Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Biology

Oppdager Somatiske genetiske forandringer i vevsprøver av Exon Capture og massivt parallelle Sekvense

doi: 10.3791/50710 Published: October 18, 2013

Summary

Vi beskriver utarbeidelse av strekkode DNA biblioteker og påfølgende hybridisering basert ekson fangst for påvisning av viktige kreftassosierte mutasjoner i kliniske vevsprøver av massivt parallelle "neste generasjon" sekvensering. Målrettet exon sekvense tilbyr fordelene med høy gjennomstrømning, lav kostnad, og dyp-sekvens dekning, noe som gir høy følsomhet for påvisning av lavfrekvente mutasjoner.

Abstract

Arbeidet med å avdekke og etterforske viktige onkogene mutasjoner har vist seg verdifullt å legge til rette for riktig behandling for kreftpasienter. Etableringen av høy gjennomstrømning, har massivt parallelle "neste-generasjons" sekvense hjulpet oppdagelsen av mange slike mutasjoner. For å styrke den kliniske og translasjonell nytte av denne teknologien, må plattformene være høy gjennomstrømning, kostnadseffektiv, og kompatibel med formalinfiksert parafin innebygd (FFPE) vevsprøver som kan gi små mengder forringet eller skadet DNA. Her beskriver vi fremstilling av strekkode og multipleksede DNA-biblioteker, etterfulgt av hybridisering baserte fangst av målrettede eksoner for påvisning av cancerassosierte mutasjoner i ferske og frosne FFPE-tumorer hos massivt parallelle sekvensering. Denne metoden muliggjør identifisering av sekvens mutasjoner, kopiere nummer endringer, og velg strukturelle rearrangements involverer alle målrettede gener. Målrettet ekson sekvense tilbyr than fordeler av høy gjennomstrømning, lav pris, og dype sekvens dekning, dermed overdragelse høy sensitivitet for å oppdage lavfrekvente mutasjoner.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Identifiseringen av "driver" tumor genetiske hendelser i viktige onkogener og tumor suppressor gener spiller en viktig rolle i diagnostisering og behandling av mange kreftformer en. Storskala forskningsinnsatsen utnytte massivt parallelle "neste-generasjons" sekvensering har aktivert identifisering av mange slike kreftrelaterte gener i de senere år to. Men disse sekvense plattformer vanligvis krever store mengder DNA isolert fra friske frosne vev, og dermed utgjør en stor begrensning for å karakterisere og analysere DNA mutasjoner fra bevarte vev, for eksempel formalinfiksert parafin innebygd (FFPE) tumorprøver. Bedre innsats for å effektivt og pålitelig karakteriserer "handlingsrettet" genomisk informasjon fra FFPE tumorprøver vil muliggjøre retrospektiv analyse av tidligere banked prøver og videre oppmuntre individualiserte tilnærminger til kreft ledelse.

Tradisjonelt molekylær diagnostic laboratorier har stolt på tidkrevende, lav gjennomstrømming metoder som Sanger-sekvensering og real-time PCR for DNA mutasjon profilering. Mer nylig har høyere gjennomstrømning metoder benytter multiplex PCR eller massespektrometrisk genotyping blitt utviklet for å undersøke tilbakevendende somatiske mutasjoner i viktige kreftgener 3-5. Disse metoder er imidlertid begrenset ved at bare forutbestemte "hotspot"-mutasjoner analyseres, noe som gjør dem uegnet for detektering av inaktiverende mutasjoner i tumorsuppressorgener. Massivt parallell sekvense tilbyr flere fordeler fremfor disse strategiene inkludert muligheten til å avhøre hele eksoner for både vanlige og sjeldne mutasjoner, evnen til å avsløre flere klasser av genomisk endringer som kopi nummer gevinster og tap, og større følsomhet i heterogene prøver 6, 7 . Hele genomsekvense representerer den mest omfattende tilnærming for mutasjon oppdagelse, selv om det er relativly dyrt og pådrar seg store beregnings krav til dataanalyse og lagring.

For kliniske applikasjoner, hvor bare en liten brøkdel av genomet kan være av klinisk interesse, har to spesielle nyvinninger i sekvensering teknologi vært transformative. Først gjennom hybridisering basert ekson fangst, kan man isolere DNA tilsvarende viktige kreftrelaterte gener for målrettet mutasjon profilering 8,. For det andre, gjennom ligation av molekylære strekkoder (dvs. DNA-sekvenser 6-8 nukleotider i lengde), kan man pool hundrevis av prøver per sekvense løp og fullt ut dra nytte av den stadig økende antall massivt parallelle sekvense instrumenter 10. Når kombinert, disse nyvinningene gjør at svulster å være profilert for lavere kostnader og høyere gjennomstrømning, med mindre beregningskrav 11. Videre, ved å omfordele sekvens dekning til bare de genene mest kritiske til den aktuelle applikasjonen, kan man oppnåddeve større sekvense dybde for høyere følsomhet for lave allel frekvens hendelser.

Her beskriver vi vår IMPACT analysen (Integrated Mutation Profilering av Actionkreft Targets), som benytter ekson fangst på strekkode sekvens bibliotek bassenger ved hybridisering ved hjelp av tilpassede oligonukleotider å fange opp alle protein-kodende eksoner og velg introner av 279 sentrale kreftrelaterte gener (Tabell 1 ). Denne strategien muliggjør identifisering av mutasjoner, indels, kopi nummer endringer, og velg strukturelle rearrangements involverer disse 279 genene. Vår metode er kompatibel med DNA isolert fra både fersk frosset og FFPE vev samt fine nål aspirates og andre cytologiske prøver.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

En. DNA og reagensklargjøring

Merk: Denne protokoll beskriver den samtidige behandling og analysering av 24 prøvene (for eksempel 12 tumor / normal-par), men kan bli tilpasset for mindre og større partier. DNA-prøver kan utlede fra FFPE eller fersk frosset vev, cytologiske prøver, eller blod. Vanligvis vil både tumor og normalt vev fra den samme pasient være profilert sammen for å skille somatiske mutasjoner fra arvet polymorfismer. Protokollen begynner umiddelbart etter DNA-ekstraksjon.

  1. Delmengde 50-250 ng (250 ng anbefales) av ekstrahert DNA per prøve, fortynnet i 1 x Tris-EDTA (pH 8,0) buffer til et sluttvolum på 50 ul, i separate Covaris rundbunnede rør.
  2. Skjær DNA på Covaris E220 instrumentet på følgende skjær innstillinger: 360 sek på 10 driftsfaktor, 175 PIP, og 200 sykluser per burst.
  3. Tine AMPure XP Perler (tabell 2) til romtemperatur. Smelte alt buffers og enzymer på is før det aktuelle trinn.

2. Bibliotek Forberedelse - Slutt Reparasjon Module

  1. Forbered slutten reparasjon mester mix i en steril mikrosentrifuge tube ved hjelp av følgende volumer per prøve: 10 pl av 10x NEBNext End Repair Reaction Buffer (tabell 2), 5 mL NEBNext End Repair Enzyme Mix (tabell 2), 35 mL sterilt nukleasefritt gratis H 2 O.
  2. Alikvot av 50 ul av hver skåret DNA inn i separate brønner i en 96-brønns plate. Tilsett 50 pl av den preparerte ende reparasjon konsentrat-blanding til hver reaksjon. Inkuber i en thermocycler i 30 min ved 20 ° C.

Tre. Innlegg End Repair Clean-up

  1. Legg 2x volum (200 mL) av AMPure XP Perler (tabell 2) til hver prøve, og pipetter forsiktig hele volumet opp og ned 10x bruker en multikanalpipette. Inkuber ved RT i 15 min.
  2. Sett på magnetstativet (tabell 2
  3. Fjern forsiktig og kast klar over tar seg ikke å forstyrre perler. Litt væske kan forbli i brønner.
  4. Med rør på stativet, tilsett 200 pl av nylaget 80% etanol til hver prøve og inkuber platen ved romtemperatur i 30 sek. Nøye, fjern etanol med pipette.
  5. Gjenta trinn 5, for totalt to etanol vasker. Sørg for all etanol har blitt fjernet. Fjern fra magnet-stativet og la det tørke ved RT i 5 min.
  6. Susp tørkede perler med 44,5 mL steril H 2 O. Forsiktig, pipette hele volumet opp og ned 10x blande grundig. Sikre perler ikke lenger er festet til siden av brønnen.
  7. Inkuber resuspendert perler ved RT i 2 min. Plasser på magnetisk stativ i 5 min inntil prøven synes klart.
  8. Forsiktig overføre 42 mL av klare væsken inneholder prøven til en ny brønn.
    Prosedyren kan trygt stoppes på dette step og prøvene lagres ved -20 ° C i opp til 7 dager. For å starte på nytt, tine frosne prøvene på is før du fortsetter.

4. Bibliotek Forberedelse - dA-Tailing Module

  1. Klargjør dA-Tailing mester mix i en steril mikrosentrifuge tube ved hjelp av følgende volumer per prøve: 5 mL av 10x NEBNext dA-Tailing Reaction Buffer (tabell 2), 3 mL (3'-5 'exo-) Klenow Fragment (Tabell 2 ).
  2. Legg 8 mL av den tilberedte dA-Tailing mester mix til hver brønn som inneholder 42 mL av end-reparert DNA. Inkuber i en thermocycler i 30 min ved 37 ° C.
  3. Utfør et innlegg dA-Tailing opprydding: Gjenta trinn 3.1 til 3.8 ved hjelp av 2x volum (100 mL) av perler, men resuspender i sterile H 2 O til et sluttvolum på 33,75 mL.
    Fremgangsmåten kan bli trygt stoppet på dette trinnet, og prøvene lagres ved -20 ° C i opp til 7 dager. For å starte på nytt, tine frosne prøvene på is før du fortsetter. </ Li>

5. Bibliotek Forberedelse - Adapter Ligation Module

  1. Klargjør Ligation konsentrat-blanding i et sterilt mikrosentrifugerør ved hjelp av de følgende volumer per prøve: 10 pl 5x NEBNext Hurtig ringsreaksjonen buffer (New England Biolabs, tabell 2), 5 pl T4 DNA Ligase Hurtig (tabell 2).
  2. Tilsett 15 pl av ligerings konsentrat-blanding til hver brønn inneholdende en dA-tailed DNA.
  3. Legg 1,25 mL av den aktuelle 25 uM NEXTflex strekkodet adapter (tabell 2) til hver brønn. Hver prøve bør få en egen strekkode-adapter. Inkuber i en thermocycler i 15 min ved 20 ° C.
  4. Utfør en stolpe adapter ligation clean-up: Gjenta trinn 3.1 til 3.8 ved hjelp av 1x volum (50 ul) av perlene, men resuspender i sterilt H2O til et sluttvolum på 50 pl.
  5. Gjenta trinn 03.01 til 03.08 for en andre 1x volum (50 mL) clean-up, men resuspender i sterile H 2 O til ensluttvolum på 23 pl.
    Fremgangsmåten kan bli trygt stoppet på dette trinnet, og prøvene lagres ved -20 ° C i opp til 7 dager. For å starte på nytt, tine frosne prøvene på is før du fortsetter.

6. Bibliotek Amplification

  1. Klargjør KAPA HiFi mester mix i en steril mikrosentrifuge tube ved hjelp av følgende volumer per sample: 25 mL 2x KAPA HiFi HS RM (tabell 2), 1 mL hver av 100 mikrometer Primer 1 og Primer 2 (Tabell 3).
  2. Legg 27 mL av konsentrat-blanding til hver brønn inneholdende ligeringsprodukt. Sett pipetten til 50 mL og forsiktig pipette hele volumet opp og ned 10x.
  3. Sett i thermocycler for de følgende PCR-sykluser: innledende denaturering i 45 sekunder ved 98 ° C, 10 sykluser på 15 sek ved 98 ° C, 30 sek ved 60 ° C, 30 sek ved 72 ° C og endelig forlengelse i 1 min ved 72 ° C.
  4. Utfør et innlegg forsterkning clean-up: Gjenta trinn 3.1 til 3.8 ved hjelp1x volum (50 ul) av AMPure XP perler, og resuspender i sterilt vann til et sluttvolum på 30 ul.
  5. Kvantifisere konsentrasjonen av hvert bibliotek ved hjelp Qubit bredt spekter analyse (Life Technologies, tabell 2) i henhold til produsentens instruksjoner.

7. Roche NimbleGen SeqCAP EZ Library Hybridisering, Wash, og Amplification

  1. Tine universelle og indeks oligonukleotid blokkere (Tabell 3), SeqCap EZ Bibliotek, og NimbleGen fangst komponenter (COT DNA, 2x hybridisering buffer, og hybridisering komponent A, Tabell 2) på is. Alle oligonukleotidprimersett blokkere er lagret i arbeids bestander av 1 mM. Vår SeqCap EZ Library er et spesialdesignet pool av fangst sonder omfatter alle protein-kodende eksoner av 279 kreftrelaterte gener, selv om andre tilpassede og katalogisere design kan brukes.
  2. Forbered en 1 mM pool av indeks oligonukleotid blokkere som tilsvarer den spesifikke strekkodet annonseaptor sekvenser som brukes i biblioteket forberedelse. Kombiner 1 pl av hver blokkering og virvle.
  3. I en ny steril 1,5 ml mikro tube, tilsett 5 mL av 1mg/ml COT DNA, 2 mL av en mM universell blocker og 2 mL av en mM pool av indeks oligonukleotid blokkere.
  4. Pool 24 strekkode bibliotekene i en enkelt reaksjon. Legg totalt 1-3 ug av samlet, strekkodet sekvensbibliotek (fremstilt ovenfor) i fangstblandingen. For 24 prøver, er 100 ng per prøve anbefales. Når sammenslåing svulster og matchet normale prøver, anbefales det at du legger mer svulst bibliotek (f.eks 100 ng per tumor og 50 ng per normal), slik at de blir sekvensert til større dybde på dekning.
  5. Lukkes rørets hetten og gjøre 15 til 20 hull i toppen av hetten med en 18-20 G eller mindre nål. Speed ​​Vac de forsterkede sample bibliotek / barneseng DNA / oligos i en DNA vakuum konsentrator på høy varme (60 ° C).
  6. Når tørket helt ned, rehydrere med 7,5 mL av 2x hybridnings-buffer og 3 pl av hybridisering komponent A. Røret skal nå inneholde følgende: 5 ug COT DNA, varierende ug amplifisert prøve bibliotek, 1,000 pmol av universal og indeks oligoer, 7,5 pl 2x hybridiserings-buffer, 3 ul hybridisering komponent A i en totalt volum på 10,5 pl.
  7. Dekker hullene i hetten med et lite stykke laboratorie-bånd. Vortex prøven i 10 sekunder og sentrifuge ved maksimal hastighet i 10 sek.
  8. Inkuber prøven ved 95 ° C i 10 minutter for å denaturere DNA, fulgt av sentrifugering ved maksimal hastighet i 10 sekunder ved romtemperatur.
  9. I en ny 0,2 ml PCR stripe rør, forberede 2,25 mL delmengde av SeqCap EZ Library fangst prober og 2,25 mL sterilt nukleasefritt gratis H 2 O og legge innholdet i trinn 7.7. Forsiktig pipette hele volumet opp og ned 10x.
  10. Inkuber i en termosykler ved 47 ° C i 48-96 timer. Sett og vedlikeholde termosykleren lokket temperatur til 57 ° C.
  11. Follave trinn i kapittel 6 i NimbleGen SeqCap EX Library SR Brukerveiledning v3.0 (tabell 2) for vasking og gjenvinning av den fangede DNA.
  12. Følger trinnene i kapittel 7 i Roche NimbleGen protokollen for forsterkning av fanget DNA med følgende endringer:
    • Bruk 2x KAPA HiFi Polymerase (tabell 2) i stedet for Phusion Høy Fidelity PCR Master Mix
    • Bruk 100/xM Primer 1 og Primer to oppført i tabell 3.
    • Kjør følgende PCR-betingelser: innledende denaturering ved 98 ° C i 30 sek, 11 sykluser av 98 ° C i 10 sek, 60 ° C i 30 sek, 72 ° C i 30 sekunder, og endelig forlengelse ved 72 ° C i 5 min . Hold ved 4 ° C.
  13. Kvantifisere konsentrasjonen av den forsterkede fanget DNA ved hjelp Qubit Høy følsomhet analysen (tabell 2) i henhold til produsentens instruksjoner.
  14. Analyser tatt DNA kvalitet ved hjelp av Agilent Bioanalysator DNA HS chip (tabell 2) i henhold til produsentens instruksjoner.
    • PCR utbytte bør være minst 100 ng (range samtidig inntar 100-1000 ng).
    • Den gjennomsnittlige fragment lengde bør være mellom 150-400 basepar.

8. Illumina Hi-Seq Sekvense

  1. Spe den forsterkede fanget DNA til 14:00, og laste prøven på ett kjørefelt av en Illumina HiSeq 2000 strømningscellen. Sequence parvise end 75 basepar leser i henhold til produsentens instruksjoner. I vår erfaring, er ett kjørefelt tilstrekkelig til å produsere 500-700x unik sekvens dekning per prøve over 279 gener for en pool av 24 prøver.
  2. Illumina programvare (Real Time Analysis) vil konvertere høyoppløselige bilder til klase intensiteter å basere samtaler og kvalitetspoeng. Bruk casava å Demultiplekse data i henhold til strekkode identitet og generere individuelle FASTQ filer for hver prøve.

9. Data Analysis

  1. Trim adapter sekvenser fra 3 'enden av sekvensen leser i FASTQ filer ved hjelp Cutadapt ( http://code.google.com/p/cutadapt/ ). Den minste overlappingslengde (-O-) er tre med en feilrate (-e) på 1%. Den minste basislengde for oppbevaring av parede leser etter trimming er 25.
  2. Rett sekvens leser til referanse menneskelige genom hg19 bruker Burrows-Wheeler Aligner verktøy (BWA) 12. Utfør etterbehandlingstrinn inkludert duplikat merking, lokale multippel sekvens omstilling, og basen kvalitet score rekalibrering ved hjelp av Genome Analysis Toolkit (GATK) i henhold til deres standard beste praksis ( http://www.broadinstitute.org/gatk/guide/topic? name = best-practices ) 13. Når profilering flere prøver fra samme pasient (f.eks matchet tumor og normal), bør lokale flersekvens omstilling være prestaMed i fellesskap. Utgangen av disse etterbehandlingstrinn er et eget BAM-fil for hver prøve, som inneholder all sekvens, kvalitet, og justering informasjon og kan lastes direkte inn i Integrative Genomics Viewer (IGV) for visualisering av leser og sekvensvarianter 14.
  3. Beregn sekvensresultattall ved hjelp av Picard verktøy ( http://picard.sourceforge.net/ ). Informative beregninger inkluderer justering rate, fragment størrelsesfordeling, GC-innhold knyttet skjevhet dekning, on-target capture spesifisitet, PCR duplisere rate, bibliotek kompleksitet, og mener målet dekning. Representative verdier er vist i figur 1. Allelfrekvensene på vanlige polymorfisme sider beregnet ved hjelp DepthOfCoverage fra GATK brukes til å overvåke forurensning fra urelatert DNA og for å sikre at matchet prøvene kom fra de samme pasientene.
    De følgende beregnings analyser er avhengig av tilstedeværelsen av matchettumor og normale prøver for påvisning av somatiske genetiske forandringer. Enestående svulster kan også bli analysert ved hjelp av en egen normal kontrollprøve, men de fleste somatiske mutasjoner kan ikke lett skilles fra arvet sekvensvarianter.
  4. Ring somatiske single nukleotid varianter (SNVs) for hver svulst-normal paret ved hjelp av en somatisk mutasjon som ringer, slik som muTect 15, SomaticSniper 16, eller Strelka 17. Vi bruker muTect med modifiserte filtreringskriterier, slik at for varianter med lav (null) allel teller i den normale prøven så lenge allele-frekvens er i det minste 5x større i tumoren. Varianter recurrently kalt i et panel av normale DNAS er fjernet som sannsynlig systematiske gjenstander av sekvensering eller justering. Hver SNV passerer filtrene er så nøye gjennomgått ved hjelp IGV.
  5. Ring somatiske indels for hver svulst-normal paret bruker algoritmer som SomaticIndelDetector 13, Dindel 18, eller SOAPindel 19
  6. Ekstrapolere kopi nummer status fra sekvensen dekning på målet eksoner. For hver enkelt prøve, utføre en Loess normalisering av bety sekvens dekning for alle måle eksoner, regresjon enn GC prosent. Juster-normaliserte dekning verdier ved å trekke Loess passform og legge prøven dekkende median dekning. Beregn forholdet i normalisert sekvens dekning på tvers av alle mål eksoner for tumor-normal parene. I fravær av et samsvarende normal prøve og / eller for å redusere støy, annet kjønnstilpassede diploidnormale kontroller mangler germline kopitallvarianter kan brukes. Bestem somatiske eksemplar nummer gevinster og tap basert på økning eller reduksjon i dekningsgrad.
  7. Ring somatiske rearrangements involverer kreftgener hvor minst en genomisk stoppunkt faller innenfor eller i nærheten av en målrettet intervall av genomet. Foreslåtte algoritmer inkluderer GASV 20, Breakdancer 21, CREST 22, og Dranger 23. Intrachromosomal inversjoner, slettinger og tandem duplikasjoner kan skilles ut fra den relative posisjon og orientering av støtte leser i uharmoniske par. Alle søker rearrangements bør manuelt gjennomgått ved hjelp IGV. Vi anbefaler eksperimentell validering av PCR og Sanger-sekvensering på tvers av de antatte omorganisering stoppunkter.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

En pool av 24 strekkode sekvens biblioteker (12 tumor-normal par) ble tatt med sonder som tilsvarer alle protein-kodende eksoner av 279 kreftgener og sekvensert som 2 x 75 bp leser på ett kjørefelt av en HiSeq 2000 flyt celle. Tumor og normale bibliotekene ble slått sammen i forholdet 2:1. Prøve ytelsesmål for en dam av frosne tumor DNA-prøver er vist i figur 1, inkluderer justeringshastighet, fragment størrelsesfordeling, på målinnfanging spesifisitet, og betyr target dekning. Eksempel somatiske mutasjoner, er innsettinger, slettinger og kopi nummer endringer vist i figur 2-4.

Figur 1
Figur 1. Representative tall i sekvensen resultattall. a) cluster tetthet og justering rate, b) mener målet dekning, > C) sette størrelsesfordeling, og d) fange spesifisitet. Klikk her for å se større bilde .

Fig. 2
Figur 2. Integrative Genomics Viewer (IGV) bilde som viser spesifisitet sekvens dekning på eksoner av EGFR i en lungekreft (øverst) og matchet normalt vev (nederst). Gray søylene representerer unik sekvens leser. Til høyre, er til stede i 24% av lyder i tumoren og 0% av lyder i den normale, noe som indikerer at det er en somatisk L858R aminosyresubstitusjon en heterozygot T> G-mutasjon. for å vise større bilde .

3 "fo: content-width =" 6in "src =" / files/ftp_upload/50710/50710fig3.jpg "width =" 600px "/>
Figur 3. Eksempler på indels i en kolorektal kreft svulst-normal pair:.. A) Somatisk frame innsetting i APC b) Somatisk frame sletting av 7 basepar i TP53 Klikk her for å se større bilde .

Figur 4
Figur 4. Kopier nummer endringer i en tumor-normal pair. Hvert datapunkt representerer en enkelt ekson fra 279 målgener. Kopier nummer gevinster og tap er utledes fra økning og reduksjon i tumor sekvens dekning. Klikk her for å se større bilde .

Tabell 1: Probe Design Funksjoner for Target Capture.

Totalt eksoner 4535
Totalt antall introner 14
SNPs * 1042
Totalt mål territorium 879 966 basepar
Total probe territorium 1.400.415 basepar

Tabell 2. Reagenser og Kits.

NavnReagens / Material Selskapet Katalognummer
NEBNext End Repair Module New England Biolabs E6050L
NEBNext dA-Tailing Module New England Biolabs E6053L
NEBNext Hurtig Ligation Module New England Biolabs E6056L
Agencourt AMPure XP Beckman Coulter Genomics
NEXTflex PCR-Free Strekkoder - 24 Bioo Scientific 514103
HiFi Library Amplification Kit Kapa Biosystems KK2612
COT Menneskelig DNA, Fluorometrisk Grade Roche Diagnostics 05 480 647 001
NimbleGen SeqCap EZ Hybridisering og Wash kit Roche NimbleGen 05 634 261 001
SeqCap EZ Bibliotek Baits Roche NimbleGen
QIAquick PCR Purification Kit Qiagen 28104
Qubit dsDNA Broad Range (BR) Assay Kit Life Technologies Q32850
Qubit dsDNA Høy følsomhet (HS) Assay Kit Life Technologies Q32851
Agilent DNA HS Kit Agilent Technologies 5067-4626, 4627
Agilent 2100 Bioanalyzer Agilent Technologies
Covaris E220 Covaris
Magnetisk Stand-96 Ambion AM10027
Illumina Hi-Seq 2000 Illumina

Tabell 3. Indeks Oligo-stopper og Grunning sekvenser.

TS-INV-HE Index to Blocker
TS-HE Universal Blocker AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT
TS-INV-HE Index en Blocker CAAGCAGAAGACGGCATACGAGATCGTGATGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT
CAAGCAGAAGACGGCATACGAGATACATCGGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT
TS-INV-HE Index tre Blocker CAAGCAGAAGACGGCATACGAGATGCCTAAGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT
TS-INV-HE Index fire Blocker CAAGCAGAAGACGGCATACGAGATTGGTCAGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT
TS-INV-HE Index fem Blocker CAAGCAGAAGACGGCATACGAGATCACTGTGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT
TS-INV-HE Index 6 Blocker CAAGCAGAAGACGGCATACGAGATATTGGCGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT
TS-INV-HE Index 7 Blocker CAAGCAGAAGACGGCATACGAGATGATCTGGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT
TS-INV-HE Index 8 Blocker CAAGCAGAAGACGGCATACGAGATTCAAGTGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT
TS-INV-HE Index 9 Blocker CAAGCAGAAGACGGCATACGAGATCTGATCGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT
TS-INV-HE Index 10 Blocker CAAGCAGAAGACGGCATACGAGATAAGCTAGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT
TS-INV-HE Index 11 Blocker CAAGCAGAAGACGGCATACGAGATGTAGCCGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT
TS-INV-HE Index 12 Blocker CAAGCAGAAGACGGCATACGAGATTACAAGGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT
TS-INV-HE Index 13 Blocker CAAGCAGAAGACGGCATACGAGATTTGACTGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT
TS-INV-HE Index 14 Blocker CAAGCAGAAGACGGCATACGAGATGGAACTGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT
TS-INV-HE Index 15 Blocker CAAGCAGAAGACGGCATACGAGATTGACATGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT
TS-INV-HE Index 16 Blocker CAAGCAGAAGACGGCATACGAGATGGACGGGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT
TS-INV-HE Index 18 Blocker CAAGCAGAAGACGGCATACGAGATGCGGACGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT
TS-INV-HE Index 19 Blocker CAAGCAGAAGACGGCATACGAGATTTTCACGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT
TS-INV-HE Index 20 Blocker CAAGCAGAAGACGGCATACGAGATGGCCACGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT
TS-INV-HE Index 21 Blocker CAAGCAGAAGACGGCATACGAGATCGAAACGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT
TS-INV-HE Index 22 Blocker CAAGCAGAAGACGGCATACGAGATCGTACGGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT
TS-INV-HE Index 23 Blocker CAAGCAGAAGACGGCATACGAGATCCACTCGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT
TS-INV-HE Index 25 Blocker CAAGCAGAAGACGGCATACGAGATATCAGTGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT
TS-INV-HE Index 27 Blocker CAAGCAGAAGACGGCATACGAGATAGGAATGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT
Primer 1 5'-AATGATACGGCGACCACCGAGATCT-3 '
Primer 2 5'-CAAGCAGAAGACGGCATACGAGAT-3 '

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Vår IMPACT analysen produserer en høy justering rente, høy på målet rente, høy target dekning, og høy sensitivitet for å påvise mutasjoner, indels, og kopiere tall endringer. Vi har vist evnen til vår IMPACT analysen til sekvens DNA fra både fersk frosset og arkivert FFPE prøver av lav DNA-inngang. Ved å utføre målrettet exon sekvensering av nøkkelcancerassosierte gener, kan man oppnå meget dype sekvens dekning for eksoner av disse mest kritiske gener derved å maksimere evnen til å oppdage lavfrekvente mutasjoner. Bruken av strekkoding og multipleksing muliggjør høyere gjennomstrømning, lavere kostnad per prøve, og lavere inn-mengder av DNA.

En fordel med den målrettede tilnærmingen er at det er mulig å optimalisere fangst prober slik at alle eksoner dekkes jevnt og tilstrekkelig for mutasjon deteksjon. Som vist i tabell 1, omfatter vår design 4535 eksoner i 279 gener. Etter iterative forbedringer tilvår konstruksjon, gir en typisk sekvense eksperiment ikke mer enn 2% av eksoner på mindre enn 20% av median dekning for hele prøven. Således, for en tumor sekvensert for å 500x sekvens dekning (et konservativt anslag som vist i figur 1),> 98% av eksoner vil bli dekket av> 100x dybde, noe som sikrer høy følsomhet for identifisering av lavfrekvente mutasjoner. Denne ensartethet av dekningen kan i stor grad tilskrives den fleksibiliteten i NimbleGen SeqCap system, der prober kan syntetiseres til forskjellige lengder i regioner med ulik nucleotide sammensetning. Vi har også med hell brukes individuelt syntetiserte biotinylerte oligonukleotider fra Integrerte DNA Technologies (IDT) for å legge til nytt innhold til vårt panel og for å øke dekningen av regionene som er vanskelige å fange og / eller sekvens. Ved også å fange velger introner av recurrently omorganiseres gener, er vi i stand til å identifisere strukturelle rearrangements produserer fusion gener selv når bare én fusion partner er fanget.

Dette målrettet sekvense tilnærmingen gjør besitter to hoved begrensninger i evnen til å oppdage "driver" genetiske forandringer i svulster. Først, er bare en brøkdel av genomet avhørt. Målrettet sekvensering er, av natur, begrenset. Etter hvert som nye kreftgener kommer ut systemagenom innsats, kan de hurtig tilsatt til en opptakspanel, men funksjonelt viktige mutasjoner kan mistes som ville bli detektert av hele genomet eller hel exome sekvensering. For det andre, er det begrenset til DNA-endringer. Påvisning av abnormt uttrykt transkripsjoner, romanen spleise isoformer, og genet fusjoner krever RNA-Seq eller lignende teknikker 24. Epigenetiske endringer som kromatin modifikasjoner og DNA metylering kan også spille viktige roller i tumorigenesis og tumorprogresjon. Som sekvensering teknologier fortsetter å øke, kan man tenke seg integrerte strategier ansette hele genomsekvensering, RNA-Seq og utfyllende som nærmerChes til omfattende karakterisere genetiske og epigenetisk make-up av enkelte svulster på rutinemessig basis 25. Som komplette integrerte strategier er for tiden kostnads-og beregnings uoverkommelige, målrettet sekvense presenterer et praktisk alternativ for å fange de mest fremtredende genomisk funksjoner for klinisk og translasjonell applikasjoner.

Vår protokollen forutsetter at svulster er sekvensert sammen matchet normalt vev tatt fra samme pasient. Hensikten med denne normal kontroll er å fastslå hvorvidt sekvensvarianter oppdaget i tumoren er arvet eller ervervet somatisk. I fravær av en matchet normal, kan man antyde at varianter forekommer på mutasjons hotspots (dvs. områder av tilbakevendende somatiske mutasjoner i andre kreftformer) er sannsynlig å være somatiske. Videre kan analyse av kopinummer gevinster og tap bli utført med en ikke-genetisk matchet diploid normal prøve. For alle andre nye genetiske forandringer, den simultanegående analyse av matchet normalt vev forenkler tolkningen av de resulterende mutasjon data og er sterkt anbefalt.

IMPACT protokollen beskrevet her demonstrerer konsistens og høy kvalitet ytelse for frosne prøvene. Vi har observert sporadisk variabilitet når du arbeider med FFPE, though. Avhengig av alder og kvalitet i FFPE-prøven, kan DNA bli alvorlig svekket eller kjemisk modifisert, og som et resultat kan gjengi sekvensering og analyse vanskelig 26.. Når det er sagt, har vi funnet disse eksperimentelle forhold til å være pålitelige for det store flertallet av FFPE. Vi har også med hell brukt denne protokollen til å karakterisere andre klinisk relevante prøver som biopsier, tynn nål aspirates, og cytologic prøver. Det er av denne grunn-fleksibilitet til å imøtekomme ulike typer prøver av variabel kvalitet, kvantitet, og heterogenitet-at denne metoden står å påvirke diagnosen end behandling av kreftpasienter i den kliniske arena.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Dr. Berger har mottatt konsulenthonorarer og forskningsmidler fra Stiftelsen Medicine, en kreftdiagnostikk selskap.

Acknowledgments

Vi takker Dr. Agnes Viale og MSKCC Genomics Kjerne Laboratory for teknisk assistanse. Denne protokollen ble utviklet med støtte fra Geoffrey Beene Cancer Research Center og Farmer Family Foundation.

Materials

Name Company Catalog Number Comments
NEBNext End Repair Module New England Biolabs E6050L  
NEBNext dA-Tailing Module New England Biolabs E6053L  
NEBNext Quick Ligation Module New England Biolabs E6056L  
Agencourt AMPure XP Beckman Coulter Genomics  
NEXTflex PCR-Free Barcodes – 24 Bioo Scientific 514103  
HiFi Library Amplification Kit KAPA Biosystems KK2612  
COT Human DNA, Fluorometric Grade Roche Diagnostics 05 480 647 001  
NimbleGen SeqCap EZ Hybridization and Wash kit Roche NimbleGen 05 634 261 001  
SeqCap EZ Library Baits Roche NimbleGen  
QIAquick PCR Purification Kit Qiagen 28104  
Qubit dsDNA Broad Range (BR) Assay Kit Life Technologies Q32850  
Qubit dsDNA High Sensitivity (HS) Assay Kit Life Technologies Q32851  
Agilent DNA HS Kit Agilent Technologies 5067-4626, 4627  
Agilent 2100 Bioanalyzer Agilent Technologies  
Covaris E220 Covaris  
Magnetic Stand-96 Ambion AM10027  
Illumina Hi-Seq 2000 Illumina  

DOWNLOAD MATERIALS LIST

References

  1. Stratton, M. R., Campbell, P. J., Futreal, P. A. The cancer genome. Nature. 458, (7239), 719-724 (2009).
  2. Meyerson, M., Gabriel, S., Getz, G. Advances in understanding cancer genomes through second-generation sequencing. Nat. Rev. Genet. 11, (10), 685-696 (2010).
  3. Thomas, R. K., Baker, A. C., Debiasi, R. M., et al. High-throughput oncogene mutation profiling in human cancer. Nat. Genet. 39, (3), 347-351 (2007).
  4. Macconaill, L. E., Campbell, C. D., Kehoe, S. M., et al. Profiling critical cancer gene mutations in clinical tumor samples. PLoS One. 4, (11), e7887 (2009).
  5. Dias-Santagata, D., Akhavanfard, S., David, S. S., et al. Rapid targeted mutational analysis of human tumours: a clinical platform to guide personalized cancer medicine. EMBO Mol. Med. 2, (5), 146-158 (2010).
  6. Macconaill, L. E., Van Hummelen, P., Meyerson, M., Hahn, W. C. Clinical implementation of comprehensive strategies to characterize cancer genomes: opportunities and challenges. Cancer Discov. 1, (4), 297-311 (2011).
  7. Taylor, B. S., Ladanyi, M. Clinical cancer genomics: how soon is now. J. Pathol. 223, (2), 318-326 (2011).
  8. Gnirke, A., Melnikov, A., Maguire, J., et al. Solution hybrid selection with ultra-long oligonucleotides for massively parallel targeted sequencing. Nat. Biotechnol. 27, (2), 182-189 (2009).
  9. Mamanova, L., Coffey, A. J., Scott, C. E., et al. Target-enrichment strategies for next-generation sequencing. Nat. Methods. 7, (2), 111-118 (2010).
  10. Craig, D. W., Pearson, J. V., Szelinger, S., et al. Identification of genetic variants using bar-coded multiplexed sequencing. Nat. Methods. 5, (10), 887-893 (2008).
  11. Wagle, N., Berger, M. F., Davis, M. J., et al. High-throughput detection of actionable genomic alterations in clinical tumor samples by targeted, massively parallel sequencing. Cancer Discov. 2, (1), 82-93 (2012).
  12. Li, H., Durbin, R. Fast and accurate short read alignment with Burrows-Wheeler transform. Bioinformatics. 25, (14), 1754-1760 (2009).
  13. Depristo, M. A., Banks, E., Poplin, R., et al. A framework for variation discovery and genotyping using next-generation DNA sequencing data. Nat. Genet. 43, (5), 491-498 (2011).
  14. Robinson, J. T., Thorvaldsdottir, H., Winckler, W., et al. Integrative genomics viewer. Nat. Biotechnol. 29, (1), 24-26 (2011).
  15. Cibulskis, K., Lawrence, M. S., Carter, S. L., et al. Sensitive detection of somatic point mutations in impure and heterogeneous cancer samples. Nat. Biotechnol. 31, (3), 213-219 (2013).
  16. Larson, D. E., Harris, C. C., Chen, K., et al. SomaticSniper: identification of somatic point mutations in whole genome sequencing data. Bioinformatics. 28, (3), 311-317 (2012).
  17. Saunders, C. T., Wong, W. S., Swamy, S., Becq, J., Murray, L. J., Cheetham, R. K. Strelka: Accurate somatic small-variant calling from sequenced tumor-normal sample pairs. Bioinformatics. 28, (14), 1811-1817 (2012).
  18. Albers, C. A., Lunter, G., Macarthur, D. G., Mcvean, G., Ouwehand, W. H., Din del Durbin, R. Accurate indel calls from short-read data. Genome Res. 21, (6), 961-973 (2011).
  19. Li, S., Li, R., Li, H., et al. Efficient identification of indels from short paired reads. Genome Res. 23, (1), 195-200 (2013).
  20. Sindi, S., Helman, E., Bashir, A., Raphael, B. J. A geometric approach for classification and comparison of structural variants. Bioinformatics. 25, (12), 222-230 (2009).
  21. Chen, K., Wallis, J. W., Mclellan, M. D., et al. BreakDancer: an algorithm for high-resolution mapping of genomic structural variation. Nat. Methods. 6, (9), 677-681 (2009).
  22. Wang, J., Mullighan, C. G., Easton, J., et al. CREST maps somatic structural variation in cancer genomes with base-pair resolution. Nat. Methods. 8, (8), 652-654 (2011).
  23. Drier, Y., Lawrence, M. S., Carter, S. L., et al. Somatic rearrangements across cancer reveal classes of samples with distinct patterns of DNA breakage and rearrangement-induced hypermutability. Genome Res. 23, (2), 228-235 (2012).
  24. Wang, Z., Gerstein, M., Snyder, M. RNA-Seq: a revolutionary tool for transcriptomics. Nat. Rev. Genet. 10, (1), 57-63 (2009).
  25. Roychowdhury, S., Iyer, M. K., Robinson, D. R., et al. Personalized oncology through integrative high-throughput sequencing: a pilot study. Sci. Transl. Med. 3, (111), 111ra121 (2011).
  26. Kerick, M., Isau, M., Timmermann, B., et al. Targeted high throughput sequencing in clinical cancer settings: formaldehyde fixed-paraffin embedded (FFPE) tumor tissues, input amount and tumor heterogeneity. BMC Med. Genomics. 4, 68 (2011).
Oppdager Somatiske genetiske forandringer i vevsprøver av Exon Capture og massivt parallelle Sekvense
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Won, H. H., Scott, S. N., Brannon, A. R., Shah, R. H., Berger, M. F. Detecting Somatic Genetic Alterations in Tumor Specimens by Exon Capture and Massively Parallel Sequencing. J. Vis. Exp. (80), e50710, doi:10.3791/50710 (2013).More

Won, H. H., Scott, S. N., Brannon, A. R., Shah, R. H., Berger, M. F. Detecting Somatic Genetic Alterations in Tumor Specimens by Exon Capture and Massively Parallel Sequencing. J. Vis. Exp. (80), e50710, doi:10.3791/50710 (2013).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter