Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Medicine

Идентификация doi: 10.3791/50156 Published: February 1, 2013

Summary

Метод идентификации неизвестных водителей канцерогенеза использованием беспристрастный подход описан. Метод использует

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. Разведение и старение трансгенных животных

  1. Выберите штаммов трансгенных мышей подходит для вашего эксперимента. Типичный эксперимент будет использовать три трансгенные линии, условно транспозазы мыши, мыши укрывательство concatamer транспозонов, и мышь выражения Cre рекомбиназой в клетках Считается, что клетки происхождения желаемого рака. Если рак моделируемой имеет известную мутацию в большой процент пациентов может быть желательно, чтобы включить эту мутацию в самом начале. Примерами таких "предрасполагающих" мутации включают активированный Kras, доминантный негативный TP53 или floxed аллель Pten. При добавлении в предрасполагающие мутации модель может лучше представлять рака у человека (см. п. 1.3). Несколько транспозазы Спящая красавица и транспозонов мышей доступны из Национального института рака мышей хранилища ( http://mouse.ncifcrf.gov/ ).
  2. Порода условного транспозазы мышей с мышами, укрывательство транспозонов, чтобы в конечном итоге получить мышей, гомозиготных по аллели и если это возможно. Порода гомозиготных потомства мышей, экспрессирующих Cre рекомбиназой для создания своих тройной трансгенных подопытных мышей (рис. 2). Примечание: Получение гомозиготных мышей, не всегда возможно или идеал. Например, гомозиготных p53 доминирующего отрицательного мышей гораздо труднее, чем разводить гетерозиготных мышей. Кроме того, было бы полезно, чтобы убедиться, что помет следует генетики Менделя, чтобы подтвердить, что разведение схема успешно.
  3. При использовании предрасположены фон, в первую мышах породы с транспозазы мышам с предрасполагающих аллелей. Одновременно породу мышей, экспрессирующих Cre рекомбиназой для мышей, несущих транспозонов. Создать гомозиготных мышей для каждого аллеля если это возможно. Наконец, разводить гомозиготных потомство от двух предыдущих схем размножения для создания трансгенных четверка Аним экспериментальныхALS.
  4. В дополнение к экспериментальным животным, генерировать управления когорты мышей. Контрольная группа обычно состоит из помета от экспериментального разведения, что наследовать только два из трех аллелей (рис. 2). В случае предрасположены фон, мышами в том числе три из четырех аллелей также будет необходимо.
  5. Мониторинг экспериментальных и контрольных мышей ежедневно развития опухоли и / или moribundity. Следуй за своей институциональной и использования животных комитета (IACUC) требования к животноводству. Кроме того, он является типичным для определения возраста, в котором вы будете принести в жертву животное, если оно еще не стало умирающим. Восемнадцать месяцев типичный возраст, в котором мышей эвтаназии.

2. Аутопсия трансгенных животных

Название реагента Компания Номер в каталоге
Sure-Seal Inducния палата Мозг дерево Научные EZ-177
Криопробирку Bioexpress C-3355-2
10% буферном растворе формалина Sigma Aldrich HT501128-4L

Таблица 1. Реагенты требуется.

  1. Когда мышь умирает или уже достигли конца определена продолжительность жизни, эвтаназии животных с использованием CO 2 камере после вашего IACUC руководящих принципов. Как правило, поместить животное в чистую газовую камеру, открыть бензобак и настроить регулятор читать не выше 5 фунтов на квадратный дюйм. Заполните медленно, чтобы свести к минимуму носа и раздражение глаз и отвращение к CO 2. Убедитесь, что сердце животного больше не избивали и не реагирует при прикосновении в глаза.
  2. Спрей внешности жертву мышь с 70% этанола.
  3. Место мыши на вскрытии плате и закрепить рассекает контакты. Используйте ножницыг пинцет, чтобы открыть мыши и удалить органах. Определение того, какие органы должны быть собраны, проект завис. Тем не менее, рекомендуется всегда собирают селезенки и печени, так как эти органы часто дают важную информацию, почему мышь умирает. Также собираем грудины для потенциального анализа костного мозга. Кроме того, это всегда полезно для сбора любого органа или ткани, который появляется ненормальный.
  4. Тканей и опухолей, которые собираются должно быть разделено на четыре части. Одна часть фиксируется в 10% буферном растворе формалина в течение 18 часов с последующим 70% этанола. В этом разделе могут быть использованы для H & E окрашивание и / или IHC. Остальные три секции, которые, как правило, от 50 до 100 мг в размерах, которые замораживали в жидком азоте. Они могут быть использованы для ДНК, РНК и белков изоляции.
  5. Утилизация туш и оставшиеся ткани в соответствии с руководящими принципами IACUC.

3. Изоляция геномной ДНК из опухоли

<сильная Name> реагента Компания Номер в каталоге
Решение осаждения белков Qiagen 158910
Сотовые лизис буфера Qiagen 158906
Протеиназы K Qiagen 158920
РНКазы Qiagen 158924
TE буфера Promega V6232

Таблица 2. Реагенты требуется.

  1. Мелко фарш замороженных образцов опухоли (50 до 100 мг), используя чистые лезвия бритвы.
  2. Место измельченной ткани в 1,5 мл трубки микроцентрифужных и добавьте 1 мл клеточного буфера для лизиса, содержащего 5 мкл протеиназы К раствор (20 мг / мл).
  3. Vortex тщательно.
  4. Инкубируйте в 55 ° C шейкере установлено на уровне 250 оборотов в минуту в течение 4 часов, желательно на ночь.
  5. Добавить 1 мкл РНКазы раствора (10 мг / мл) и инвертировать трубки 25 раз.
  6. Инкубировать при 37 ° С в течение 30 мин.
  7. Остудить до комнатной температуры путем размещения на льду в течение 3 мин.
  8. Добавить 333 мкл раствора Осадки белков и вихревые энергично.
  9. Центрифуга при 14000 оборотов в минуту 10 мин. Белки должны гранул. Если гранулы очень мало, вихрь снова, инкубировать на льду в течение 5 минут, а затем повторно центрифуги.
  10. Слейте супернатант, содержащий ДНК в чистую пробирку для центрифугирования 15 мл.
  11. Добавить равном объеме 100% изопропанола и смешать, аккуратно обращения 50 раз.
  12. Центрифуга при 3500 оборотов в минуту в течение 3 минут.
  13. Удалите супернатант.
  14. Добавить 1 мл 70% этанола и инвертировать трубку несколько раз мыть гранул.
  15. Передача промытый осадок вместе с этанолом, 1,5 мл микроцентрифужных трубку.
  16. Центрифуга при 14000 оборотов в минуту в течение 5 мин при 4 ° C.
  17. Вылейте этанола и инвертировать трубку воздух сухой (примерно от 5 до 30 мин.)
  18. Ресуспендируют ДНК-рВ Ellet 50 до 500 мкл ТЕ в зависимости от размера гранул ДНК.
  19. Дополнительно инкубации при 37 ° C для ресуспендирования ДНК.
  20. Хранить при температуре 4 ° C или -20 ° C для длительного хранения.

4. Linker опосредованной-PCR с использованием геномной ДНК из опухоли

Название реагента Компания Номер в каталоге
BFAI New England Biolabs R0568S
NlaIII New England Biolabs R0125S
MinElute 96-луночные планшеты Qiagen 28051
QIAvac 96 Вакуумная Qiagen 19504
Multi-микропланшетов Genie, 120В Научно Industries, Inc SI-4000
T4 ДНК-лигазы с 5-кратным буфера лигирования Invitrogen 15224-041
BamHI New England Biolabs R0136S
25 мМ дНТФ Bioexpress C-5014-200
Платиновая Taq Invitrogen 10966-034
FastStart Taq ДНК-полимеразы Roche 12032929001
Агароза Promega V3121
TAE буфер Promega V4271
TE буфера Promega V6232
Бромистый этидий Promega H5041

Таблица 3. Реагенты требуется.

Linker Последовательности

BFAI компоновщик + 5 'GTAATACGACTCACTATAGGGCTCCGCTTAAGGGAC 3'

BFAI линкер-5 'Phos-TAGTCCCTTAAGCGGAG 3'NH2

"> NlaIII компоновщик + 5'GTAATACGACTCACTATAGGGCTCCGCTTAAGGGACCATG 3 '

NlaIII линкер-5 'Phos-GTCCCTTAAGCGGAGCC 3'

Праймеров

Первичный ПЦР вперед правой стороны (NlaIII): SPL IRDR R1 1 GCTTGTGGAAGGCTACTCGAAATGTTTGACCC

Первичный ПЦР вперед левой стороне (BFAI): SPL IRDR L1 1 CTGGAATTTTCCAAGCTGTTTAAAGGCACAGTCAAC

Первичный обратной ПЦР для правой и левой стороны: Spl Link1 1 GTAATACGACTCACTATAGGGC

Вторичный ПЦР вперед правой стороны: Пример Illumina штрих вторичной грунтовки 5 'AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTNNNNNNNNNNNNaGgtgtatgtaaacttccgacttcaa (N представляют 12 б.п. штрих-код, последовательность в верхнем регистре, необходимых для Illumina платформы, и последовательность в нижнем регистре будет связываться с транспозонов).

Вторичный ПЦР вперед левой стороне: Пример Illumina штрих вторичныхДары грунтовки 5'AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTNNNNNNNNNNNNaAgtgtatgtaaacttccgacttcaa (N представляют 12 б.п. штрих-код, последовательность в верхнем регистре, необходимых для Illumina платформы, и последовательность в нижнем регистре будет связываться с транспозонов).

Вторичный обратной ПЦР для правой и левой стороны: компоновщик вложенных обратный праймер 5 'CAAGCAGAAGACGGCATACGAGCTCTTCCGATCTAGGGCTCCGCTTAAGGGAC

  1. Отжиг + и - линкеров для линкеры BFAI и NlaII линкеры путем смешивания 50 мкл компоновщик + (100 мкм) с 50 мкл линкер-(100 мкМ) и добавляют 2 мкл NaCl (5 м) в 1,5 мл микроцентрифужных трубку. Место в 95 ° C тепла блока в течение 5 мин. Отключите нагревательный блок и пусть медленно охлаждают до комнатной температуры (это занимает час и более). После охлаждения отожженной линкеров может храниться в морозильной камере -20 ° C до необходимости.
  2. Приготовьте две порции опухоли ДНК, каждая из аликвоты, содержащие 1 мкг ДНК. Один аликвоты будет переварена остроумиега, рестриктазы, что позволит сократить близкий к "правильным" конца транспозонов. Вторая аликвота будет расщепляли ферментом рестрикции, что сокращение близкий к "левым" конца транспозонов. Это сделано, чтобы максимально повысить шансы на усиление каждого сайта транспозона вставки.
  3. Дайджест опухоли ДНК в одной аликвоты использованием "правильной" стороне фермента NlaII, и переваривать опухоли ДНК в другие аликвоты помощью клавиш «влево» стороне фермента BFAI: смешайте 1 мкл фермента, 5 мкл 10х буфера NEB № 4, ДНК ( 1 мкг) и DDH 2 O в общем объеме 50 мкл. Дайджест ДНК в течение ночи при 37 ° С в водяной бане или инкубатор.
  4. Нагрейте инактивации ферментов (BFAI = 80 ° C в течение 20 мин, NlaIII = 65 ° С в течение 20 мин).
  5. Очистите усваиваются образцы, помещая образцы в MinElute 96-луночный планшет, место пластину в многообразии вакуума и вакуума в течение приблизительно 15 минут, пока скважин выглядят сухими.
  6. Удалите пластину из коллектора вакуум и пятно нижней части 96-луночный планшет с бумажным полотенцем, чтобы удалить все Liquiре
  7. Добавить 30 мкл DDH 2 O в каждую лунку и встряхивают на множестве орбитальный шейкер на высоко в течение 2 мин, или пипетки вверх и вниз от 20 до 40 раз.
  8. Передача весь объем в скважинах (30 мкл) из MinElute 96-луночный планшет в чистую 96-луночных планшетах.
  9. Выполните компоновщик реакции лигирования с расщепленной ДНК с шагом 4,8 и линкеры с шагом 4.1. Смешать 10 мкл ДНК переваривается, 4 мкл 5х буфера лигирования, 5,5 мкл отожженной линкеры (950 мкг / мкл), 0,5 мкл лигазы Т4 (5 ед / мкл).
  10. Выдержите в течение 4 часов в течение ночи при 16 ° C.
  11. Нагрейте инактивации ДНК-лигазы Т4 при 65 ° С в течение 10 мин.
  12. Очистка перевязки использованием MinElute 96-луночные планшеты и вакуумный коллектор как описано в пунктах 4.5 - 4.6.
  13. Ресуспендируют в 30 мкл H 2 O и перенести в чистую 96-луночный планшет.
  14. Выполнить второй пищеварение ДНК для того, чтобы уничтожить оставшиеся concatamer транспозонов. Это достигается путем разрезания ДНК второй раз с использованием фермента, который разрезает плазмиду VЭктор ДНК, который был использован для создания трансгенных мышей, содержащих транспозонов concatamer.
  15. Дайджест ДНК с использованием BamHI (слева и справа): смешать 25 мкл линкер-Лигированную ДНК с шагом 4.13, 5 мкл 10х буфера NEB № 3, 0,5 мкл BamHI (20 ед / мкл), 0,5 мкл BSA (10 мг / мл ), и 19 мкл DDH 2 O.
  16. Дайджест 3-6 часа или на ночь при 37 ° C.
  17. Выполните первичной ПЦР с использованием праймеров, специфичных для транспозонов и праймера, специфичных для компоновщика. Они будут варьироваться в зависимости от того, транспозонов и компоновщик вы используете. Праймеров, перечисленных в таблице выше грунтовки работы на T2/Onc и T2/Onc2 транспозонов.
  18. Первичный ПЦР: 5 мкл 10х буфера, 2,0 мкл MgCl2 (50 мМ), 4 мкл дНТФ (2,5 нМ), 1 мкл Primer 1 (20 мкм), 1 мкл праймера 2 (20 мкм), 0,25 мкл Taq Платиновый (5 U / мкл), 3 мкл расщепленной ДНК с линкеры (сумма может варьироваться), до 50 мкл DDH 2 O.
  19. ПЦР программе: 94 ° C в течение 5 мин, 30 циклов 94 ° C в течение 30 сек, 60 и Dнапример, C в течение 30 сек, 72 ° С в течение 90 сек. Окончательное удлинение при 72 ° C в течение 5 мин.
  20. Очистите PCR продукта с использованием MinElute 96-луночные планшеты и вакуумный коллектор, как описано выше.
  21. Ресуспендируют в 30 мкл H 2 O и перенести в чистую 96-луночный планшет.
  22. Сделать 1:75 разбавление 1 ° ПЦР путем разбавления 2 мкл ДНК шаг 4,21 на 148 мкл DDH 2 O
  23. Выполните вторичной PCR с использованием вложенных версии праймеров, которые также имеют необходимую последовательность для Illumina машины GAIIx, а также в 12 пар оснований, что штрих-код является уникальным для каждого образца опухоли обработаны (см. таблицу выше грунтовку для примера этих праймеров).
  24. Вторичный ПЦР 10 мкл 10х буфера с MgCl2, 8 мкл дНТФ (2,5 мм), 1 мкл Illumina штрих вторичной грунтовки (20 мкм), 1 мкл Nest Illumina 1 вторичная грунтовка (20 мкм), 0,25 мкл Taq FastStart (5 ед / мкл ), 2 мкл ДНК из первичных ПЦР разбавленной 1:75, до 100 мкл DDH 2 O.
  25. ПЦР программе: 94 °, С в течение 2 мин, 30 циклов при 94 ° C в течение 30 сек, 53 ° С в течение 45 сек, 72 ° C в течение 90 сек. Окончательное удлинение при 72 ° C в течение 5 мин.
  26. Выполнить 45 мкл этой реакции ПЦР на 1% агарозном геле, содержащем бромистый этидий (0,5 мкг / мл). Там должно быть "размазать" продуктов ПЦР представляет ампликонов из многих различных вставками транспозонов в опухоли (рис. 3).
  27. Очистите оставшиеся 50 мкл продукта ПЦР с использованием MinElute 96-луночные планшеты и вакуумный коллектор, как описано выше. Мыть один раз путем размещения 50 мкл DDH 2 O в скважинах и пылесосить раз.
  28. Ресуспендируют в 30 мкл TE и перенести в чистую 96-луночный планшет.
  29. Определение концентрации ДНК в каждой пробе. Комбинат равных количеств ДНК в одной трубе микроцентрифуге 1,5 мл. Это будет библиотека, которая последовательно в одну полосу Illumina HiSeq 2000 машин. Можно последовательности нескольких сотен опухоли в одной полосе Illumina перспективе.
  30. Представлятьодной трубки, содержащей равные количества ДНК от всех опухолей для секвенирования. Это может быть сделано по вашей организации или в коммерческих целях.

5. Анализ вставками транспозонов

  1. Программное обеспечение для анализа транспозона вставки данных доступна для бесплатного скачивания через SourceForge ( http://sourceforge.net/projects/tapdancebio/ ). Программа под названием TapDance, требуется последовательность файлов из Illumina платформы и штрих-код библиотеки текстовый файл карты.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

После разведения схема была создана, заводчики должны производить мусор каждые 19-21 дней. Помет размер будет варьироваться от 5 до 12 детенышей, в зависимости от возраста заводчиков и генетического фона. Кроме того, убедитесь, что генотип помета следует генетики Менделя как способ подтвердить, что разведение схема правильным и успешным.

Для эксперимента были успешными, опухолей у подопытных животных должно быть значительно больше, чем опухолей у контрольных животных. Если нет "предрасполагающих" мутация была включена в эксперимент не должно быть мало, чтобы не опухолей у контрольных животных. Если "предрасполагающих" мутация была включена в эксперимент, опухолей у этих животных должно быть значительно ниже, чем заболеваемость у животных с мутацией и SB деятельности.

LM-PCR должны усиливать сотни транспозона вставок в одной опухоли. После запуска гаLF вторичных продуктов ПЦР на 1% гель, не должно быть "размазать" ДНК, представляющий этот усиления (рис. 3). Если есть только одна или две полосы, либо SB не был активным в опухоль или была допущена ошибка в протоколе (рис. 4).

Секвенирование ста до двухсот опухоли в одной полосы движения на платформе Illumina GAIIx должна производить более 30 миллионов последовательностей 100 б.п. каждая (рис. 5).

Таблица 1. Реагенты для раздела 2.

Таблица 2. Реагенты для раздела 3.

Таблица 3. Реагенты для раздела 4.

Рисунок 1
Рисунок 1. Схема, иллюстрирующая этапыпровести генетическую вперед экране с помощью Спящая красавица системы. Во-первых, модель мыши генерируется. Мыши, затем вскрытие, когда умирающий и опухоли собраны и изолированы. Опухоль ДНК очищают и компоновщик опосредованный-ПЦР выполняется. Наконец, усиливается опухоли ДНК со вставками транспозонов секвенируют и общие сайты вставки определены.

Рисунок 2
Рисунок 2. Разведение схемы для создания экспериментальной группе. Мышей, содержащих транспозазы (Rosa26-LSL-SB11) пересекаются мышей укрывательство concatamer транспозонов (T2-ОНК). Потомства, то в паре с мышей, несущих назначенный ткани промотора приводом Cre рекомбиназой (CRE).

Рисунок 3
Рисунок 3. ПредставительРезультаты вторичного ПЦР. ожидаемый продукт имеет мазков, как внешний вид в пределах от 100 до 600 пар оснований.

Рисунок 4
Рисунок 4. Если LM-ПЦР является неудачным, будет отсутствие "размазать" ДНК. Вместо этого, вы увидите окончательный полос ДНК.

Рисунок 5
Рисунок 5. Пример данных из последовательности выполнения, который демонстрирует одну полосу Illumina платформы GAIIx должна производить более 30 миллионов последовательностей из 100 пар оснований каждый.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Вперед генетические экран с помощью Спящая красавица транспозона система предоставляет метод для выявления мутаций, которые вызывают рак. Выбрав соответствующий промотор для управления Cre рекомбиназой в дополнение к любой предрасполагающие мутации, на экране SB будет определять известных и новых генов-кандидатов рака.

Успех экране SB во многом зависит от мышей выбран для создания экрана. Для транспозонов, мы рекомендуем использовать два различных линий мышей проведение concatamer онкогенных транспозонов на разных хромосомах 7. Тщательное внимание должно быть использовано при выборе ткани конкретных Cre рекомбиназой, которые будут активировать транспозазы SB. Там должны быть доказательства того, что фермент Cre активен в тип клеток, которые подозреваются в клетке происхождения рака моделируется. Успешные примеры включают Villin-Cre (рак желудочно-кишечного тракта), Альбумин-Cre (гепатоцеллюлярной carcinomа), а Aid-Cre (лимфома). 8-10

Число мышей, необходимых для успешного экрана будет зависеть от опухоли пенетрантностью. В целом, более опухолей и больше мышей приведет к более надежным экраном. Для обнаружения в 2-х кратную разницу в рак задержка должна быть не менее 60 животных как в контрольной и экспериментальной групп 11.

Универсальный характер этих экранов является мощным в отношении других методов, которые можно определить характер заболевания, следуйте прогрессии, и анализ генетического состава. Эта техника была успешной в число экранов, которые дали СНГ списки, определить новые потенциальные гены рака вождения. Обладая этой информацией, направленной исследования могут быть выполнены, чтобы понять функции этих новых мутаций. В целом, использование этого метода может привести в конечном итоге к разработке новых лекарственной терапии, направленных на устранение результатов этих специфических генетических мутацийных.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Авторы не имеют ничего раскрывать.

Acknowledgments

Авторы хотели бы поблагодарить Branden Мориарти, Дэвид Largaespada, и Винсент Keng в Университете Миннесоты, и Адам Дюпюи в Университете штата Айова за их помощь в разработке протокола, описанного выше.

Materials

Name Company Catalog Number Comments
Sure-Seal Induction Chamber Brain Tree Scientific EZ-177
Cryovial Bioexpress C-3355-2
10% Buffered Formalin Sigma Aldrich HT501128-4L
Protein Precipitation solution Qiagen 158910
Cell lysis buffer Qiagen 158906
Proteinase K Qiagen 158920
RNase A Qiagen 158924
TE Buffer Promega V6232
BfaI New England Biolabs R0568S
NlaIII New England Biolabs R0125S
MinElute 96 well plates Qiagen 28051
QIAvac 96 Vacuum manifold Qiagen 19504
Multi-MicroPlate Genie, 120V Scientific Industries, Inc. SI-4000
T4 DNA ligase with 5x ligation Buffer Invitrogen 15224-041
BamHI New England Biolabs R0136S
25mM dNTPs Bioexpress C-5014-200
Platinum Taq Invitrogen 10966-034
FastStart Taq DNA Polymerase Roche 12032929001
Agarose Promega V3121
TAE Buffer Promega V4271
TE Buffer Promega V6232
Ethidium bromide Promega H5041

DOWNLOAD MATERIALS LIST

References

  1. Fearon, E. R., Vogelstein, B., et al. A genetic model for colorectal tumorigenesis. Cell. 61, 759-767 (1990).
  2. Wood, L. D., et al. The Genomic Landscapes of Human Breast and Colorectal Cancers. Science. 318, 1108-1113 (2007).
  3. Ivics, Z., Hackett, P. B., Plasterk, R. H., Izsvák, Z. Molecular Reconstruction of Sleeping Beauty, a Tc1-like Transposon from Fish, and Its Transposition in Human Cells. Cell. 91, 501-510 (1997).
  4. Starr, T. K., Largaespada, D. A. Cancer gene discovery using the Sleeping Beauty transposon. Cell Cycle. 4, 1744-1748 (2005).
  5. Mueller, P. R., Wold, B. In Vivo Footprinting of a Muscle Specific Enhancer by Ligation Mediated PCR. Science. 246, 780-786 (1989).
  6. Bergemann, T. L., et al. New methods for finding common insertion sites and co-occurring common insertion sites in transposon- and virus-based genetic screens. Nucleic acids research. 40, 3822-3833 (2012).
  7. Copeland, N. G., Jenkins, N. A. Harnessing transposons for cancer gene discovery. Nature Reviews Cancer. 10, 696-706 (2010).
  8. Collier, L. S., Carlson, C. M., Ravimohan, S., Dupuy, A. J., Largaespada, D. A. Cancer gene discovery in solid tumours using transposon-based somatic mutagenesis in the mouse. Nature. 436, 272-276 (2005).
  9. Starr, T. K., et al. A transposon-based genetic screen in mice identifies genes altered in colorectal cancer. Science. 323, 1747-1750 (2009).
  10. Keng, V. W., et al. A conditional transposon-based insertional mutagenesis screen for genes associated with mouse hepatocellular carcinoma. Nature. 27, 264-274 (2009).
  11. Dupuy, A. J., Akagi, K., Largaespada, D. A., Copeland, N. G., Jenkins, N. A. Mammalian mutagenesis using a highly mobile somatic Sleeping Beauty transposon system. Nature. 436, 221-226 (2005).
Идентификация<em&gt; Спящая красавица</em&gt; Транспозонов вставки в твердых опухолей с использованием Linker-опосредованного ПЦР
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Janik, C. L., Starr, T. K. Identification of Sleeping Beauty Transposon Insertions in Solid Tumors using Linker-mediated PCR. J. Vis. Exp. (72), e50156, doi:10.3791/50156 (2013).More

Janik, C. L., Starr, T. K. Identification of Sleeping Beauty Transposon Insertions in Solid Tumors using Linker-mediated PCR. J. Vis. Exp. (72), e50156, doi:10.3791/50156 (2013).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter