에 따라 다릅니다.
  19. 37 번 선택 부화는 ° C DNA를 resuspend합니다.
  20. 장기 저장을위한 4 ° C 또는 -20 ° C에서 저장합니다.

4. 종양에서 링커 매개-PCR 사용하여 게놈의 DNA

시약의 이름 회사 카탈로그 번호
BfaI 뉴 잉글랜드 Biolabs R0568S
NlaIII 뉴 잉글랜드 Biolabs R0125S
96 잘 접시를 MinElute Qiagen 28,051
QIAvac 96 진공 매니 폴드 Qiagen 19,504
멀티 MicroPlate 지니, 120V 과학 산업 주식회사 SI-4000
5 배 결합 버퍼와 T4 DNA ligase의 Invitrogen 15224-041
BamHI 뉴 잉글랜드 Biolabs R0136S
25 MM dNTPs Bioexpress C-5014-200
플래티넘 DNA 형성 촉매 Invitrogen 10966-034
FastStart DNA 형성 촉매의 DNA 중합 효소의 로슈 12032929001
아가로 오스 Promega V3121
태 버퍼 Promega V4271
TE 버퍼 Promega V6232
Ethidium 브로마이드 Promega H5041

표 3. 시약이 필요합니다.

링커 시퀀스

BfaI 링커 + 5 'GTAATACGACTCACTATAGGGCTCCGCTTAAGGGAC 3'

BfaI 링커-5 'Phos-TAGTCCCTTAAGCGGAG 3'NH2

"> NlaIII 링커 + 5'GTAATACGACTCACTATAGGGCTCCGCTTAAGGGACCATG 3 '

NlaIII 링커-5 'Phos-GTCCCTTAAGCGGAGCC 3'

프라이머 시퀀스

앞으로 차 PCR 오른쪽 (NlaIII) : SPL IRDR R1 한 GCTTGTGGAAGGCTACTCGAAATGTTTGACCC

SPL IRDR L1 한 CTGGAATTTTCCAAGCTGTTTAAAGGCACAGTCAAC : 기본 PCR 앞으로 쪽 (BfaI)를 왼쪽으로

오른쪽과 왼쪽 모두 측면에 대한 기본 PCR 역방향 : SPL Link1 한 GTAATACGACTCACTATAGGGC

차 PCR 앞으로 오른쪽 : Illumina barcoded 보조 프라이머 5 'AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTNNNNNNNNNNNNaGgtgtatgtaaacttccgacttcaa의 예 (N가 12 BP 바코드를 나타내는, 대문자의 순서는 Illumina 플랫폼에 필요한, ​​그리고 낮은 경우에 시퀀스는 transposon에 바인딩됩니다.)

Illumina barcoded secon의 예 : 차 PCR 앞으로 곁을 떠나지dary 입문서 5'AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTNNNNNNNNNNNNaAgtgtatgtaaacttccgacttcaa (N가 12 BP 바코드를 나타내는, 대문자의 순서는 Illumina 플랫폼에 필요한, ​​그리고 낮은 경우에 시퀀스는 transposon에 바인딩됩니다.)

오른쪽과 왼쪽 모두 측면에 대한 보조 PCR 역방향 : 링커 중첩 된 역 프라이머 5 'CAAGCAGAAGACGGCATACGAGCTCTTCCGATCTAGGGCTCCGCTTAAGGGAC

  1. +를 단련하고 - BfaI의 linkers와 NlaII linkers 모두 linkers을 링커 - (100 μM)의 50 μl와 링커의 50 μl + (100 μM)를 혼합 의해 1.5 ML의 microcentrifuge 관에 2 μl NaCl을 (5 M) 추가 할 수 있습니다. 95 5 분에 대한 ° C 열 블록의 장소. 가열 블록을 해제하고 (이 시간 이상 소요) 객실 온도에 천천히 시원한 보자. 필요한 때까지 냉각 한 후, annealed linkers는 -20 ° C의 냉동고에 저장 될 수 있습니다.
  2. 종양 DNA의 두 aliquots, DNA 1 μg를 포함하는 각 나누어지는을 준비합니다. 하나 나누어지는이 지혜를 소화 될 것입니다transposon의 "오른쪽"끝으로 아슬 아슬합니다 헥타르 제한 효소. 두 번째 나누어지는이 transposon의 "왼쪽"마지막에 가까운 지경 제한 효소로 소화 될 것입니다. 이것은 모든 transposon 삽입 사이트를 증폭의 가능성을 최대화하기 위해 수행됩니다.
  3. "오른쪽"사이드 효소 NlaII을 이용하여 하나 나누어지는의 종양 DNA를 소화하고 "왼쪽"쪽 효소 BfaI을 사용하여 다른 나누어지는에있는 종양 DNA 소화 : 효소 1 μl, 5 μl 10X 코 버퍼 # 4, DNA를 (결합을 1 μg) 50 μl의 총 볼륨에 ddH 2 O. 37 번 박 다이제스트 DNA ° 물 목욕이나 보육에 C.
  4. 효소를 비활성화 가열 (BfaI = 80 ° C 20 분에, NlaIII = 65 ° C 20 분 용).
  5. MinElute 96 잘 플레이트에 샘플을 배치하여 소화 샘플을 청소, 우물까지 약 15 분에 진공 매니 폴드 및 진공의 장소 플레이트는 건조 봐.
  6. 모든 liqui를 제거하는 진공 매니 폴드 및 종이 타월로 96 잘 접시의 얼룩 바닥에서 판을 제거디
  7. 각도에 30 μl ddH 2 O를 추가하고 2 분 높은에 궤도 셰이커 세트에 흔들, 또는 20-40 배 아래로 피펫합니다.
  8. 깨끗 96 잘 접시에 MinElute 96 잘 접시에서 우물의 전체 볼륨 (30 μl)를 전송합니다.
  9. 단계 4.8 및 4.1 단계에서 linkers에서 소화 DNA와 링커 결합 반응을 수행합니다. 10 μl 소화 DNA, 4 μl 5 배 결합 버퍼, 5.5 μl annealed linkers (950 μg / μl), 0.5 μl T4 ligase를 (5 U / μl) 섞는다.
  10. 16시 밤에 4 시간에 품다 ° C.
  11. 10 분 동안 65 ° C에서 T4 DNA ligase를 비활성화의 가열.
  12. 4.6 - MinElute 96 잘 접시와 같은 단계 4.5에 설명 된 진공 매니 폴드를 사용하여 결합을 청소하십시오.
  13. 30 μl H 2 O에 Resuspend하고 깨끗한 96 잘 판에 전송할 수 있습니다.
  14. concatamer transposons 남아 파괴하기 위해 두 번째 DNA의 소화를 수행합니다. 이 문제는 플라스미드 v를 잘라 효소를 사용하여 DNA 두 번째 절단에 의해 달성된다transposon concatamer를 포함하는 유전자 변형 쥐를 만드는 데 사용 된 ector DNA.
  15. 다이제스트 DNA는 BamHI (왼쪽과 오른쪽 모두 측면)를 사용하여 : 믹스 단계 4.13, 5 μl 10X 코 버퍼 # 3, 0.5 μl BamHI (20 U / μl), 0.5 μl BSA (에서 링커 - 출혈도 잡았 DNA의 25 μl를 10 MG / ML ), 19 μl ddH 2 O.
  16. 37 번 다이제스트 3-6 시간 또는 밤새 ° C.
  17. 링커에 대한 transposon과 프라이머의 특정에 대한 특정 프라이머를 사용하여 기본 PCR을 수행합니다. 이러한 사용중인 transposon와 링커에 따라 달라집니다. 프리 머의 T2/Onc과 T2/Onc2 transposons에 대한 작업 위의 프라이머 표에 나열된.
  18. 차 PCR : 5 μl 10X 버퍼, 2.0 μl MgCl2 (50 ㎜), 4 μl dNTPs (2.5 nm 정도), 1 μl 프라이머 1 (20 μM), 1 μl 프라이머 2 (20 μM), 0.25 μl 플래티넘 DNA 형성 촉매 (5 U / ) μl, linkers있는 3 μl 소화 DNA (금액이 다를 수 있습니다), 최대 50 μl ddH 2 O.
  19. PCR 프로그램 : 94 ° C 5 분, 94의 30주기 ° C 30에 초, 60 & D예를 들어, 30 초에 C, 90 초 72 ° C. 72의 최종 확장 ° C 5 분에.
  20. MinElute 96 잘 접시 위에 설명 된대로 진공 매니 폴드를 사용하여 PCR 제품을 청소하십시오.
  21. 30 μl H 2 O에 Resuspend하고 깨끗한 96 잘 판에 전송할 수 있습니다.
  22. 148 μl ddH 2 O로 단계 4.21에서 DNA의 2 μl를 diluting하여 (1)의 1:75 희석 ° PCR을
  23. 또한 Illumina GAIIx 기계뿐만 아니라 (이 프리 머의 예에 대한 위의 프라이머 표를 참조) 처리 각 종양 샘플에 대한 고유 12 기본 쌍 바코드에 필요한 순서를 가지고있는 프리 머의 중첩 된 버전을 사용하여 보조 PCR을 수행합니다.
  24. 차 PCR : MgCl2을 갖춘 10 μl 10X 버퍼, 8 μl dNTPs (2.5 ㎜), 1 μl Illumina 보조 프라이머 (20 μM), 1 μl Illumina의 둥지 1 차 프라이머 (20 μM), 0.25 μl FastStart DNA 형성 촉매를 (barcoded 5 U / μl ), 차 PCR 희석 1:75에서 2 μl DNA, 최대 100 μl ddH 2 O.
  25. PCR 프로그램 : 94 °, 2 분을위한 C, 90 초에 45 초, 72 ° C 30 초, 53 ° C에 94 ° C의 30주기. 72의 최종 확장 ° C 5 분에.
  26. ethidium 브로마이드 (0.5 μg / ML)를 포함하는 1 % 아가로 오스 겔에서이 PCR 반응의 45 μl를 실행합니다. 종양의 여러 가지 transposon의 삽입 (그림 3)의 amplicons을 대표하는 PCR 제품의 "비방"이 있어야합니다.
  27. MinElute 96 잘 접시 위에 설명 된대로 진공 매니 폴드를 사용하여 PCR 제품의 나머지 50 μl를 청소합니다. 우물에서 50 μl ddH 2 O를 배치 한 후 다시 진공 청소기로 청소하여 한 번 씻으십시오.
  28. 30 μl TE에 Resuspend하고 깨끗한 96 잘 판에 전송할 수 있습니다.
  29. 각 샘플에 DNA의 농도를 결정합니다. 하나의 1.5 ML의 microfuge 관 DNA의 동등한 양의 조화를 이루고 있습니다. 이 Illumina HiSeq 2000 시스템의 단일 차선으로 순서가되어있는 라이브러리 될 것입니다. 이 Illumina 실행의 단일 차선에서 순서 수백 종양을 할 수 있습니다.
  30. 제출시퀀싱에 대한 모든 종양에서 DNA의 동등한 양을 포함하고있는 단일 관. 이는 기관이나 상업적으로 수행 할 수 있습니다.

5. Transposon에 삽입 분석

  1. transposon 삽입 데이터를 분석 소프트웨어는 소스 포지 (를 통해 무료로 다운로드 할 수 있습니다 http://sourceforge.net/projects/tapdancebio/ ). TapDance라는 프로그램은, Illumina 플랫폼과 라이브러리지도 텍스트 파일에 바코드에서 시퀀스 파일이 필요합니다.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

번식 체계가 설립 된 후, 브마다 19~21일 쓰레기를 생산해야합니다. 쓰레기 크기는 브 및 유전 배경의 연령에 따라, 5 사이 12 새끼를 달라집니다. 또한, 쓰레기의 유전자형이 번식 체계가 정확하고 성공적인 모두 있는지 확인하는 방법으로 Mendelian 유전학을 준수하는지 확인하십시오.

실험이 성공하기 위해서는 실험 동물의 종양 발병률은 제어 동물에서 종양 발생률보다 훨씬 커야한다. 더 "predisposing"돌연변이가 실험에 포함되지 않은 경우 제어 동물의 종양에 몇 가지가 있어야합니다. "predisposing"변이가 실험에 포함 된 경우,이 동물의 종양 발병률은 돌연변이와 SB 활동과 동물의 발생보다 훨씬 낮을 수 있습니다.

LM-PCR은 단일 종양에 transposon의 삽입 수백 증폭해야합니다. 헥타르를 실행 한 후1 % 젤의 보조 PCR 제품의면이 증폭를 대표하는 DNA의 "비방"(그림 3)가 있어야합니다. 하나 또는 두 개의 밴드가있는 경우, SB 하나는 종양에 적극적으로되지 않았거나 오류가 (그림 4) 프로토콜에 만들어졌습니다.

Illumina GAIIx 플랫폼의 단일 차선 1-200 종양 시퀀싱이 100 BP 각 (그림 5) 3 천만 시퀀스를 통해 생산해야합니다.

표 1. 시약 섹션 2 필요합니다.

표 2. 시약 섹션 3 필요합니다.

표 3. 시약 섹션 4 필요합니다.

그림 1
1 그림. 단계를 보여주는 플로우 차트잠자는 숲속의 미녀 시스템을 사용하여 앞으로 유전 화면을 수행 할 수 있습니다. 먼저, 마우스 모델이 생성됩니다. 죽어가는 그리고 종양이 수집 분리 할 때 마우스 그런 다음 necropsied 있습니다. 종양 DNA는 정화되고 링커 매개-PCR이 수행됩니다. 마지막으로, transposon의 삽입과 증폭 종양 DNA는 순서가 및 일반 삽입 사이트는 식별됩니다.

그림 2
그림 2. 실험 일대를 생성하는 방식을 사육. transposase (Rosa26-LsL-SB11)를 포함하는 마우스는 transposons (T2-ONC)의 concatamer을 품고 마우스에 발을 담그 있습니다. 자손 그런 다음 Cre Recombinase (Cre)를 구동 지정된 조직 특정 발기인을 들고 마우스로 결합되어 있습니다.

그림 3
그림 3. 대표하는차 PCR의 결과입니다. 예상 제품 외관은 100에서 600 기본 쌍에 이르기까지 같은 얼룩이 있습니다.

그림 4
LM-PCR에 실패 할 경우 그림 4., DNA의 '비방'의 부재가있을 것입니다. 대신에, 당신은 DNA의 결정적인 밴드를 볼 수 있습니다.

그림 5
Illumina GAIIx 플랫폼의 단일 차선을 보여 시퀀싱 실행에서 그림 5. 예를 들어 데이터 100 기본 쌍을 각각 3 천만 시퀀스를 통해 생산해야합니다.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

잠자는 숲속의 미녀 transposon 시스템을 사용하여 앞으로 유전자 화면은 원인 암 변이를 식별하는 방법을 제공합니다. 모든 predisposing 변이에 추가 Cre Recombinase를 제어 할 수있는 적절한 프로모터를 선택하면, SB 화면이 알려져 파악하고 새로운 후보 암 유전자 것입니다.

SB 화면의 성공은 화면을 만들 때 선택한 마우스에 달려 있습니다. transposon를 들어, 우리는 서로 다른 염색체 7 일 종양 발생 transposons의 concatamer을 가진 두 개의 서로 다른 마우스 변종을 사용하는 것이 좋습니다. SB의 transposase을 활성화합니다 조직 별 Cre의 Recombinase을 선택할 때 조심스럽게 생각 사용해야합니다. Cre 효소가 모델로되는 암의 기원 세포되고 의심​​되는 세포 유형에서 활성화되어 있다는 증거가 있어야합니다. 성공적인 예는 Villin-Cre (GI 기관 암), 알부민-Cre을 (간세포 carcinom 포함) 및 보조 - Cre (림프종). 8-10

성공적으로 화면에 필요한 마우스의 수는 종양 penetrance에 따라 달라집니다. 일반적으로 더 많은 종양 등 마우스는보다 강력한 화면에 발생합니다. 암 대기 시간의 2 배의 차이를 감지 할 수 최소 60 동물 제어 및 실험 그룹이 모두 거기에 있어야합니다. 11

이 화면의 다양한 자연은 하나, 질병의 특성을 지정 진행을 따라, 그리고 유전 성분을 분석 할 수 있다는 점에서 다른 기술에 관련하여 강력하다. 이 기술은 새로운 잠재 암 운전 유전자를 식별 CIS 목록을 굴복 한 화면의 숫자에 성공했다. 이 정보 지향성 연구는 이러한 소설 변이의 기능을 이해하기 위해 수행 할 수 있습니다. 전반적으로,이 기술의 사용은 이러한 특정 유전자 무타의 결과를 제거하기위한 새로운 약물 요법의 최종 디자인으로 이어질 수 있습니다tions.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

저자는 공개 할 수 없어요.

Acknowledgments

저자는 프로토콜 위에서 설명한 개발에서의 도움 아이오와 대학에서 미네소타 대학에서 Branden의 Moriarity, 데이비드 Largaespada, 그리고 빈센트 켕에게 감사를, 그리고 아담 Dupuy 것입니다.

Materials

Name Company Catalog Number Comments
Sure-Seal Induction Chamber Brain Tree Scientific EZ-177
Cryovial Bioexpress C-3355-2
10% Buffered Formalin Sigma Aldrich HT501128-4L
Protein Precipitation solution Qiagen 158910
Cell lysis buffer Qiagen 158906
Proteinase K Qiagen 158920
RNase A Qiagen 158924
TE Buffer Promega V6232
BfaI New England Biolabs R0568S
NlaIII New England Biolabs R0125S
MinElute 96 well plates Qiagen 28051
QIAvac 96 Vacuum manifold Qiagen 19504
Multi-MicroPlate Genie, 120V Scientific Industries, Inc. SI-4000
T4 DNA ligase with 5x ligation Buffer Invitrogen 15224-041
BamHI New England Biolabs R0136S
25mM dNTPs Bioexpress C-5014-200
Platinum Taq Invitrogen 10966-034
FastStart Taq DNA Polymerase Roche 12032929001
Agarose Promega V3121
TAE Buffer Promega V4271
TE Buffer Promega V6232
Ethidium bromide Promega H5041

DOWNLOAD MATERIALS LIST

References

  1. Fearon, E. R., Vogelstein, B., et al. A genetic model for colorectal tumorigenesis. Cell. 61, 759-767 (1990).
  2. Wood, L. D., et al. The Genomic Landscapes of Human Breast and Colorectal Cancers. Science. 318, 1108-1113 (2007).
  3. Ivics, Z., Hackett, P. B., Plasterk, R. H., Izsvák, Z. Molecular Reconstruction of Sleeping Beauty, a Tc1-like Transposon from Fish, and Its Transposition in Human Cells. Cell. 91, 501-510 (1997).
  4. Starr, T. K., Largaespada, D. A. Cancer gene discovery using the Sleeping Beauty transposon. Cell Cycle. 4, 1744-1748 (2005).
  5. Mueller, P. R., Wold, B. In Vivo Footprinting of a Muscle Specific Enhancer by Ligation Mediated PCR. Science. 246, 780-786 (1989).
  6. Bergemann, T. L., et al. New methods for finding common insertion sites and co-occurring common insertion sites in transposon- and virus-based genetic screens. Nucleic acids research. 40, 3822-3833 (2012).
  7. Copeland, N. G., Jenkins, N. A. Harnessing transposons for cancer gene discovery. Nature Reviews Cancer. 10, 696-706 (2010).
  8. Collier, L. S., Carlson, C. M., Ravimohan, S., Dupuy, A. J., Largaespada, D. A. Cancer gene discovery in solid tumours using transposon-based somatic mutagenesis in the mouse. Nature. 436, 272-276 (2005).
  9. Starr, T. K., et al. A transposon-based genetic screen in mice identifies genes altered in colorectal cancer. Science. 323, 1747-1750 (2009).
  10. Keng, V. W., et al. A conditional transposon-based insertional mutagenesis screen for genes associated with mouse hepatocellular carcinoma. Nature. 27, 264-274 (2009).
  11. Dupuy, A. J., Akagi, K., Largaespada, D. A., Copeland, N. G., Jenkins, N. A. Mammalian mutagenesis using a highly mobile somatic Sleeping Beauty transposon system. Nature. 436, 221-226 (2005).
의 식별<em&gt; 잠자는 숲속의 미녀</em링커로 인한 PCR을 사용하여 고체 종양의&gt; Transposon의 삽입
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Janik, C. L., Starr, T. K. Identification of Sleeping Beauty Transposon Insertions in Solid Tumors using Linker-mediated PCR. J. Vis. Exp. (72), e50156, doi:10.3791/50156 (2013).More

Janik, C. L., Starr, T. K. Identification of Sleeping Beauty Transposon Insertions in Solid Tumors using Linker-mediated PCR. J. Vis. Exp. (72), e50156, doi:10.3791/50156 (2013).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter